Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
May-2014 Volume 33 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2014 Volume 33 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins

  • Authors:
    • Wenpeng Dong
    • Xianyue Wang
    • Shenghui Bi
    • Zhiguo Pan
    • Shenxi Liu
    • Hao Yu
    • Hua Lu
    • Xi Lin
    • Xiaowu Wang
    • Tao Ma
    • Weida Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Cardiovascular Surgery, Guangzhou General Hospital of Guangzhou Military Command, Guangzhou, Guangdong 510010, P.R. China, Intensive Care Unit, Guangzhou General Hospital of Guangzhou Military Command, Guangzhou, Guangdong 510010, P.R. China, Information Center, Guangzhou General Hospital of Guangzhou Military Command, Guangzhou, Guangdong 510010, P.R. China
  • Pages: 1161-1168
    |
    Published online on: February 28, 2014
       https://doi.org/10.3892/ijmm.2014.1680
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Resveratrol has been shown to exert anti-atherosclerotic effects. 5' AMP-activated protein kinase (AMPK) and monocyte chemotactic protein-1 (MCP-1) play key roles in foam cell formation, which is considered as the initiation of atherosclerosis. Thus, in this study, we investigated whether resveratrol inhibits foam cell formation by regulating lipid accumulation and inflammation. For this purpose, THP-1 cells were treated with 100 nM phorbol 12-myristate 13-acetate (PMA) to induce their differentiation into macrophages. The macrophages were then pre-treated with 2.5 µM resveratrol and subsequently with serum-free (SF) medium alone or SF medium containing lipopolysaccharide (LPS; 100 ng/ml) and oxidized low-density lipoprotein (ox-LDL; 50 µg/ml) for 24 h to detect foam cell formation. To detect the expression of lipid accumulation-related proteins, the macrophages were treated with resveratrol. For the detection MCP-1 expression, the macrophages were treated with LPS and resveratrol, or with resveratrol alone. We incubated the THP-1-derived macrophages in resveratrol (2.5 µM) for 6 h in the presence or absence of 30 µM compound C for 4 h to detect the influence of compound C on the effects of resveratrol. The foam cells were examined using Red O staining. Gene expression levels were determined by qRT-PCR, western blot analysis and ELISA; lipid analysis was carried out by high-performance liquid chromatography (HPLC). The results revealed that resveratrol effectively suppressed foam cell formation induced by LPS. Resveratrol also suppressed lipid accumulation and downregulated the mRNA expression of peroxisome proliferator-activated receptor (PPAR)γ and PPARα, but had no effect on the expression of PPARβ/δ. Resveratrol also upregulated the expression of AMPK and Silent information regulator T1 (SIRT1). However, the effects of resveratrol on SIRT1, PPARγ and PPARα expression and lipid accumulation were reversed when the cells were pre-treated with compound C. Resveratrol downregulated the mRNA expression of MCP-1 in a dose-dependent manner and LPS upregulate its expression in a time-dependent manner. MCP-1 expression induced by LPS was inhibited by resveratrol at both the transcriptional and translational level. These data suggest that resveratrol inhibits foam cell formation by regulating the expression of MCP-1 and activating the AMPK-SIRT1-PPAR signaling pathway; thus, resveratrol may be a novel therapeutic agent for atherosclerosis.

Introduction

Atherosclerosis is a chronic inflammatory disease characterized by inflammatory infiltrates and lipid accumulation (1). It is known that monocytes play an important role in the progression of the disease (2,3). Monocytes first migrate into the arterial tissue in response to locally produced chemokines and then differentiate into macrophages. These macrophages act to augment the expression of several pattern recognition receptors, leading to the accumulation of cholesterol and lipids; thse cells then become foam cells (4–6). Therefore, inflammatory infiltrates and the accumulation of cholesterol and lipids in macrophages is a key point in the initiation of atherosclerosis.

Over the past decade, the search for natural compounds with the ability to prevent atherosclerosis has been a main focus for many investigators. Several lines of evidence suggest that resveratrol, a plant-derived polyphenol and phytoalexin, exhibits cardioprotective and anti-inflammatory properties (7–10). In the current study, we investigated the potential atheroprotective, anti-inflammatory and lipid-lowering effects of resveratrol. The oral administration of resveratrol has been shown to affect lipid profiles and inflammation markers (11). However, the precise mechanisms involved remain unclear.

