Open Access

PP2A inhibitors suppress migration and growth of PANC-1 pancreatic cancer cells through inhibition on the Wnt/β-catenin pathway by phosphorylation and degradation of β-catenin

  • Authors:
    • Meng-Yao Wu
    • Xin Xie
    • Ze-Kuan Xu
    • Li Xie
    • Zheng Chen
    • Liu‑Mei  Shou
    • Fei-Ran Gong
    • Yu-Feng Xie
    • Wei Li
    • Min Tao
  • View Affiliations

  • Published online on: June 13, 2014     https://doi.org/10.3892/or.2014.3266
  • Pages: 513-522
  • Copyright: © Wu et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Cantharidin is an active constituent of mylabris, a traditional Chinese medicine, and presents strong anticancer activity in various cell lines. Cantharidin is a potent and selective inhibitor of serine/threonine protein phosphatase 2A (PP2A). Our previous studies revealed the prospect of application of cantharidin, as well as other PP2A inhibitors, in the treatment of pancreatic cancer. However, the mechanisms involved in the anticancer effect of PP2A inhibitors have not been fully explored. The Wnt/β‑catenin pathway is involved in cell migration and proliferation and participates in the progression of pancreatic cancer. If β‑catenin is phosphorylated and degraded, the Wnt/β‑catenin pathway is blocked. PP2A dephosphorylates β‑catenin and keeps the Wnt/β‑catenin pathway active. In the present study, we found that PP2A inhibitor treatment induced phosphorylation and degradation of β‑catenin. The suppression on the migration and growth of PANC‑1 pancreatic cancer cells could be attenuated by pretreatment with FH535, a β‑catenin pathway inhibitor. Microarray showed that PP2A inhibitor treatment induced expression changes in 13 of 138 genes downstream of the β‑catenin pathway. Real‑time PCR further confirmed that FH535 attenuated the expression changes induced by PP2A inhibitors in 6 of these 13 candidate genes. These 6 genes, VEGFB, Dkk3, KRT8, NRP1, Cacnalg and WISP2, have been confirmed to participate in the migration and/or growth regulation in previous studies. Thus, the phosphorylation- and degradation-mediated suppression on β‑catenin participates in the cytotoxicity of PP2A inhibitors. Our findings may provide insight into the treatment of pancreatic cancer using a targeting PP2A strategy.

Introduction

Pancreatic cancer is one of the most fatal solid malignancies, with a 5-year survival rate of only ~5%. There is no method for early detection of the cancer and most patients with localized cancer have no recognizable symptoms. As a result, most patients are not diagnosed until the cancer metastasizes to other organs (1). Less than 20% of patients are eligible for curative resection and, of those, most experience recurrence of the cancer. Thus, an effective treatment and therapy are essential (2).

Mylabris is the dried body of the Chinese blister beetle. The use of mylabris as a traditional Chinese medicine in the treatment of tumor can be traced back to >2,000 years ago and it is still used as a folk medicine today (3). The active constituent of mylabris is cantharidin (3). In our previous studies, we found that cantharidin presented cytotoxicity through NF-κB pathway-mediated apoptosis induction (4), JNK pathway-dependent growth inhibition (3,5) and suppression on migration in breast cancer cells (6). It remains unclear whether cantharidin, as well as other PP2A inhibitors, could suppress the migration of pancreatic cancer cells. Moreover, the mechanism involved in the migration inhibition induced by cantharidin remains unknown.

The conserved Wnt/β-catenin pathway regulates stem cell pluripotency and cell fate decisions during development (7,8). Previous studies presented the participation of Wnt/β-catenin pathway in cell migration and proliferation (9). In the absence of Wnt signal, β-catenin is phosphorylated by glycogen synthase kinase-3β (GSK-3β) and then degraded by the ubiquitin-proteasome system. When Wnt ligands bind to frizzled receptors, GSK-3β activity is inhibited and unphosphorylated β-catenin accumulates in the cytoplasm and translocates into the nucleus, where it acts as a transcription cofactor with T cell factor/lymphoid enhancer factor TCF/LEF (9) and regulates the transcription of a variety of the target genes (7,8). Dysregulation of Wnt/β-catenin signaling and altered transcription of β-catenin/TCF-regulated genes are found in many cancers (10), including pancreatic cancer (11).

Mechanistically, cantharidin has been shown to be a potent and selective inhibitor of serine/threonine protein phosphatase 2A (PP2A) (3). Our previous studies revealed that cantharidin, as well as other PP2A inhibitors, fulfilled their anticancer effect through inhibition of PP2A and subsequent activation of several kinase pathways (36). A previous study proved that PP2A dephosphorylates β-catenin. Treatment of colon cancer cells with classical PP2A inhibitor, okadaic acid (OA), increases the phosphorylation of β-catenin (12).

Therefore, in the present study, we investigated whether cantharidin, as well as other PP2A inhibitors, could suppress the migration and growth of pancreatic cancer cells through phosphorylation and degradation of β-catenin-mediated inhibition on the Wnt/β-catenin pathway.

