The human umbilical cords of healthy puerperant women were collected in asepsis after parturition. The HUVECs were isolated by treatment with 1% Trypsin, as previously described (7). The HUVECs were grown on 1% gelatin-coated culture plates in McCoy’s 5A (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 15% fetal bovine serum (Hyclone), 100 U/ml penicillin and 100 μg/ml streptomycin (Hyclone), at 37°C in a humidified atmosphere of air containing 5% CO₂. The cells were used to within 2–3 passages and were identified as endothelial by their cobblestone monolayer appearance in culture and by the expression of cell-surface antigens CD34 and CD31, as detected by flow cytometry (FCM) assay.

For expression plasmid pRNAT-CMV32-miR155 (pre-miRNA of miR-155 expression element), oligonucleotide pairs for pre-miRNA of miR-155 and linker sequences with BamHI and XhoI sites were chemically synthesized by GenePharma Co., Ltd. (Shanghai, China). The sequences of the oligonucleotides were: top strand, 5′-GT ggatccCTGTTAATGCTAATCGTGATAGGGGTTTTTGC CTCCAACTGACTCCTACATATTAGCATTAACAGctcgag CC-3′, and bottom strand, 5′-GGctcgagCTGTTAATGCTAAT ATGTAGGAGTCAGTTGGAGGCAAAAACCCCTATCAC GATTAGCATTAACAGggatccAC-3′ (sequences corresponding to miR-155 seed sequences in capitalized, underlined and bold, and restriction enzyme sites in lower case and underlined). To built the expression plasmid the pairs of oligos were annealed and inserted into the multiple cloning sites between of BamHI and XhoI sites in the pRNAT-CMV32/Neo vector (GenScript, Piscataway, NJ, USA). The negative control plasmid pRNAT-CMV32-miR155-Mut were similarly built, except that 11 nucleotides in sequences corresponding to miR-155 see sequences were mutated (change TTAATGCTAAT to TaAtTcCaAtT, mutations shown in lower-case). Co-transfection of HUVECs from patients or healthy women were conducted to transfer 0.3 μg miR-155 expressed vector or miR-155 mutant vector, respectively, with Lipofectamine 2000 reagent according to the manufacturer’s protocol. The cells were seeded in a 6-well plate in McCoy’s 5A (Sigma-Aldrich) supplemented with 15% fetal bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin (were from Hyclone), at 37°C in a humidified atmosphere of air containing 5% CO₂, until 80% confluent.

All steps of this assay were performed as previously described (6,7). NIH-3T3 cells were seeded at 3×10⁴/well in 48-well plates and co-transfected with 400 ng of pRNAT-CMV32-miR-155 or pRNAT-CMV32 or pRNAT-CMV32-miR155-Mut, 20 ng of pGL-ATR1-3UTR-WT or pGL-ATR1-3UTR-Mut, and pRL-TK (Promega, Madison, WI, USA) using Lipofectamine 2000 reagent according to the manufacturer’s protocol. After 48 h transfection, luciferase activity was measured using the dual-luciferase reporter assay system (Promega).

Each group of HUVECs was seeded at 2×10³/well in 96-well plates and cultured in McCoy’s 5A supplemented with 15% fetal bovine serum at 37°C with 5% CO₂, until 85% confluent. MTT (Sigma-Aldrich) reagent (5 mg/ml) was added to the maintenance cell medium at different time points, and incubated at 37°C for an additional 4 h. The reaction was terminated with 150 μl dimethylsulfoxide (DMSO; Sigma-Aldrich) per well and the cells were lysed for 15 min; the plates were gently shaken for 5 min. Absorbance values were determined by using the enzyme linked immunosorbent assay (ELISA) reader (Model 680; Bio-Rad) at 490 nm.

Total RNA from each cell was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. The RNA samples were treated with DNase I (Sigma-Aldrich), quantified, and reverse-transcribed into cDNA using the ReverTra Ace-α First Strand cDNA Synthesis kit (Toyobo). qRT-PCR was conducted using a RealPlex4 real-time PCR detection system from Eppendorf Co., Ltd. (Germany), with SYBR-Green Realtime PCR Master MIX (Toyobo) used as the detection dye. qRT-PCR amplification was performed over 40 cycles with denaturation at 95°C for 15 sec and annealing at 58°C for 45 sec. Target cDNA was quantified using the relative quantification method. A comparative threshold cycle (Ct) was used to determine gene expression relative to a control (calibrator) and steady-state mRNA levels are reported as an n-fold difference relative to the calibrator. For each sample, the marker gene Ct values were normalized using the formula ΔCt = Ct_genes-Ct_18sRNA. To determine relative expression levels, the following formula was used ΔΔCt = ΔCt_sample_group-ΔCt_control_group. The values used to plot relative expressions of markers were calculated using the expression 2^−ΔΔCt. The mRNA levels were calibrated based on levels of 18 sec rRNA. The cDNA of each gene was amplified using primers as previously described (7,15).