The balanced flow of lipids into and out of macrophages is necessary to avoid lipid overload, and ultimately, foam cell formation (12). 5′ AMP-activated protein kinase (AMPK) is an important serine/threonine kinase well known for regulating cellular energy levels by balancing nutrient availability and energy demand through its control of several proteins involved in glucose and lipid metabolism (13,14). Recent evidence has shown a promising role for AMPK in the attenuation of atherosclerosis and vascular dysfunction (14). Resveratrol can activate the AMPK pathway in adipose tissue (15). In addition, it has been demonstrated that resveratrol exerts cardiometabolic effects by increasing AMPK expression and the level of Silent information regulator T1 (SIRT1) (16).

Conventional risk factors for atherosclerosis trigger an inflammatory response in the artery wall, mediated by complex molecular interactions in which chemokines play a critical role (17). Monocyte chemotactic protein-1 (MCP-1) is a potent chemoattractant for monocytes and plays a pivotal role in early atherogenesis by promoting monocyte infiltration to lesion-prone areas and penetrates between endothelial cells into the inner arterial space (18,19). MCP-1 is synthesized by endothelial cells and monocytes in response to diverse stimuli, including interleukins and oxidized low-density lipoprotein (ox-LDL) (18). Lipopolysaccharide (LPS) is thought to be involved in cardiovascular disease, as it contributes to the development of arterial plaques through activated pro-inflammatory pathways by secreting cytokines, including MCP-1 (20,21). The mechanisms which have been suggested to be responsible for the anti-inflammatory effects of resveratrol, include the inhibition of MCP-1 production (22).

In this study, we investigated the effects of resveratrol on foam cell formation, as well as on the expression of MCP-1 and AMPK in macrophages in order to elucidate the mechanisms involved in its anti-atherosclerotic effects. In addition, the expression of SIRT1 and nuclear peroxisome proliferator-activated receptors (PPARs) was detected. The results of this study provide important information regarding the initiation and prevention of atherosclerosis.

Materials and methods

Materials

Resveratrol, Oil Red O and compound C were purchased from Sigma-Aldrich, St. Louis, MO, USA; antibodies directed against phospho-AMPKα (Thr172), AMPK, SIRT1 and β-actin were from Cell Signaling Technology, Danvers, MA, USA; Texas-Red-conjugated goat anti-mouse secondary antibody was obtained from Molecular Probes, Eugene, OR, USA; LPS, phorbol 12-myristate 13-acetate (PMA) and TRIzol reagent were from Sigma-Aldrich; the cDNA Synthesis kit was obtained from Fermentas, St. Leon-Rot, Germany; the SYBR Premix Ex Taq™ II kit was purchased from Takara Bio Inc., Otsu, Japan; the Human MCP-1 ELISA kit was from R&D Systems, Minneapolis, MN, USA; the BCA kit was from Pierce, Rockford, IL, USA; and Agilent 1100 series HPLC system was from Agilent Technologies, Palo Alto, CA, USA.

Preparation of ox-LDL

Human LDL was purified from the fresh plasma of healthy donors by sequential centrifugation, according to the method described in the study by Feng et al (23) with some modifications. In order to produce ox-LDL, 200 μg/ml LDL were exposed to 20 μM CuSO4 in phosphate-buffered saline (PBS) for oxidation and the reaction was terminated with 40 μM butylhydroxytoluene in ethanol. ox-LDL was then dialyzed against culture medium and sterile-filtered.

Cell culture

The human monocytic cell line, THP-1 (ATCC, Rockville, MD, USA), was grown in RPMI-1640 supplemented with 10% (v/v) fetal bovine serum (FBS), 0.05 mM 2-mercaptoethanol, 10 mM HEPES, 1 mM sodium pyruvate, 4.5 g/l glucose and 1.5 g/l bicarbonate at 37°C in an atmosphere containing 5% CO2. The THP-1 cells were stimulated by a 48-h exposure to 100 nM PMA to induce their differentiation into adherent macrophages. Differentiated THP-1 macrophages were extensively washed in PBS before being used in experiments.

Resveratrol treatment

A stock concentration of 100 mM resveratrol in 50% DMSO was produced fresh each time and diluted in culture medium to the desired concentration. The controls received the same amount of DMSO.

Foam cell formation assay

The experiments were performed in serum-free (SF) experimental medium. The THP-1 cells were pre-treated with 2.5 μM of resveratrol or the control (DMSO) for 1 h. Subsequently, both the control and resveratrol-treated groups were treated with SF medium alone or SF medium containing LPS (100 ng/ml) and ox-LDL (50 μg/ml) for 24 h. The formation of foam cells was determined by Oil Red O staining. The cells were fixed with 4% formaldehyde for 15 min. Cell lipids were stained with Oil Red O (3 mg/ml in 60% isopropanol) for 10 min, then observed under a microscope.