Materials and methods

Cells and cultures

The human pancreatic cancer cell line PANC-1 was purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were maintained in DMEM medium (Gibco, Grand Island, NY, USA). Medium was supplemented with 10% fetal calf serum (Gibco), 100 U/ml penicillin and 100 mg/ml streptomycin at 37°C in a 5% CO2 incubator with humidified atmosphere. Cells were passaged every 2–3 days for exponential growth.

Reagents

Cantharidin, OA and SP600125 were purchased from Enzo Life Sciences International (Plymouth Meeting, PA, USA). Norcantharidin (NCTD) was purchased from Sigma (St. Louis, MO, USA). FH535 was purchased from Millipore (Billerica, MA, USA).

Wound healing assay

The cells were seeded in 96-well plates at a density of 1×104 cells/well and grown to confluence. The monolayer culture was then artificially scrape-wounded with a sterile micropipette tip to create a denuded zone (gap) of constant width. Each well was washed with phosphate-buffered saline (PBS) twice to remove the detached cells before treatment. Cells that had migrated to the wounded region were observed using an XDS-1B inverted microscope (MIC Optical & Electrical Instrument, Chongqing, China) and photographed (magnification, ×40). Images were captured at various time points to monitor the wound healing process. The wound areas were measured using ImageJ (NHI, Bethesda, MA, USA).

MTT assay

Cellular growth was evaluated by the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) assay (13). The cells were seeded into 24-well tissue culture plates at 5×104 cells/well. After treatment, MTT (Sigma) was added to each well at a final concentration of 0.5 mg/ml, followed by incubation at 37°C for 4 h. The medium was then removed and 800 μl dimethyl sulfoxide was added to each well. The absorbance of the mixture was measured at 490 nm using a microplate ELISA reader (Bio-Rad Laboratories, Hercules, CA, USA). The relative cell viability was calculated as follows: relative cell viability = (mean experimental absorbance/mean control absorbance) ×100%.

Western blot analysis

Total protein was extracted using a lysis buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 1 mM EDTA, supplemented with protease inhibitor cocktail kit (Roche, Indianapolis, IN, USA) and phosphatase inhibitor cocktail kit (Roche). The cytosol and nuclear extracts were prepared by NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology, Rockford, IL, USA), supplemented with protease inhibitor cocktail kit (Roche). The protein extract was loaded, size-fractionated by SDS-polyacrylamide gel electrophoresis and transferred to PVDF membranes (Bio-Rad Laboratories). After blocking, the membranes were incubated with primary antibodies at 4°C overnight. Rabbit anti-phospho-β-catenin (Thr41/Ser45) antibody was purchased from Santa Cruz Biotechnologies (Santa Cruz, CA, USA). Mouse anti-active-β-catenin (unphosphorylated Ser37/Thr41, clone 8E7) antibody was purchased from Millipore. Mouse anti-β-catenin was purchased from Cell Signaling Technology (Beverly, MA, USA). Rabbit anti-RPL38 and rabbit anti-histone H1 antibodies were purchased from Proteintech Group (Chicago, IL, USA). The protein expression was determined using horseradish peroxidase-conjugated antibodies followed by enhanced chemiluminescence (ECL; Millipore) detection. The intensity of the bands was captured by JS-1035 image analysis scanning system (Peiqing Science & Technology, Shanghai, China). RPL38 and histone H1 were used as internal controls for the total and nuclear extracts, respectively.

Microarray assay

Sample preparation and processing procedure were performed as described in detail in the Agilent GeneChip Expression Analysis Manual (Santa Clara, CA, USA). Differentially expressed genes were screened using Agilent 44K human whole-genome oligonucleotide microarrays. The selection criterion was defined as a >1.5-fold difference in the level of expression (difference in upregulated expression >1.5-fold and difference in downregulated expression <0.67-fold). Hierarchical clustering of samples was performed by average linkage algorithm using TIGR MultiExperiment Viewer (The Institute for Genomic Research, Rockville, MD, USA).

Real-time PCR

Total RNA was extracted using TRIzol reagent (Life Technologies) according to the manufacturer’s protocol. After spectrophotometric quantification, 1 μg total RNA was used for reverse transcription in a final volume of 20 μl with AMV reverse transcriptase (Promega) according to the manufacturer’s instructions. Aliquots cDNA of corresponding to equal amounts of RNA were used for the quantification of mRNA by real-time PCR using the LightCycler 96 real-time quantitative PCR detection system (Roche). The reaction system (25 μl) contained the corresponding cDNA, forward and reverse primers and SYBR-Green PCR Master Mix (Roche). All data were analyzed using RPL38 gene expression as an internal standard. The specific primers are presented in Table I.

Table I

Primers.

Table I

Primers.