Total proteins extracts of each group cells were resolved by 12% SDS-PAGE and transferred on PVDF (Millipore) membranes. After blocking, the PVDF membranes were washed four times for 15 min with TBST at room temperature and incubated with primary antibody. Following extensive washing, membranes were incubated with secondary peroxidase-linked goat anti-rabbit IgG (1:1,000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) for 1 h. After washing four times for 15 min with TBST at room temperature once more, the immunoreactivity was visualized by enhanced chemiluminescence (ECL kit; Pierce Biotechnology), and membranes were exposed to Kodak XAR-5 film (Sigma-Aldrich).

All steps of northern blotting were carried out as previously described (7–11). For all groups, 20 μg of good quality total RNA was analyzed on a 7.5 M ureum 12% PAA denaturing gel and transferred to a Hybond N⁺ nylon membrane (Amersham, Freiburg, Germany). Membranes were crosslinked using UV light for 30 sec at 1,200 mjoule/cm². Hybridization was performed with the miR-155 antisense starfire probe, 5′-CCCCTATCACGATTAGCATTAA-3′ (Integrated DNA Technologies, Inc., Coralville, IA, USA), to detect the 22-nt miR-155 fragments according to the manufacturer’s instructions. After washing, membranes were exposed for 20–40 h to Kodak XAR-5 film (Sigma-Aldrich). As a positive control, all membranes were hybridized with a human U6 snRNA probe, 5′-GCAGGGGCCATGCTAATCTTCTCTG TATCG-3′. Exposure times for the U6 control probe varied between 15 and 30 min.

Each group cells was seeded at 3×10⁵/well in 6-well plates and cultured until 85% confluent. Each group cells was washed by PBS three times and were then collected by centrifugation (Allegra X-22R; Beckman Coulter) at 1,000 × g for 5 min. The cell pellets were the resuspended in 1 ml of PBS, fixed in 70% ice-cold ethanol, and kept in a freezer >48 h. Prior to FCM analysis, the fixed cells were centrifuged, washed twice with PBS, and resuspended in PI staining solution (Sigma-Aldrich) containing 50 μl/ml PI and 250 μg/ml RNase A (Sigma-Aldrich). The cell suspension, which was hidden from light, was incubated for 30 min at 4°C and analyzed using the FACS (BD FACSAria; BD Biosciences). A total of 20,000 events were acquired for analysis using CellQuest software.

All group cells were seeded at 3×10⁵/well in 6-well plates and cultured until 85% confluent; they were lysed (500 μl/plate) in a modified cell lysis buffer for western blotting and IP (20 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, sodium pyrophosphate, β-glycerophosphate, Na₃VO₄ and leupeptin) (Beyotime Institute of Biotechnology). Following lysis, each sample was centrifuged to clear the lysate of the insoluble debris and pre-incubated with 20 μg protein A agarose beads (Beyotime Institute of Biotechnology) by rocking for 30 min at 4°C, followed by centrifugation and transfer to a fresh 1.5 ml tube. The rabbit anti-human ERK1/2 polyclonal antibody (Cell Signaling Technology, USA) was incubated for 90 min before re-addition of 20 μg protein A agarose beads to capture the immune complexes. The pelleted beads were then washed three times with 500 μl cell lysis buffer, dissolved in 4× SDS-PAGE sample loading buffer, and heated for 10 min at 95°C.

The cultured cells were washed three times with PBS and fixed with 4% paraformaldehyde (Sigma-Aldrich) for 30 min. After blocking, the cells were incubated first with rabbit anti-human Angiotensin II polyclonal antibody (1:200;) and rabbit anti-human ERK1/2 or pERK1/2 polyclonal antibody (1:200; were from Santa Cruz Biotechnology, Inc.) overnight at 4°C, and then with FITC- or Cy3-conjugated goat anti-rabbit IgG antibody (1:200; Abcam, Cambridge, UK) and 5 mg/ml DAPI (Sigma-Aldrich) at room temperature for 30 min. Then the cells were thoroughly washed with TBST and viewed through a fluorescence microscope (DMI3000; Leica, Allendale, NJ, USA).