Quantitative reverse transcription PCR (qRT-PCR)

Total cellular RNA was extracted from the THP-1-derived macrophages using TRIzol reagent in accordance with the manufacturer’s instructions, and dissolved in nuclease-free water, prior to being reverse-transcribed to synthesize first-strand cDNA with oligo(dT) primer using the cDNA Synthesis kit. To correct for differences in cDNA loading among the samples, the target PCRs were normalized to a reference PCR involving the endogenous housekeeping gene, β-actin. Non-template controls were included for each primer pair to check for any significant levels of contaminants. A melting-curve analysis was performed to assess the specificity of the amplified PCR products. qRT-PCR was performed using the FastStart SYBR-Green reagent kit according to the manufacturer’s instructions. The reaction conditions followed the instructions provided by the manufacturer of the SYBR Premix Ex Taq II kit using gene-specific primers for MCP-1, SIRT1, PPARs and β-actin (Table I).

Table I

Primer sequences used in qRT-PCR.

Table I

Primer sequences used in qRT-PCR.

GenePrimer sequence (5′→3′)
β-actinF: GATCATTGCTCCTCCTGAGC
R: ACTCCTGCTTGCTGATCCAC
SIRT1F: GAGTGGCAAAGGAGCAGA
R: TCTGGCATGTCCCACTATC
PPARγF: GCAGTGGGGATGTCTCATAATGC
R: CAGGGGGGTGATGTGTTTGAA
PPARβ/δ F: AATGCCTACCTGAAAAACTTCAAC
R: GTGCACGCTGATTCCTTGT
PPARαF: GAGAAAGCAAAACTGAAAGCAGAGA
R: GAAGGGCGGGTTATTGCTG
MCP-1F: AGCCACCTTCATTCCCCAAG
R: CTCCTTGGCCACAATGGTCT

[i] SIRT1, Silent information regulator T1; PPAR, peroxisome proliferator-activated receptor; MCP-1, monocyte chemotactic protein-1; F, forward, R, reverse.

Lipid analysis by high-performance liquid chromatography (HPLC)

Cellular total cholesterol and triglyceride contents were analyzed by lipid analysis by HPLC. Briefly, the cells were washed 3 times in PBS and lysed by the addition of 0.9% NaOH solution. Protein concentration was measured using the BCA kit. Masterol was used as a standard curve first, and the extraction procedure was then repeated. Samples were dissolved in 100 μl of isopropanol-acetonitrile (v/v, 20:80), followed by incubation in an ultrasonic water at room temperature for 5 min. Finally, the samples were placed in the Agilent 1100 series HPLC system.

Western blot analysis

Protein concentrations were determined using bovine serum albumin (BSA) as a standard protein with the BCA protein assay. The same amounts of total proteins (15–20 μg/lane) were loaded onto each lane and transferred to nitrocellulose membranes at 80 V for 1 h. After blocking for 4 h in 5% skim milk, the membranes were incubated overnight at 4°C with a 1:1,000 dilution of primary antibody. Following incubation with the corresponding secondary antibody, signals were detected using a chemiluminescent detection system and quantified using Quantity One analysis software.

ELISA

To evaluate the produced levels of MCP-1, the THP-1-derived macrophages were pre-treated with resveratrol (10 μM) for 1 h and then treated with LPS (10 μM) for 6 h. Supernatants from the treated cells were collected and analyzed for MCP-1 using a sandwich ELISA kit according to the manufacturer’s instructions.

Data analysis

All results are expressed as the means ± standard deviation (SD). All data were evaluated using SPSS 11.0 software. A typical image from at least 3 similar experiments is presented. Statistical analysis were carried out using t-tests. A value of P<0.05 was considered to indicate a statistically significant difference.

Results

Resveratrol inhibits foam cell formation

We investigated foam cell formation in response to exposure to LPS. As evidenced by Oil Red O staining, in the presence of ox-LDL, the typical formation of foam cells was observed (Fig. 1A-II vs. A-I). Resveratrol effectively suppressed the foam cell formation induced by LPS (Fig. 1A-III vs. A-II). We investigated intracellular lipid accumulation by HPLC. LPS at 100 ng/ml without LDL loading increased lipid accumulation in the macrophages (Fig. 1B, LPS vs. SF medium, solid bars). In the presence of ox-LDL (50 μg/ml) loading, LPS further increased lipid accumulation in the macrophages (Fig. 1B, LPS ox-LDL vs. ox-LDL, solid bars). These observations led us to hypothesize that resveratrol may inhibit foam cell formation by regulating lipid accumulation.