GenesSense (5′-3′)Antisense (5′-3′)Product size (bp)
VEGFB GGACAGAGTTGGAAGAGGAGAC GGGAGGAAGAGCCAGTTGTA130
Dkk3 GGGAGGAGATGGAAACAATG ATGGAAAGAACTGCGTGGAA131
MYC CCTCCACTCGGAAGGACTATC TTGTGTGTTCGCCTCTTGAC142
KRT8 CAGGAGCTGATGAACGTCAA TCATGTTCTGCATCCCAGAC106
NRP1 GACAGAAACTGGATGCCTGAA CTTCCCACCCTGAATGATGA153
Cacnalg CACTCTCTGCCCAATGACAG ACAAGACGGAGCCTGACTGA109
WISP2 ACTCCCTGCCTACACACACAG TGCCTTCTCTTCATCCTACCC165
PTGS2 TAGGTGCATTGGAATCAAGC GGAGAAACGAAGTGATGAGAAGA105
BTRC GCAGTCCAACCCAGATTAGTG AAATGGCTCTCTTTCCGATACT135
DAB2 TGTGGCTTCTTCTCAACCTG TTATTCCTCTGGATGGTCTGC104
AHR ACGAGGTCAAGAGATGGAGAC TTCCCAGGTTCAGGCTATTC148
TIAM1 CTTCCCTCATCCCAGCAATA CCTCCTCCTCCCAAGAGACT120
UBXN8 GCAGCAAAGAGCCAGAACTT GGACATCGGAGAGCAACAGT143
RPL38 GCTGCTTGCTGTGAGTGTCT AGATTTGGCATCCTTTCGTC149
Statistical analysis

Each experiment was performed at least in triplicate. Results are expressed as the mean value ± standard deviation (SD). Statistical analysis was performed using an unpaired Student’s t-test. A P-value <0.05 was considered to indicate a statistically significant difference.

Results

Cantharidin suppresses cell migration through JNK pathway-independent manner

Previously, we found that cantharidin suppressed the proliferation of pancreatic cancer cells (3,5). However, whether cantharidin affects the migration of pancreatic cancer cells remains unknown. Thus, we investigated whether cantharidin suppresses the migration of pancreatic cancer PANC-1 cells using a wound healing assay. As shown in Fig. 1A, cantharidin suppressed the migration of PANC-1 cells in a time- and dose-dependent manner, suggesting the anticancer effect of cantharidin also involves the suppression on metastasis potential.

In our previous studies, cantharidin-induced activation of JNK suppressed pancreatic cancer cell growth (3,5). As the JNK pathway is also involved in the migration regulation (14), we investigated whether cantharidin suppressed migration of PANC-1 cells through activation of the JNK pathway. Treatment with SP600125, the inhibitor of JNK, time-dependently suppressed migration of PANC-1 cells, suggesting the basal activity of the JNK pathway promoted migration of pancreatic cancer cells. Notably, pretreatment with SP600125 did not attenuate the cantharidin-induced suppression on migration, but even strengthened the cantharidin-induced suppression of cell migration (Fig. 1B), suggesting the activation of JNK impaired the migration suppression of cantharidin.

PP2A inhibitors suppress the β-catenin pathway through phosphorylation-mediated degradation of β-catenin

Treatment with PP2A inhibitors, cantharidin, NCTD and OA, increased the phosphorylation level and decreased the nonphosphorylated form (active form) of β-catenin, accompanied by the reduction of total protein level of β-catenin (Fig. 2A). Blotting of nuclear protein proved the decreased nuclear distribution of β-catenin after treatment with PP2A inhibitors (Fig. 2B). These data suggested that PP2A inhibitors induced phosphorylation and degradation of β-catenin, which further resulted in the decreased nuclear translocation.

PP2A inhibitors suppress migration and growth of pancreatic cancer cells through suppression on β-catenin pathway

To investigate whether the suppression on the β-catenin pathway is involved in the anticancer effect of PP2A inhibitors, we used FH535, a classic Wnt/β-catenin inhibitor (15), to verify whether blocking Wnt/β-catenin could attenuate the migration and growth suppression caused by PP2A inhibitors. Treatment with FH535 suppressed the migration and growth of pancreatic cancer cells, suggesting β-catenin may participate in the progression of pancreatic cancer (Fig. 3A and B).

Cantharidin, NCTD and OA suppressed the migration and growth of pancreatic cancer cells, respectively. When cells were pretreated with FH535, the anti-migration and anti-growth effects of PP2A inhibitors were partially attenuated, suggesting that the anticancer effects of PP2A inhibitors were partially β-catenin pathway-dependent.

PP2A inhibitors induce expression changes of genes at the downstream of the β-catenin pathway

We performed microarray analyses to determine the mRNA expression changes of 138 genes downstream of β-catenin pathway (http://www.stanford.edu/group/nusselab/cgi-bin/wnt/target_genes) (Fig. 4A). Only those genes that significantly altered expression levels (by 1.5-fold) in all FH535, cantharidin and OA groups were chosen for further analysis. Of the 138 genes analyzed, 13 fulfilled this criterion (Fig. 4B).

