Determining molecular markers for osteoporosis may be valuable for improving the quality of life of affected elderly patients by aiding in early detection and disease management. In the present study, the association between single nucleotide polymorphisms (SNPs) of the vitamin D receptor (
Osteoporosis is a disease associated with the human aging process, and consequently it primarily occurs in the elderly population (
For the present study, 105 postmenopausal Thai female volunteers with osteoporosis aged 56–88 years (mean age, 73.1±8.9 years) and 132 healthy Thai postmenopausal female volunteers aged 41–88 years (mean age, 63.4±8.7) were recruited from Thammasat Hospital, Pathum Thani, and Ramathibodi Hospital, Bangkok, Thailand between May 2013 and January 2014. All osteoporosis subjects were confirmed by orthopaedic physicians from Thamasat and Ramathibodi Hospitals. BMD measurement at the LS and hip was performed by dual energy X-ray absorptiometry (DXA). LS-BMD of patients with osteoporosis was 0.71±0.11 g/cm2 and the LS T-score was −2.59±1.00 g/cm2, while the total hip BMD T-score was 0.61±0.09 g/cm2 and the total hip T-score was 2.08±0.81 g/cm2 (
Peripheral blood samples (5 ml) were collected from all subjects in EDTA tubes (Corning Life Sciences, Tewksbury, MA, USA). The samples were centrifuged to obtain the buffy coat (1,000 × g for 10 min at room temperature). Genomic DNA was extracted from the buffy coat fraction by phenol/chloroform extraction (
DNA extracted from osteoporosis and healthy Thai postmenopausal females was genotyped at the
All DNA samples were also genotyped at the −290C>T (rs9525641), −643C>T (rs9533156) and −693G>C (rs9533155) polymorphisms of
To confirm the sequence of each genotype from PCR-RFLP, 12 samples per SNP were randomly selected for sequence analysis. Briefly, each PCR product was purified using a PCR purification kits (Qiagen GmbH, Hilden, Germany). Purified products were sent to AITbiotech Pte Ltd. (Singapore) for sequencing using forward primers of each genotype.
The deviation from Hardy-Weinberg equilibrium at the P<0.05 level was calculated by comparing χ2 values between the expected and the observed values for genotype counts to evaluate the consistency of genotype frequencies for the normal controls. Allele and genotype frequency was compared between patients with osteoporosis and control subjects. Odds ratios (OR), 95% confidence intervals (CIs) and P-values were used as parameters to compare the frequency of an SNP with the risk of osteoporosis. The three SNPs of each gene were analysed in haplotype blocks. The PLINK v1.07 program (
The genotyping data is summarized in
As displayed in
The allele frequencies are displayed in
For the −290C>T SNP, the OR (95% CI) of CC, as the susceptibility genotype, was 0.96 (0.41–2.20; P=0.91), while the OR (95% CI) of CT, as the susceptibility genotype, was 1.24 (0.72–2.15; P=0.41) in the patients with osteoporosis. The OR (95% CI) of the minor C allele, as the susceptibility allele, was 1.10 (0.74–1.62; P=0.62). For the −643C>T SNP, the OR (95% CI) of CC, as the susceptibility genotype, was 0.75 (0.33–1.67; P=0.44), while the OR (95% CI) of CT, as the susceptibility genotype, was 1.31 (0.76–2.27; P=0.30). The OR (95% CI) of the minor C allele, as the susceptibility allele, was 0.99 (0.67–1.46; P=0.97). For the −693G>C SNP, the OR (95% CI) of GG, as the susceptibility genotype, was 0.74 (0.31–1.75; P=0.46), while of CG, as the susceptibility genotype, was 1.29 (0.75–2.23; P=0.33). The OR (95%) of the minor allele G, as the susceptibility allele, was 1.00 (0.68–1.48; P=0.99).