Figure 1

Resveratrol inhibits LPS-induced foam cell formation. THP-1-derived macrophages were cultured in the absence or presence of resveratrol then treated with LPS (100 ng/ml) containing ox-LDL (50 μg/ml) for 24 h. (A) Foam cell was analyzed through Oil-red O staining, and photographed at a magnification of ×400. (B) Cholesterol ester was assayed as described in Materials and methods. Results are described as the means ± SD of duplicate wells of 6 experiments. *P<0.05 vs. group treated with serum-free (SF) medium; #P<0.05 resveratrol vs. the corresponding control group; +P<0.05 vs. the ox-LDL group.

Resveratrol inhibits lipid accumulation through SIRT1 and PPARs

SIRT1 reduces the accumulation of fatty acids by suppressing the expression of PPAR-γ (24). PPAR-γ is one of the PPAR family members, which comprises 3 isotypes: PPARα, PPARγ and PPARβ/δ (25), PPARs play a central role in the regulation of adipogenesis (26). Resveratrol is an activator of SIRT1 (27). Thus, this prompted us to investigate whether resveratrol regulates lipid accumulation through SIRT1-PPARs.

To investigate the effects of resveratrol on SIRT1 and PPAR expression, the THP-1-derived macrophages were treated with resveratrol (2.5 μM) for 6 h. As shown in Fig. 2A, resveratrol significantly upregulated the mRNA expression of SIRT1 (P<0.05), and there were analogous results obtained by western blot analysis (Fig. 2B).

Figure 2

Effects of resveratrol on SIRT1 expression. THP-1-derived macrophages were treated (6 h) with resveratrol (2.5 μM). mRNA and protein levels were examined at 0, 2, 4 and 6 h of resveratrol treatment. (A) Effect of resveratrol on SIRT1 mRNA expression. Data are the means ± SEM; n=6. *P<0.05 vs. control. (B) Effect of resveratrol on SIRT1 protein expression. *P<0.05 vs. control.

We then detected the expression of PPARs. As shown in Fig. 3, resveratrol significantly downregulated the mRNA expression of PPARγ (P<0.05). As regards PPARα, resveratrol also significantly downregulated the mRNA expression (P<0.05). By contrast, resveratrol had no effect on the mRNA expression of PPARβ/δ (P<0.05), suggesting that resveratrol regulates lipid accumulation through SIRT1-PPARs.

Figure 3

Effects of resveratrol on PPAR expression. Effect of resveratrol on PPAR mRNA expression, THP-1-derived macrophages were treated (6 h) with resveratrol (2.5 μM). Data are the means ± SEM; n=6. *P<0.05 vs. control.

Resveratrol regulates SIRT1-PPARs through AMPK

As shown by our results, resveratrol regulates the expression of SIRT1 and PPARs; however, the mechanisms involved are not yet clear. AMPK, which acts upstream of SIRT1, controls several proteins involved in glucose and lipid metabolism (13,14). The activation of AMPK activates catabolic pathways, generating ATP, and ‘switches off’ a number of processes that consume ATP, such as fatty acid, protein, or cholesterol synthesis (28,29); AMPK also enhances SIRT1 activity (30,31).

To investigate the effects of resveratrol on AMPK, the THP-1-derived macrophages were treated with resveratrol (2.5 μM) for 6 h. The phosphorylated isoform is the active AMPK form; thus, we determined the phosphorylated AMPK/total AMPK protein ratio. Resveratrol significantly increased the phosphorylated AMPK/total AMPK protein ratio; this increase demonstrated that AMPK was significantly activated by resveratrol (Fig. 4), suggesting that resveratrol regulates SIRT1-PPARs through AMPK.

Figure 4

Effects of resveratrol on activation of AMPK. Effect of resveratrol on activation of AMPK. THP-1-derived macrophages were treated (6 h) with resveratrol (2.5 μM). Phosphorylated (p)-AMPK and total AMPK expression was examined at 0, 2, 4 and 6 h of resveratrol treatment. *P<0.05 vs. control.

Effects of AMPK inhibition on SIRT1 and PPAR expression and lipid accumulation

To verify our hypothesis, we evaluated the effects of AMPK inhibition (using compound C) on SIRT1 and PPAR expression and lipid accumulation following incubation of THP-1-derived macrophages in resveratrol (2.5 μM) for 6 h in the presence or absence of 30 μM compound C for 4 h. Our results revealed that pre-treatment with 30 μM compound C for 4 h inhibited the resveratrol-induced increase in SIRT1 expression and blocked the suppression of PPARγ/PPARα expression by resveratrol (Fig. 5A and B). We also examined lipid accumulation; the suppression of lipid accumulation following treatment with resveratrol was reversed when the cells were pre-treated with 30 μM compound C (Fig. 5C).