We used real-time PCR to confirm the changes of these genes in the microarray analysis. Spearman’s rank correlation analysis revealed that the mRNA expression values obtained by real-time PCR correlated significantly with those obtained by microarray analysis for these 13 genes (P<0.01). The correlation coefficient R ranged between 0.828 and 0.896 (Fig. 4C).

PP2A inhibitors induce expression level changes of candidate genes through β-catenin pathway-dependent manner

To verify whether the expression changes of these 13 genes induced by PP2A inhibitors were executed through β-catenin pathway-dependent manner, the cells were pretreated with FH535, followed by treatment with PP2A inhibitors. As shown in Fig. 5, expression changes of 6 of these 13 genes, VEGFB, Dkk3, KRT8, NRP1, Cacnalg and WISP2, were attenuated by FH535 pretreatment, suggesting PP2A inhibitors downregulated these 6 genes in a β-catenin pathway-dependent manner.

Discussion

The Wnt/β-catenin pathway has been positively confirmed to regulate cell proliferation, migration, apoptosis, differentiation and stem cell self-renewal (16,17). As the indispensable mediator of classical Wnt signaling pathway, β-catenin participates in two distinct functions in the cell, depending on its localization. Membrane-localized β-catenin is isolated by the epithelial cell-cell adhesion protein E-cadherin to chronically maintain cell-cell adhesion (9). On the other hand, classical Wnt signaling pathway causes accumulation of β-catenin in cytoplasm in complex with the transcription factor TCF/LEF that regulates target gene expression (18,19). In the absence of Wnt signaling, the level of β-catenin is kept low through degradation of cytoplasmic β-catenin, which is targeted for phosphorylation and ubiquitination at Ser33/Ser37/Thr41 by GSK3β bound to a scaffolding complex of axin and adenomatous polyposis coli (APC) protein (20,21). Thus, the key factors in β-catenin signaling are its stabilization and accumulation in the cytoplasm.

This is a reflection of an evolving literature showing Wnt/β-catenin signaling has variable and sometimes paradoxical effects in the pancreas dictated by its timing, location, strength and mechanism of activation. Several investigators have demonstrated that β-catenin was essential for normal pancreatic development through the canonical Wnt signaling pathway, but this pathway is downregulated in adult pancreas (22). Although canonical activating mutations are uncommon, Wnt/β-catenin signaling can be dysregulated in pancreatic cancer through a variety of mechanisms that modulate existing levels of autocrine or paracrine Wnt activation. There is ample in vitro and in vivo evidence that Wnt/β-catenin signaling is involved in pancreatic cancer tumorigenesis. Aberration in canonical Wnt/β-catenin signaling activity has been documented in pancreatic cancer (23). Positive expression of nuclear and/or cytoplasmic β-catenin is reported in anywhere from 4 to 65% of human pancreatic ductal adenocarcinoma tumors (11) and up to 40% of pancreatic intraductal papillary mucinous neoplasms (24). Positive nuclear β-catenin distribution is also reported in advanced pancreatic intraepithelial neoplasia in human and mouse model (25,26). Retrospective studies reported alterations in β-catenin that correlate with tumor differentiation (27,28) metastasis (29,30) or patient survival (30,31). Heiser et al (32) demonstrated that enhanced Wnt/β-catenin signaling in itself could induce pancreatic tumorigenesis and activation of other oncogenes in the presence of enhanced Wnt/β-catenin signaling induced distinct pancreatic tumor formation. This dysregulation makes it evident that these changes have meaningful phenotypic effects on pancreatic cancer tumorigenesis. The direct inhibition of Wnt/β-catenin signaling by knockdown of β-catenin suppresses human pancreatic cancer cell growth and survival in vitro (26). Contrary to colon cancer, in which the genetic mutations are common, the manner in which Wnt/β-catenin signaling is activated and readily modulated in pancreatic cancer may also indicate that pancreatic cancer may be more amenable to genetic or pharmacological targeting of Wnt/β-catenin as clinical therapy (11).

β-catenin is the first identified target of PP2A-B56α. Overexpression of B56α decreased β-catenin expression in mammalian cells and Xenopus embryo explants (33). PP2A-B56α is thought to have targets within Axin1-mediated degradation complex for β-catenin and it has been found to be able to inhibit the Wnt signaling pathway (34). A previous study proved that the effect of aspirin on the Wnt/β-catenin pathway is mediated via PP2A (12). Aspirin treatment caused increased phosphorylation of Tyr307 of PP2A, an event associated with inhibition of PP2A enzymatic activity. Inhibition of PP2A resulted in phosphorylation of β-catenin and inhibition of β-catenin/TCF transcriptional activity. Although the phosphorylation-mediated degradation of β-catenin was not observed in this literature, these findings provided a molecular explanation for the efficacy of aspirin in chemoprevention of colorectal cancer and shows biochemical evidence that PP2A is an important regulator of Wnt/β-catenin pathway activity in colorectal cells. In our present study, PP2A inhibitors triggered phosphorylation and degradation of β-catenin in pancreatic cancer cells, suggesting inhibition of β-catenin pathway induced by inhibition of PP2A could be a promising way in cancer treatment.