Models of inheritance of each SNP in VDR were determined as follows: for the
Models of inheritance of each SNP in
Haplotype analysis of SNPs
There are numerous factors associated with osteoporosis, including age, nutrition, hormones and genetics (
A number of studies have demonstrated association of other
The authors are grateful to the Center of Excellence in Molecular Genetics of Cancer and Human Diseases, Chulalongkorn University, Bangkok, Thailand, for providing the facility to perform this study. The current work was included as part of the Thesis of Master Degree of Mananya Techapatiphandee, which has been deposited in the database of Chulalongkorn University, Bangkok, Thailand.
The current study was supported by the 90th Anniversary of Chulalongkorn University Fund (Ratchadaphiseksomphot Endowment Fund; grant no. 9020561125) and the Ratchadapisek Sompoch Endowment Fund 2013, Chulalongkorn University (grant no. CU-56-467-HR).
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
MT performed experiments, analysed data and wrote the first draft of the manuscript. NT acted as the clinician who diagnosed osteoporosis and collected the clinical samples. AW and RT analysed data. PY wrote the proposal for grants, designed the study, analysed data and revised the manuscript.
The study was approved by the ethical committees of Ramathibodi Hospital (approval no. 04-54-44) and Thammasart Hospital (approval no. MTU-EC-OT-4-087/56) and informed consent was obtained from all participating subjects.
All participating subjects consented to the publication of relevant data.
The authors declare that they have no competing interests.
Primer sequences with annealing temperature and restriction enzymes used for genotyping.
Single nucleotide polymorphism | Primer sequence, 5′-3′ | Enzyme for RFLP | Product size, bp |
---|---|---|---|
Vitamin D receptor gene | |||
rs731236 | F: TGGTGGGATTGAGCAGTGAG | Uncut: 249 | |
Cut: 101/148 | |||
R: GTACTGCTTGGAGTGCTCCT | |||
rs1544410 | F: AACCTGAAGGGAGACGTAGCA | Uncut: 283 | |
Cut: 200/83 | |||
R: TTGTACCCTGCCCGCAAGAAA | |||
rs2228570 | F: ACCAAGGATGCCAGCTGG | Uncut: 266 | |
Cut: 19/63/184 | |||
R: GCTTCTTCTCCCTCCCTTTC | |||
Tumor necrosis factor superfamily member 11 gene | |||
rs9533155 | F: GCCACAGTTCTGAATAGAGG | Uncut: 498 | |
Cut: 123/375 | |||
R: GGATAAGGATTGCACCTCAG | |||
rs9533156 | F: GCCACAGTTCTGAATAGAGG | Uncut: 498 | |
Cut: 176/322 | |||
R: GGATAAGGATTGCACCTCAG | |||
rs9525641 | F: ATCCTAAGGAGGAAACCGAGAC | Uncut: 146 | |
Cut: 124/22 | |||
R: GGAGGTCCAAGAGATGGGTTTA |
Summary of genotypes.
Allele | Genotype, n (%) | Allele frequency | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene | SNP | Major | Minor | Group | OR minor allele (95% CI) | OR major allele (95% CI) | P-value (OR minor allele) | |||||
VDR | TT | CT | CC | T | C | |||||||
rs731236 | T | C | Control | 116 (87.88) | 15 (11.36) | 1 (0.76) | 0.94 | 0.06 | Ref. | Ref. | – | |