Figure 5

Effect of the AMPK inhibition in the SIRT1, PPAR expression and lipid accumulation. THP-1-derived macrophages incubated in resveratrol (2.5 μM) for 6 h in the presence or absence of 30 μM compound C for 4 h. (A) Effect of compound C on the expression of SIRT1. (B) Effect of compound C in the expression of PPARs. (C) Effect of compound C on lipid accumulation. *P<0.05 vs. control; #P<0.05 vs. resveratrol.

Resveratrol blocks LPS-induced MCP-1 expression

Given the well-documented anti-inflammatory effects of resveratrol, we focused on the effects of resveratrol on LPS-induced MCP-1 expression in THP-1-derived macrophages. Resveratrol downregulated the mRNA expression of MCP-1 in a dose-dependent manner (Fig. 6A). As shown in Fig. 6B, MCP-1 mRNA expression increased following treatment with LPS in a time-dependent manner. Pre-treatment with 10 μM resveratrol markedly inhibited the mRNA expression of MCP-1 induced by LPS (Fig. 6C). The induced expression of MCP-1 was determined by ELISA (Fig. 7). Compared to the control group, LPS induced a statistically significant upregulation of MCP-1 expression (P<0.05), and resveratrol downregulated the LPS-induced MCP-1 expression. MCP-1 expression which was induced by LPS was inhibited by resveratrol at both the transcriptional and translational level. These results demonstrate that resveratrol inhibits foam cell formation by regulating inflammatory cytokine (MCP-1) production.

Figure 6

Effect of resveratrol on LPS-induced MCP-1 mRNA expression. (A) Effect of resveratrol on MCP-1 expression, THP-1-derived macrophages were treated (6 h) with resveratrol (1–100 μM). (B) LPS-induced MCP-1 expression, THP-1-derived macrophages were treated (24 h) with LPS (10 μg/ml). (C) Effect of resveratrol on LPS-induced MCP-1 expression, THP-1-derived macrophages were pre-treated with resveratrol (10 μM) for 1 h then treated with LPS (10 μM) for 6 h. Data are the means ± SEM; n=6. *P<0.05 vs. control.

Figure 7

Effect of resveratrol on LPS-induced secretion of MCP-1. THP-1-derived macrophages were pretreated with resveratrol (10 μM) for 1 h then treated with LPS (10 μM) for 6 h. The concentration of MCP-1 in the culture medium was determined by ELISA. Results are the means ± SD. *P<0.05 compared to control cells (NC).

Discussion

Cardiovascular disease, which is currently the leading cause of death and illness in developed countries, is a preeminent health issue worldwide (32). Atherosclerosis, a progressive inflammatory disease, produces arterial plaques characterized by inflammatory infiltrates, lipid accumulation, cell death and fibrosis (2,3,33). Monocytes play an important role in the progression of the disease. Monocytes first migrate, and then differentiate into macrophages. Inflammatory infiltrates and the accumulation of cholesterol and lipids in macrophages allows them to become foam cells; this is a key point in the initiation of atherosclerosis.

Resveratrol is a polyphenol found in grapes, berries and peanuts. It inhibits macrophage activation (34), one of the most important steps in atherosclerosis, as well as lipid accumulation (34,35). In addition, resveratrol has been suggested to exert anti-atherosclerotic effects (36). However, the precise mechanisms responsible for the anti-atherosclerotic effects of resveratrol remain unclear.

In this study, we found that THP-1-derived macrophages treated with LPS and ox-LDL together resulted in the typical formation of foam cells and resveratrol effectively suppressed the foam cell formation induced by LPS. Based on our findings, we suggest that resveratrol exerts anti-atherosclerotic effects by suppressing foam cell formation. Experiments on the effects of lipid deposition in THP-1-derived macrophages treated with resveratrol, revealed that the cellular total cholesterol content was suppressed by resveratrol, suggesting that resveratrol protects against atherosclerosis by inhibiting lipid accumulation.

AMPK regulates cellular energy levels by balancing nutrient availability and energy demand through its control of several proteins involved in glucose and lipid metabolism (13). SIRT1 is one of the 7 mammalian homologs of the Sir2 family that catalyzes NAD+-dependent protein deacetylation (37). Both AMPK and SIRT1 have emerged as interesting targets as they are heavily involved in catabolic metabolism, mitochondrial activation, angiogenesis and enhanced cell survival (37–40). PPARs are central regulators of adipogenesis (25). Previous studies have shown that resveratrol negatively modulates PPARγ protein levels in 3T3-L1 adipocytes (41) and it is known that resveratrol affects both SIRT1 and AMPK (42). The data from these studies, as well as ours, suggest that resveratrol regulates lipid metabolism through the AMPK-SIRT1-PPAR signaling pathway.