To demonstrate whether cantharidin and other PP2A inhibitors suppress pancreatic cell migration by phosphorylation/degradation of β-catenin and alter expressions of genes downstream of the Wnt/β-catenin pathway, we firstly treated the pancreatic cancer cells with cantharidin and other PP2A inhibitors, and evaluated the migration and growth of the cells. Then, we determined the phosphorylation and protein levels of β-catenin and expression level changes of genes downstream of the Wnt/β-catenin pathway. We found that cantharidin and other PP2A inhibitors suppressed the migration of pancreatic cells through the Wnt/β-catenin pathway by phosphorylation/degradation of β-catenin. By using genome microarray technology and RT-PCR, we identified 6 candidate genes, VEGFB, NRP1, Dkk3, KRT8, Cacnalg and WISP2, at the downstream of PP2A/β-catenin pathway.

VEGFB is a prototype member of vascular endothelial growth factor (VEGF) family, which participates in both physiologic and pathologic angiogenesis (35). VEGFB has been found to be able to promote migration and invasion, but not proliferation or survival in pancreatic cancer cells (36). NRP1 has a protumorigenic role and direct contribution to tumor progression in some studies where NRP1 is predominantly expressed in epithelial cancer cells, including carcinomas of lung, breast, prostate, pancreas and colon and is implicated in the survival, migration and invasion of tumor cells (3740). NRPl overexpression is positively associated with metastatic potential, advanced stage, shorter 5-year survival rate and/or clinical grade in prostate (41), gastrointestinal (42) and colorectal carcinoma (43), suggesting a protumorigenic role of NRP1 and direct contribution of NRP1 to tumor progression. Dkk3 is involved in embryonic development through its interactions with the Wnt signaling pathway. Dkk3 maintains the pancreatic cancer cells in a dedifferentiated state. Knockdown of Dkk3 resulted in significant reduction of cellular proliferation and concomitant induction of cell cycle inhibitors, as well as pancreatic epithelial cell differentiation markers (44). KRT8 (Keratin 8) is a member of the type II keratin family and knockdown of KRT8 increased migration and invasiveness, but increased apoptosis in epithelial cancer cells through upregulation of Fas receptor (45). Cacnalg (Ca2+ channel, voltage-dependent, T-type, α 1G subunit) is expressed in various human tumors, including colon and pancreatic cancer and glioblastoma, as well as in acute myelogenous leukemia (46,47). Knockdown of Cacnalg decreased proliferation of astrocytoma, neuroblastoma, renal tumor (48), breast cancer (49) and glioblastoma (50) cells. WISP2 (Wnt-induced secreted proteins 2), one of the three Wnt inducible proteins that belongs to the CCN family, stimulates mitosis, adhesion, apoptosis, extracellular matrix production, growth arrest and migration of multiple cell types (51). Previous findings suggest that WISP2 is relevant to tumorigenesis and malignant transformation. Its roles in cancer appear to vary depending on cell type and the microenvironment (52) and promote invasiveness and growth in the circumstance of pancreatic cancer (53). As VEGFB, NRP1, Dkk3, KRT8, Cacnalg and WISP2 all participate in the migration and/or growth regulation, the PP2A/β-catenin pathway-mediated migration and growth inhibition induced by PP2A inhibitors could be executed through these 6 genes.

PP2A is generally considered to be a cancer suppressor. Inhibition of PP2A has been thought to be cancer promoting by induction of phosphorylation and activation of several substrate kinases, including c-Jun N-terminal kinase (JNK), extracellular signal-related kinase (ERK), p38, Akt and protein kinase C (PKC) amongst others, most of which can accelerate growth (5455). However, we previously reported some kinase-dependent anticancer pathways that are induced by treatment with PP2A inhibitors, which suggested that the activation of kinase pathways may not always be cancer promoting. These kinase-dependent anticancer mechanisms induced by PP2A inhibitors include JNK-dependent growth inhibition (5), NF-κB pathway-dependent apoptosis induction (4) and PKC-dependent downregulation of α2 integrin (6). In the present study, we confirmed that the phosphorylation-mediated inhibition of the β-catenin pathway participated in the migration and growth inhibition effect of PP2A inhibitors.

The JNK pathway, over-activation of which suppresses the growth of pancreatic cancer cells (5), fulfilled its positive effect on migration upon treatment with PP2A inhibitors. A similar phenomenon was also found in our previous studies. The activation of PKC decreased the expression of intergrin and suppressed the adhesion to platelet, which suppress the metastasis potential. However, the activation of PKC impaired the growth inhibition effect of PP2A inhibitors. These may be ascribed to the multiple-targeting effects of PP2A, i.e., an inhibition of PP2a may cause dysfunction of abundant pathways of PP2A and the anticancer effect of PP2A inhibitors is a joint function of several pathways. These also suggest that a signaling pathway may present opposite effects in different cellular processes, which may also be affected by several signal pathways.