JC-1 probe (Beyotime Biotechnology, Shanghai, China) was employed to measure mitochondrial membrane potential (ΔΨm) depolarization. All steps of northern blotting were according to previous reports (15,16). Briefly, cells cultured in 6-well plates after indicated treatments were incubated with an equal volume of JC-1 staining solution (5 μg/ml) at 37°C for 20 min and rinsed twice with PBS. ΔΨm was monitored by determining the relative amounts of dual emissions from mitochondrial JC-1 monomers or aggregates using a fluorescence microscope (DMI3000; Leica) under Argon-ion 488 nm laser excitation. Mitochondrial depolarization is indicated by an increase in the green/red fluorescence intensity ratio.

All steps of northern blotting were performed according to previous reports (16,17). In brief, HUVECs were plated on matrigel-coated 6 chamber slides (2×10⁵ cells/chamber) in the presence and absence of various test substances described in the previous section for the cell migration assay. After 6 h of incubation in a CO₂ incubator, cells were photographed. To quantitate the data, the number of branch points in four non-overlapping fields was determined.

Each experiment was performed at least three times, and data are shown as the means ± SE, where applicable, and differences were evaluated using the Student’s t-test. P<0.05 was considered to indicate statistically significant differences.

According to the miRBase Target database (http://www.mirbase.org), the 3′ untranslated region (3′-UTR) of AtR1 mRNA harbors 9–16 putative miRNA target sites, depending on the species analyzed. We focused on human miR-155, which may target the human AtR1 3′-UTR, since these sites are conserved to varying degrees across species (Fig. 1). To identify possible miR-155 target genes, the 3′-UTR sites of AtR1 were cloned on a luciferase activity assay plasmid. Plasmid DNA for wild-type and mutant AtR1 mRNA 3′-UTR and a blank plasmid were co-transfected with a miR-155 expression vector (wild-type, mutant and blank) in NIH-3T3 cells to determine whether AtR1 gene expression is regulated by mature miR-155. The luciferase activity of the AtR1 3′-UTR was significantly inhibited by miR-155 (Fig. 1), whereas that of the mutated AtR1 3′-UTR was not. The data suggest that miR-155 targets AtR1. Northern blotting detected the hybridization signal of mature miR-155 in HUVECs transfected with miR-155 but not in untransfected cells (Fig. 1). Quantitative real-time PCR (qRT-PCR) and western blotting were used to determine whether miR-155 interfered with AtR1 mRNA expression. According to qRT-PCR, AtR1 mRNA expression was inhibited when the miR-155 expression plasmid was transfected into HUVECs (0.313±0.050), compared with untransfected cells (1.006±0.076). Western blotting confirmed that AtR1 protein expression was significantly reduced in miR-155-transfected HUVECs (0.168±0.045) compared with untransfected cells (0.705±0.066). These data indicate that exogenous miR-155 downregulated the expression of endogenous AtR1 in HUVECs (Fig. 1).

To determine whether exogenous Ang II can suppress HUVEC proliferation, inhibition with 0, 5, 10, 20, 40, 80 and 120 ng/μl Ang II was measured by the MTT proliferation assay (Fig. 2). There were no significant differences between the HUVEC-Ang II group and the HUVEC-PBS group with Ang II concentrations of 0–20 ng/μl after 24 h. However, with concentrations of 40–120 ng/μl, the HUVEC-PBS group was significantly less susceptible to the proliferation inhibitory effect of Ang II (Table I). Furthermore, exogenous Ang II suppressed the proliferation of HUVECs in a concentration-dependent manner, with a half maximal inhibitory concentration of 68.94 ng/μl according to the MTT cell proliferation assay.

To determine whether exogenous Ang II could induce apoptosis in HUVECs, qRT-PCR and western blotting were used to measure the expression levels of apoptosis related factors (Fig. 2). qRT-PCR showed that mRNA expression of the apoptosis inhibitor Bcl-2 was markedly lower in the HUVEC-Ang II group than in the HUVEC-PBS group and the blank controls (BCs). By contrast, mRNA expression levels of the apoptosis-promoting factors Bax, cytochrome c, caspases-9 and -3 were markedly higher in the HUVEC-Ang II group than in the HUVEC-PBS group and the BCs (Table II). Western blotting confirmed that Bcl-2 protein expression was significantly reduced in the HUVEC-Ang II group compared with the HUVEC-PBS group and the BCs. These data indicate that exogenous Ang II activates the expression of apoptosis related proteins and thereby induces apoptosis.