In this study, we found that AMPK was significantly activated by resveratrol and that resveratrol markedly upregulated the expression of SIRT1 both at the mRNA and protein level. In addition, resveratrol markedly downregulated the mRNA expression of PPARγ and PPARα, but not that of PPARβ/δ. When the cells were pre-treated with the AMPK inhibitor, compound C, the effects of resveratrol on SIRT1, PPARγ and PPARα expression, as well as on lipid accumulation were reversed, suggesting that resveratrol suppresses lipid accumulation through the AMPK-SIRT1-PPARγ/PPARα signaling pathway.

Inflammatory infiltrates in macrophages are a key to foam cell formation. Thus, we hypothesized that resveratrol may suppress foam cell formation by regulating inflammatory cytokines. We selected MCP-1, a potent chemoattractant for monocytes. MCP-1 has been shown to be overexpressed in human and experimental atheroma, and can recruit mononuclear phagocytes that characteristically accumulate in the nascent atheroma (32,43). A recent study demonstrated that LPS induces the expression of MCP-1 (44). Despite the evidence of a prominent role of MCP-1 in the development of atherosclerosis, and although resveratrol has been shown to inhibit the production of various types of inflammatory cytokines (34,45), few studies have investigated the direct effects of resveratrol on MCP-1. In this study, we found that resveratrol downregulated the expression of MCP-1 in a dose-dependent manner in THP-1-derived macrophages and that LPS induced MCP-1 expression in THP-1-derived macrophages in a time-dependent manner. Most importantly, we found that pre-treatment of THP-1-derived macrophages with resveratrol significantly blocked MCP-1 mRNA expression induced by LPS. Therefore, we speculate that resveratrol plays a role in anti-atherosclerosis by inhibiting the expression of MCP-1.

In conclusion, our results demonstrate that resveratrol suppresses the foam cell formation induced by LPS. Resveratrol inhibits foam cell formation by regulating the expression of the inflammatory cytokine, MCP-1, and by activating the AMPK-SIRT1-PPAR signaling pathway. These results suggest that resveratrol may be a novel therapeutic agent for atherosclerosis.

Acknowledgements

This study was supported by a grant from the Natural Science Foundation of China (no. 81200633).

References

1 

Andersson J, Libby P and Hansson GK: Adaptive immunity and atherosclerosis. Clin Immunol. 134:33–46. 2010. View Article : Google Scholar

2 

Hansson GK: Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 352:1685–1695. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Weber C, Zernecke A and Libby P: The multifaceted contributions of leukocyte subsets to atherosclerosis: lessons from mouse models. Nat Rev Immunol. 8:802–815. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Boring L, Gosling J, Cleary M and Charo IF: Decreased lesion formation in CCR2−/− mice reveals a role for chemokines in the initiation of atherosclerosis. Nature. 394:894–897. 1998. View Article : Google Scholar : PubMed/NCBI

5 

Gu L, Okada Y, Clinton SK, et al: Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell. 2:275–281. 1998. View Article : Google Scholar : PubMed/NCBI

6 

Edfeldt K, Swedenborg J, Hansson GK and Yan ZQ: Expression of toll-like receptors in human atherosclerotic lesions: a possible pathway for plaque activation. Circulation. 105:1158–1161. 2002.PubMed/NCBI

7 

Fan EG, Zhang LJ, Jiang S and Bai YH: Beneficial effects of resveratrol on atherosclerosis. J Med Food. 11:610–614. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Palmieri D, Pane B, Barisione C, et al: Resveratrol counteracts systemic and local inflammation involved in early abdominal aortic aneurysm development. J Surg Res. 171:e237–246. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Prasad K: Natural products in regression and slowing of progression of atherosclerosis. Curr Pharm Biotechnol. 11:794–800. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Zhu X, Liu Q, Wang M, et al: Activation of Sirt1 by resveratrol inhibits TNF-alpha induced inflammation in fibroblasts. PLoS ONE. 6:e270812011. View Article : Google Scholar : PubMed/NCBI

11 

Militaru C, Donoiu I, Craciun A, Scorei ID, Bulearca AM and Scorei RI: Oral resveratrol and calcium fructoborate supplementation in subjects with stable angina pectoris: effects on lipid profiles, inflammation markers, and quality of life. Nutrition. 29:178–183. 2013. View Article : Google Scholar