In conclusion, we demonstrated that PP2A inhibitors suppressed pancreatic cancer cell migration and growth through the Wnt/β-catenin pathway by phosphorylation and further degradation of β-catenin. This may be attributed to the selective downregulation of genes downstream of the Wnt/β-catenin pathway. Our findings provide a promising strategy for treatment of pancreatic cancer by targeting PP2A using PP2A inhibitors.

Acknowledgements

This study was supported by grants from the National Natural Science Foundation of China (nos. 81101867, 81272542, 81200369 and 81372443), the China International Medical Foundation (CIMF-F-H001-057), the Scientific Research Project of Jiangsu Provincial Bureau of Traditional Chinese Medicine (L213236), the Medical Scientific Research Project of Jiangsu Provincial Bureau of Health (Z201206), the Special Foundation of Wu Jieping Medical Foundation for Clinical Scientific Research (nos. 320.6753.1225 and 320.6750.12242), the Science and Education for Health Foundation of Suzhou for Youth (nos. SWKQ1003 and SWKQ1011), the Scientific Research and Innovation Plan Project of Jiangsu Province for Postgraduate (CXLX13_838) and the Science and Technology Project Foundation of Suzhou (nos. SYS201112, SYSD2012137 and SYS201335).

References

1 

Wolfgang CL, Herman JM, Laheru DA, et al: Recent progress in pancreatic cancer. CA Cancer J Clin. 63:318–348. 2013. View Article : Google Scholar

2 

Paulson AS, Tran Cao HS, Tempero MA and Lowy AM: Therapeutic advances in pancreatic cancer. Gastroenterology. 144:1316–1326. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Li W, Xie L, Chen Z, et al: Cantharidin, a potent and selective PP2A inhibitor, induces an oxidative stress-independent growth inhibition of pancreatic cancer cells through G2/M cell-cycle arrest and apoptosis. Cancer Sci. 101:1226–1233. 2010. View Article : Google Scholar

4 

Li W, Chen Z, Zong Y, et al: PP2A inhibitors induce apoptosis in pancreatic cancer cell line PANC-1 through persistent phosphorylation of IKKα and sustained activation of the NF-κB pathway. Cancer Lett. 304:117–127. 2011.PubMed/NCBI

5 

Li W, Chen Z, Gong FR, et al: Growth of the pancreatic cancer cell line PANC-1 is inhibited by protein phosphatase 2A inhibitors through overactivation of the c-Jun N-terminal kinase pathway. Eur J Cancer. 47:2654–2664. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Shou LM, Zhang QY, Li W, et al: Cantharidin and norcantharidin inhibit the ability of MCF-7 cells to adhere to platelets via protein kinase C pathway-dependent downregulation of α2 integrin. Oncol Rep. 30:1059–1066. 2013.PubMed/NCBI

7 

Clevers H and Nusse R: Wnt/beta-catenin signaling and disease. Cell. 149:1192–1205. 2012. View Article : Google Scholar : PubMed/NCBI

8 

MacDonald BT, Tamai K and He X: Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell. 17:9–26. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Nelson WJ and Nusse R: Convergence of Wnt, beta-catenin, and cadherin pathways. Science. 303:1483–1487. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Fearon ER: PARsing the phrase ‘all in for Axin’-Wnt pathway targets in cancer. Cancer Cell. 16:366–368. 2009.

11 

White BD, Chien AJ and Dawson DW: Dysregulation of Wnt/β-catenin signaling in gastrointestinal cancers. Gastroenterology. 142:219–232. 2012.

12 

Bos CL, Kodach LL, van den Brink GR, et al: Effect of aspirin on the Wnt/β-catenin pathway is mediated via protein phosphatase 2A. Oncogene. 25:6447–6456. 2006.

13 

Carmichael J, DeGraff WG, Gazdar AF, Minna JD and Mitchell JB: Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res. 47:936–942. 1987.PubMed/NCBI

14 

Huang C, Jacobson K and Schaller MD: MAP kinases and cell migration. J Cell Sci. 117:4619–4628. 2004. View Article : Google Scholar : PubMed/NCBI

15 

Handeli S and Simon JA: A small-molecule inhibitor of Tcf/beta-catenin signaling down-regulates PPARgamma and PPARdelta activities. Mol Cancer Ther. 7:521–529. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Turashvili G, Bouchal J, Burkadze G and Kolar Z: Wnt signaling pathway in mammary gland development and carcinogenesis. Pathobiology. 73:213–223. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Yamaguchi TP: Heads or tails: Wnts and anterior-posterior patterning. Curr Biol. 11:R713–R724. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Tetsu O and McCormick F: Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature. 398:422–426. 1999. View Article : Google Scholar : PubMed/NCBI

19 

Clevers H: Wnt/beta-catenin signaling in development and disease. Cell. 127:469–480. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Polakis P: Wnt signaling and cancer. Genes Dev. 14:1837–1851. 2000.