We used FCM to determine whether Ang II influences the cell cycle in HUVECs. There were no significant changes in the cell cycle distribution of the BCs and the HUVEC-PBS group (Fig. 3). By contrast, the HUVEC-Ang II group was arrested in the G0/G1 phase of the cell cycle and the percentage of cells in the S phase was significantly decreased. These results suggest that exogenous Ang II significantly affects cell cycle regulation in HUVECs in vitro.

To determine whether exogenous Ang II in the cell culture medium damages mitochondria, mitochondrial membrane depolarization was examined. According to previous studies (15,16), normal HUVECs stained with JC-1 emit mitochondrial orange-red fluorescence with a little green fluorescence (Fig. 4). However, compared with the HUVEC-Ang II group, Ang II further decreased the ΔΨm and produced obvious green fluorescence in the HUVEC-PBS group. Thus, exogenous Ang II damages mitochondria in HUVECs.

To investigate the effect of miR-155 expression, qRT-PCR and western blotting were used to determine the expression levels of apoptosis related factors (Fig. 2). qRT-PCR showed that the mRNA expression of Bcl-2 in miR-155-transfected cells was markedly elevated, whereas Bax, cytochrome c, caspases-9 and -3 in this group were markedly decreased (Table II). Western blotting showed that Bcl-2 protein expression was significantly increased in miR-155-transfected cells compared with the HUVEC-Ang II group and the miR-155 mutant-transfected group; Bax, active caspase-9 and active caspase-3 were markedly decreased. These data indicate that miR-155 attenuates the expression of exogenous Ang II-induced apoptosis related proteins. FCM showed no significant differences in cell cycle distribution between the HUVEC-Ang II group and the miR-155 mutant-transfected group (Fig. 3). By contrast, the cell cycle in the miR-155-transfected group was more ameliorated. Compared with the miR-155-transfected group, Ang II further increased ΔΨm and produced obvious orange-red fluorescence but not green fluorescence (Fig. 4). This difference in ΔΨm between the different groups indicates that miR-155 attenuates exogenous Ang II-induced mitochondrial damage in HUVECs.

In previous studies, Ang II-induced AtR1 activation was shown to induce ERK1/2 activation and phosphorylation, leading to cellular hypertrophy and apoptosis (6,7). To determine whether miR-155 suppression of At1R expression in HUVECs can reverse the above phenomena, phospho-ERK 1/2 levels were determined by co-immunoprecipitation (co-IP) western blotting. There were no obvious differences in the levels of normal ERK1/2 and phospho-ERK1/2 expression between the BCs and the HUVEC-PBS group (Fig. 5). When exogenous Ang II was added to the culture medium, the levels of phospho-ERK1/2 in the HUVEC-Ang II group and the miR-155 mutant-transfected group were 0.745±0.048 and 0.797±0.043 of their baseline levels, respectively. These values were significantly higher than those for the miR-155 transfected group, the BCs and the HUVEC-PBS group (0.430±0.03, 0.244±0.100 and 0.249±0.056 of baseline, respectively). Immunofluorescence staining showed that ERK1/2 and phospho-ERK1/2 protein expression were both decreased in the miR-155-transfected cells compared with the HUVEC-Ang II group and the miR-155 mutant-transfected cells after stimulation with exogenous Ang II (Fig. 5). The results of co-IP western blotting suggest that miR-155 significantly reduces Ang II-induced activation of the MAPK ERK1/2.

We also investigated whether exogenous Ang II can influence HUVEC migration and capillary tubule formation in vitro, and whether miR-155 can maintain these abilities. Our experimental results showed that HUVECs can form capillary tubules in migration gels under normal conditions (HUVEC-BC, 37±5; HUVEC-PBS, 36±4). When the cell culture medium contained exogenous Ang II, HUVEC migration and capillary tubule formation were markedly reduced (HUVEC-Ang II, 3±2). However, after transfection with miR-155, the migration and capillary tubule formation abilities of the HUVEC were maintained in the presence of Ang II (22±3) (Fig. 6).