12 

Voloshyna I, Hai O, Littlefield MJ, Carsons S and Reiss AB: Resveratrol mediates anti-atherogenic effects on cholesterol flux in human macrophages and endothelium via PPAR gamma and adenosine. Eur J Pharmacol. 698:299–309. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Vingtdeux V, Chandakkar P, Zhao H, Davies P and Marambaud P: Small-molecule activators of AMP-activated protein kinase (AMPK), RSVA314 and RSVA405, inhibit adipogenesis. Mol Med. 17:1022–1030. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Fullerton MD, Steinberg GR and Schertzer JD: Immunometabolism of AMPK in insulin resistance and atherosclerosis. Mol Cell Endocrinol. 366:224–234. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Siriwardhana N, Kalupahana NS, Cekanova M, LeMieux M, Greer B and Moustaid-Moussa N: Modulation of adipose tissue inflammation by bioactive food compounds. J Nutr Biochem. 24:613–623. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Crandall JP and Barzilai N: Exploring the promise of resveratrol: where do we go from here? Diabetes. 62:1022–1023. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Coll B, Alonso-Villaverde C and Joven J: Monocyte chemoattractant protein-1 and atherosclerosis: is there room for an additional biomarker? Clin Chim Acta. 383:21–29. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Charo IF and Taubman MB: Chemokines in the pathogenesis of vascular disease. Circ Res. 95:858–866. 2004. View Article : Google Scholar : PubMed/NCBI

19 

McLaren JE, Michael DR, Ashlin TG and Ramji DP: Cytokines, macrophage lipid metabolism and foam cells: implications for cardiovascular disease therapy. Prog Lipid Res. 50:331–347. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Kallio KA, Buhlin K, Jauhiainen M, et al: Lipopolysaccharide associates with pro-atherogenic lipoproteins in periodontitis patients. Innate Immun. 14:247–253. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Vink A, Schoneveld AH, van der Meer JJ, et al: In vivo evidence for a role of toll-like receptor 4 in the development of intimal lesions. Circulation. 106:1985–1990. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Park D-W, Kim J-S, Chin B-R and Baek S-H: Resveratrol inhibits inflammation induced by heat-killed Listeria monocytogenes. J Med Food. 15:788–794. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Feng X, Zhang Y, Xu R, et al: Lipopolysaccharide up-regulates the expression of Fcalpha/mu receptor and promotes the binding of oxidized low-density lipoprotein and its IgM antibody complex to activated human macrophages. Atherosclerosis. 208:396–405. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Winnik S, Stein S and Matter CM: SIRT1 - an anti-inflammatory pathway at the crossroads between metabolic disease and atherosclerosis. Curr Vasc Pharmacol. 10:693–696. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Semple RK, Chatterjee VK and O’Rahilly S: PPAR gamma and human metabolic disease. J Clin Invest. 116:581–589. 2006. View Article : Google Scholar : PubMed/NCBI

26 

dos Costa CS, Rohden F, Hammes TO, et al: Resveratrol upregulated SIRT1, FOXO1, and adiponectin and downregulated PPARgamma1–3 mRNA expression in human visceral adipocytes. Obes Surg. 21:356–361. 2011.PubMed/NCBI

27 

Nimmagadda VK, Bever CT, Vattikunta NR, et al: Overexpression of SIRT1 protein in neurons protects against experimental autoimmune encephalomyelitis through activation of multiple SIRT1 targets. J Immunol. 190:4595–4607. 2013.

28 

Cantó C, Jiang LQ, Deshmukh AS, et al: Interdependence of AMPK and SIRT1 for metabolic adaptation to fasting and exercise in skeletal muscle. Cell Metab. 11:213–219. 2010.PubMed/NCBI

29 

Hardie DG: AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy. Nat Rev Mol Cell Biol. 8:774–785. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Canto C, Gerhart-Hines Z, Feige JN, et al: AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature. 458:1056–1060. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Costford SR, Bajpeyi S, Pasarica M, et al: Skeletal muscle NAMPT is induced by exercise in humans. Am J Physiol Endocrinol Metab. 298:E117–E126. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Libby P: Inflammation in atherosclerosis. Nature. 420:868–874. 2002. View Article : Google Scholar

33 

Hansson GK and Libby P: The immune response in atherosclerosis: a double-edged sword. Nat Rev Immunol. 6:508–519. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Park D-W, Baek K, Kim J-R, et al: Resveratrol inhibits foam cell formation via NADPH oxidase 1-mediated reactive oxygen species and monocyte chemotactic protein-1. Exp Mol Med. 41:171–179. 2009. View Article : Google Scholar : PubMed/NCBI