21 

Takahashi-Yanaga F and Sasaguri T: GSK-3beta regulates cyclin D1 expression: a new target for chemotherapy. Cell Signal. 20:581–589. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Papadopoulou S and Edlund H: Attenuated Wnt signaling perturbs pancreatic growth but not pancreatic function. Diabetes. 54:2844–2851. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Zeng G, Germinaro M, Micsenyi A, et al: Aberrant Wnt/beta-catenin signaling in pancreatic adenocarcinoma. Neoplasia. 8:279–289. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Chetty R, Serra S, Salahshor S, et al: Expression of Wnt-signaling pathway proteins in intraductal papillary mucinous neoplasms of the pancreas: a tissue microarray analysis. Hum Pathol. 37:212–217. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Pasca di Magliano M, Biankin AV, Heiser PW, et al: Common activation of canonical Wnt signaling in pancreatic adenocarcinoma. PloS One. 2:e11552007.PubMed/NCBI

26 

Wang L, Heidt DG, Lee CJ, et al: Oncogenic function of ATDC in pancreatic cancer through Wnt pathway activation and beta-catenin stabilization. Cancer Cell. 15:207–219. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Lowy AM, Fenoglio-Preiser C, Kim OJ, et al: Dysregulation of beta-catenin expression correlates with tumor differentiation in pancreatic duct adenocarcinoma. Ann Surg Oncol. 10:284–290. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Joo YE, Rew JS, Park CS and Kim SJ: Expression of E-cadherin, alpha- and beta-catenins in patients with pancreatic adenocarcinoma. Pancreatology. 2:129–137. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Karayiannakis AJ, Syrigos KN, Polychronidis A and Simopoulos C: Expression patterns of alpha-, beta- and gamma-catenin in pancreatic cancer: correlation with E-cadherin expression, pathological features and prognosis. Anticancer Res. 21:4127–4134. 2001.PubMed/NCBI

30 

Li YJ, Wei ZM, Meng YX and Ji XR: Beta-catenin up-regulates the expression of cyclinD1, c-myc and MMP-7 in human pancreatic cancer: relationships with carcinogenesis and metastasis. World J Gastroenterol. 11:2117–2123. 2005. View Article : Google Scholar : PubMed/NCBI

31 

Qiao Q, Ramadani M, Gansauge S, Gansauge F, Leder G and Beger HG: Reduced membranous and ectopic cytoplasmic expression of beta -catenin correlate with cyclin D1 overexpression and poor prognosis in pancreatic cancer. Int J Cancer. 95:194–197. 2001. View Article : Google Scholar : PubMed/NCBI

32 

Heiser PW, Cano DA, Landsman L, et al: Stabilization of beta-catenin induces pancreas tumor formation. Gastroenterology. 135:1288–1300. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Seeling JM, Miller JR, Gil R, Moon RT, White R and Virshup DM: Regulation of beta-catenin signaling by the B56 subunit of protein phosphatase 2A. Science. 283:2089–2091. 1999. View Article : Google Scholar : PubMed/NCBI

34 

Li X, Yost HJ, Virshup DM and Seeling JM: Protein phosphatase 2A and its B56 regulatory subunit inhibit Wnt signaling in Xenopus. EMBO J. 20:4122–4131. 2001. View Article : Google Scholar : PubMed/NCBI

35 

Ferrara N, Gerber HP and LeCouter J: The biology of VEGF and its receptors. Nat Med. 9:669–676. 2003. View Article : Google Scholar : PubMed/NCBI

36 

Wey JS, Fan F, Gray MJ, et al: Vascular endothelial growth factor receptor-1 promotes migration and invasion in pancreatic carcinoma cell lines. Cancer. 104:427–438. 2005. View Article : Google Scholar : PubMed/NCBI

37 

Bielenberg DR, Pettaway CA, Takashima S and Klagsbrun M: Neuropilins in neoplasms: expression, regulation, and function. Exp Cell Res. 312:584–593. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Frankel P, Pellet-Many C, Lehtolainen P, et al: Chondroitin sulphate-modified neuropilin 1 is expressed in human tumour cells and modulates 3D invasion in the U87MG human glioblastoma cell line through a p130Cas-mediated pathway. EMBO Rep. 9:983–989. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Miao HQ, Lee P, Lin H, Soker S and Klagsbrun M: Neuropilin-1 expression by tumor cells promotes tumor angiogenesis and progression. FASEB J. 14:2532–2539. 2000. View Article : Google Scholar : PubMed/NCBI

40 

Wey JS, Gray MJ, Fan F, et al: Overexpression of neuropilin-1 promotes constitutive MAPK signalling and chemoresistance in pancreatic cancer cells. Br J Cancer. 93:233–241. 2005. View Article : Google Scholar : PubMed/NCBI

41 

Latil A, Bieche I, Pesche S, et al: VEGF overexpression in clinically localized prostate tumors and neuropilin-1 overexpression in metastatic forms. Int J Cancer. 89:167–171. 2000. View Article : Google Scholar : PubMed/NCBI