Osteoporosis | 97 (92.38) | 6 (5.71) | 2 (1.91) | 0.95 | 0.05 | 0.73 (0.30–1.72) | 1.38 (0.58–3.31) | 0.43 | ||||
GG | GA | AA | G | A | ||||||||
rs1544410 | G | A | Control | 103 (78.03) | 25 (18.94) | 4 (3.03) | 0.88 | 0.13 | Ref. | Ref. | – | |
Osteoporosis | 85 (80.95) | 19 (18.10) | 1 (0.95) | 0.90 | 0.10 | 0.78 (0.42–1.44) | 1.29 (0.69–2.39) | 0.40 | ||||
CC | CT | TT | C | T | ||||||||
rs2228570 | C | T | Control | 41 (31.06) | 73 (55.30) | 18 (13.64) | 0.59 | 0.41 | Ref. | Ref. | – | |
Osteoporosis | 31 (29.52) | 46 (43.81) | 28 (26.67) | 0.51 | 0.49 | 1.34 (0.92–1.97) | 0.74 (0.51–1.09) | 0.11 | ||||
TNFSF11 | CC | CG | GG | C | G | |||||||
rs9533155 | C | G | Control | 52 (39.39) | 62 (46.97) | 18 (13.64) | 0.63 | 0.37 | Ref. | Ref. | – | |
Osteoporosis | 38 (36.19) | 56 (53.33) | 11 (10.48) | 0.63 | 0.37 | 1.00 (0.68–1.48) | 1.00 (0.67–1.48) | 0.99 | ||||
TT | CT | CC | T | C | ||||||||
rs9533156 | T | C | Control | 47 (35.61) | 64 (48.48) | 21 (15.91) | 0.60 | 0.40 | Ref. | Ref. | – | |
Osteoporosis | 24 (32.38) | 58 (55.24) | 13 (12.38) | 0.60 | 0.40 | 0.99 (0.67–1.46) | 1.01 (0.68–1.48) | 0.97 | ||||
TT | CT | CC | T | C | ||||||||
rs9525641 | T | C | Control | 48 (36.36) | 67 (50.76) | 17 (12.88) | 0.62 | 0.38 | Ref. | Ref. | – | |
Osteoporosis | 33 (31.43) | 59 (56.19) | 13 (12.38) | 0.60 | 0.40 | 1.10 (0.74–1.62) | 0.91 (0.62–1.34) | 0.62 |
OR, odds ratio; CI, confidence interval; SNP, single nucleotide polymorphism; VDR, vitamin D receptor; TNFSF11, tumor necrosis factor superfamily member 11.
OR (95% CI) of genotypic frequency of SNPs at VDR and TNFSF11 in osteoporosis patients and control subjects.
SNP | Genotype | OR (95% CI) | P-value |
---|---|---|---|
rs731236 | CC | 2.54 (0.18–7.26) | 0.41 |
CT | 0.47 (0.16–1.36) | 0.13 | |
TT | 1.67 (0.67–4.48) | 0.25 | |
rs15444410 | AA | 0.31 (0.01–2.98) | 0.26 |
GA | 0.95 (0.46–1.92) | 0.89 | |
GG | 1.20 (0.60–2.38) | 0.58 | |
rs2228570 | TT | 2.30 (1.14–4.69) | 0.01 |
CT | 0.63 (0.36–1.09) | 0.08 | |
CC | 0.93 (0.51–1.69) | 0.80 | |
rs9533155 | GG | 0.74 (0.31–1.75) | 0.46 |
CG | 1.29 (0.75–2.23) | 0.33 | |
CC | 0.87 (0.50–1.53) | 0.61 | |
rs9533156 | CC | 0.75 (0.33–1.67) | 0.44 |
CT | 1.31 (0.76–2.27) | 0.30 | |
TT | 0.85 (0.49–1.54) | 0.60 | |
rs9525641 | CC | 0.96 (0.41–2.20) | 0.91 |
CT | 1.24 (0.72–2.15) | 0.41 | |
TT | 0.80 (0.45–1.43) | 0.43 |
OR, odds ratio; CI, confidence interval; SNP, single nucleotide polymorphism;
Haplotypes analysis of single nucleotide polymorphisms in
Haplotype frequency | |||
---|---|---|---|
Haplotype | Osteoporosis | Control | P-value |
CAT | 0.193 | 0.026 | 0.618 |
TAT | 0.021 | 0.017 | 0.793 |
TGT | 0.443 | 0.369 | 0.105 |
CAA | 0.005 | 0.037 | 0.020 |
TAA | 0.058 | 0.044 | 0.510 |
TGA | 0.455 | 0.506 | 0.270 |
GCC | 0.363 | 0.349 | 0.755 |
CCC | 0.024 | 0.023 | 0.930 |
CTC | 0.014 | 0.011 | 0.773 |
GCT | 0.005 | 0.019 | 0.175 |
CCT | 0.009 | 0.011 | 0.837 |
CTT | 0.584 | 0.586 | 0.967 |