35 

Li H, Song Y, Li F, et al: Identification of lipid droplet-associated proteins in the formation of macrophage-derived foam cells using microarrays. Int J Mol Med. 26:231–239. 2010.PubMed/NCBI

36 

Hou X, Xu S, Maitland-Toolan KA, et al: SIRT1 regulates hepatocyte lipid metabolism through activating AMP-activated protein kinase. J Biol Chem. 283:20015–20026. 2008. View Article : Google Scholar : PubMed/NCBI

37 

Lagouge M, Argmann C, Gerhart-Hines Z, et al: Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell. 127:1109–1122. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM and Puigserver P: Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature. 434:113–118. 2005. View Article : Google Scholar : PubMed/NCBI

39 

Reverchon M, Cornuau M, Cloix L, et al: Visfatin is expressed in human granulosa cells: regulation by metformin through AMPK/SIRT1 pathways and its role in steroidogenesis. Mol Hum Reprod. 19:313–326. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Morita Y, Wada-Hiraike O, Yano T, et al: Resveratrol promotes expression of SIRT1 and StAR in rat ovarian granulosa cells: an implicative role of SIRT1 in the ovary. Reprod Biol Endocrinol. 10:142012. View Article : Google Scholar : PubMed/NCBI

41 

Picard F, Kurtev M, Chung N, et al: Sirt1 promotes fat mobilization in white adipocytes by repressing PPAR-gamma. Nature. 429:771–776. 2004. View Article : Google Scholar : PubMed/NCBI

42 

Baur JA, Pearson KJ, Price NL, et al: Resveratrol improves health and survival of mice on a high-calorie diet. Nature. 444:337–342. 2006. View Article : Google Scholar : PubMed/NCBI

43 

von Grote EC, Venkatakrishnan V, Duo J and Stenken JA: Long-term subcutaneous microdialysis sampling and qRT-PCR of MCP-1, IL-6 and IL-10 in freely-moving rats. Mol Biosyst. 7:150–161. 2011.PubMed/NCBI

44 

Wang J, Si Y, Wu C, et al: Lipopolysaccharide promotes lipid accumulation in human adventitial fibroblasts via TLR4-NF-kappaB pathway. Lipids Health Dis. 11:1392012. View Article : Google Scholar

45 

Culpitt SV, Rogers DF, Fenwick PS, et al: Inhibition by red wine extract, resveratrol, of cytokine release by alveolar macrophages in COPD. Thorax. 58:942–946. 2003. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Dong W, Wang X, Bi S, Pan Z, Liu S, Yu H, Lu H, Lin X, Wang X, Ma T, Ma T, et al: Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins. Int J Mol Med 33: 1161-1168, 2014.
APA
Dong, W., Wang, X., Bi, S., Pan, Z., Liu, S., Yu, H. ... Zhang, W. (2014). Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins. International Journal of Molecular Medicine, 33, 1161-1168. https://doi.org/10.3892/ijmm.2014.1680
MLA
Dong, W., Wang, X., Bi, S., Pan, Z., Liu, S., Yu, H., Lu, H., Lin, X., Wang, X., Ma, T., Zhang, W."Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins". International Journal of Molecular Medicine 33.5 (2014): 1161-1168.
Chicago
Dong, W., Wang, X., Bi, S., Pan, Z., Liu, S., Yu, H., Lu, H., Lin, X., Wang, X., Ma, T., Zhang, W."Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins". International Journal of Molecular Medicine 33, no. 5 (2014): 1161-1168. https://doi.org/10.3892/ijmm.2014.1680
Copy and paste a formatted citation
x
Spandidos Publications style
Dong W, Wang X, Bi S, Pan Z, Liu S, Yu H, Lu H, Lin X, Wang X, Ma T, Ma T, et al: Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins. Int J Mol Med 33: 1161-1168, 2014.
APA
Dong, W., Wang, X., Bi, S., Pan, Z., Liu, S., Yu, H. ... Zhang, W. (2014). Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins. International Journal of Molecular Medicine, 33, 1161-1168. https://doi.org/10.3892/ijmm.2014.1680
MLA
Dong, W., Wang, X., Bi, S., Pan, Z., Liu, S., Yu, H., Lu, H., Lin, X., Wang, X., Ma, T., Zhang, W."Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins". International Journal of Molecular Medicine 33.5 (2014): 1161-1168.
Chicago
Dong, W., Wang, X., Bi, S., Pan, Z., Liu, S., Yu, H., Lu, H., Lin, X., Wang, X., Ma, T., Zhang, W."Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins". International Journal of Molecular Medicine 33, no. 5 (2014): 1161-1168. https://doi.org/10.3892/ijmm.2014.1680
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team