42 

Hansel DE, Wilentz RE, Yeo CJ, Schulick RD, Montgomery E and Maitra A: Expression of neuropilin-1 in high-grade dysplasia, invasive cancer, and metastases of the human gastrointestinal tract. Am J Surg Pathol. 28:347–356. 2004. View Article : Google Scholar : PubMed/NCBI

43 

Ochiumi T, Kitadai Y, Tanaka S, Akagi M, Yoshihara M and Chayama K: Neuropilin-1 is involved in regulation of apoptosis and migration of human colon cancer. Int J Oncol. 29:105–116. 2006.PubMed/NCBI

44 

Zenzmaier C, Hermann M, Hengster P and Berger P: Dickkopf-3 maintains the PANC-1 human pancreatic tumor cells in a dedifferentiated state. Int J Oncol. 40:40–46. 2012.PubMed/NCBI

45 

Fortier AM, Asselin E and Cadrin M: Keratin 8 and 18 loss in epithelial cancer cells increases collective cell migration and cisplatin sensitivity through claudin1 up-regulation. J Biol Chem. 288:11555–11571. 2013. View Article : Google Scholar : PubMed/NCBI

46 

Toyota M, Ho C, Ohe-Toyota M, Baylin SB and Issa JP: Inactivation of CACNA1G, a T-type calcium channel gene, by aberrant methylation of its 5′ CpG island in human tumors. Cancer Res. 59:4535–4541. 1999.PubMed/NCBI

47 

Lory P, Bidaud I and Chemin J: T-type calcium channels in differentiation and proliferation. Cell Calcium. 40:135–146. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Panner A and Wurster RD: T-type calcium channels and tumor proliferation. Cell calcium. 40:253–259. 2006. View Article : Google Scholar : PubMed/NCBI

49 

Taylor JT, Huang L, Pottle JE, et al: Selective blockade of T-type Ca2+channels suppresses human breast cancer cell proliferation. Cancer Lett. 267:116–124. 2008.PubMed/NCBI

50 

Zhang Y, Zhang J, Jiang D, et al: Inhibition of T-type Ca2+channels by endostatin attenuates human glioblastoma cell proliferation and migration. Br J Pharmacol. 166:1247–1260. 2012.PubMed/NCBI

51 

Brigstock DR: The CCN family: a new stimulus package. J Endocrinol. 178:169–175. 2003. View Article : Google Scholar : PubMed/NCBI

52 

Davies SR, Davies ML, Sanders A, Parr C, Torkington J and Jiang WG: Differential expression of the CCN family member WISP-1, WISP-2 and WISP-3 in human colorectal cancer and the prognostic implications. Int J Oncol. 36:1129–1136. 2010.PubMed/NCBI

53 

Aikawa T, Gunn J, Spong SM, Klaus SJ and Korc M: Connective tissue growth factor-specific antibody attenuates tumor growth, metastasis, and angiogenesis in an orthotopic mouse model of pancreatic cancer. Mol Cancer Ther. 5:1108–1116. 2006. View Article : Google Scholar

54 

Millward TA, Zolnierowicz S and Hemmings BA: Regulation of protein kinase cascades by protein phosphatase 2A. Trends Biochem Sci. 24:186–191. 1999. View Article : Google Scholar : PubMed/NCBI

55 

Janssens V, Goris J and Van Hoof C: PP2A: the expected tumor suppressor. Curr Opin Genet Dev. 15:34–41. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August-2014
Volume 32 Issue 2

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wu M, Xie X, Xu Z, Xie L, Chen Z, Shou LM, Gong F, Xie Y, Li W, Tao M, Tao M, et al: PP2A inhibitors suppress migration and growth of PANC-1 pancreatic cancer cells through inhibition on the Wnt/β-catenin pathway by phosphorylation and degradation of β-catenin. Oncol Rep 32: 513-522, 2014
APA
Wu, M., Xie, X., Xu, Z., Xie, L., Chen, Z., Shou, L. ... Tao, M. (2014). PP2A inhibitors suppress migration and growth of PANC-1 pancreatic cancer cells through inhibition on the Wnt/β-catenin pathway by phosphorylation and degradation of β-catenin. Oncology Reports, 32, 513-522. https://doi.org/10.3892/or.2014.3266
MLA
Wu, M., Xie, X., Xu, Z., Xie, L., Chen, Z., Shou, L., Gong, F., Xie, Y., Li, W., Tao, M."PP2A inhibitors suppress migration and growth of PANC-1 pancreatic cancer cells through inhibition on the Wnt/β-catenin pathway by phosphorylation and degradation of β-catenin". Oncology Reports 32.2 (2014): 513-522.
Chicago
Wu, M., Xie, X., Xu, Z., Xie, L., Chen, Z., Shou, L., Gong, F., Xie, Y., Li, W., Tao, M."PP2A inhibitors suppress migration and growth of PANC-1 pancreatic cancer cells through inhibition on the Wnt/β-catenin pathway by phosphorylation and degradation of β-catenin". Oncology Reports 32, no. 2 (2014): 513-522. https://doi.org/10.3892/or.2014.3266