Clean Sprague-Dawley (SD) rats, weighing 250–300 g, were obtained from the Experimental Animal Center of Shanghai Jiaotong University Medical School, Shanghai, China (production license: scxk (hu)2004-0001; use license no. syxk (hu)2003–2009). The present study was reviewed and approved by the University Institutional Animal Care and Use Committee.

Except where otherwise specified, all reagents were obtained from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA) and Gibco (Grand Island, NY, USA), including cell culture medium [low-glucose Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS)]. The cardiac-specific antibodies (TNI, α-sarcomeric actin, desmin), FITC-conjugated goat anti-rat antibodies (CD45), PE-conjugated rabbit anti-rat antibodies (CD90), allophycocyanin (APC)-conjugated rabbit anti-rat antibodies (CD29) and FITC-conjugated rabbit anti-rat nesprin-1 antibodies, were purchased from Abcam (Cambridge, UK). The BLOCK-iT™ POLIImiR RNAi Expression Vector kit with EmGFP, pcDNA™ 6.2-GW/EmGFPmiR, Escherichia coli (E. coli) DH5, Lipofectamine^® 2000, Opti-MEM, TRIzol reagent and pLenti6.3/V5-DEST were purchased from Invitrogen (Carlsbad, CA, USA). Restriction endonuclease, DNA ligase and the Large Plasmid DNA Extraction kit were purchased from Qiagen (Dusseldorf, Germany). The reagents and instruments for immunohistochemistry, immunofluorescence and western blot analysis were purchased from Gibco, Sigma-Aldrich Chemical Co. and Invitrogen, respectively.

Eight-week-old SD rats (250–300 g) were prepared as donors. The procedures were performed in accordance with the guidelines for animal experimentation of Shanghai Jiaotong University and approved by the institutional ethics committee. Under general anesthesia with ether (approximately 100 μl) bone marrow was aspirated from both the tibia and femur with a 20-gauge needle attached to a 10-ml syringe containing 0.5 ml DMEM with 40 U/ml heparin.

The concentration of the cells in suspension was adjusted to 5×10⁵ mononuclear cells/ml culture medium at 37°C in a humidified atmosphere with 5% CO₂; the cells were then seeded on culture plates, without removal of the red blood cells. Since bone marrow-derived MSCs (BMSCs) grow initially in colonies and do not reach confluence over the entire culture dish, the cells were passaged 7 days after seeding, when half the colonies reached 70–80% confluence; the cells were then passaged weekly when the cells reached confluence. For subcultures, adherent BMSCs wer harvested using 0.125% trypsin and plated at a ratio of 1:3.

For flow cytometry, the cells were detached using accutase instead of trypsin, in order to achieve a better preservation of the cell surface molecules. 293T cells were maintained in MEM supplemented with 5% FBS and 50 mg/ml gentamycin. The cells were trypsinized by a 0.05% trypsin-0.5 mM EDTA solution.

Flow cytometry was performed using a FACSAria flow cytometer/cell sorter (BD Biosciences, San Jose, CA, USA). Following accutase treatment, the cells were resuspended at a density of 1×10⁵ cells/200 μl phosphate-buffered saline (PBS) and incubated with 2% FCS (PBS-FCS) on ice. The cells were stained with antibody, and incubated with FITC-conjugated CD45 monoclonal antibody, PE-conjugated CD90 monoclonal antibody and APC-conjugated CD29 monoclonal antibody (at concentrations indicated by the manufacturer) for 30 min at 4°C in the dark, and then washed in PBS-FCS. After washing, the cells were analyzed in the cytometer. At least 5,000 events were analyzed for each sample. Negative controls, used to detect the unspecific bindings, included an irrelevant antibody or PBS-FCS alone. The acquired data were analyzed using Summit software (Cytomation, Inc., Fort Collins, CO, USA).

BMSCs grown on glass coverslips were fixed by a 20-min incubation in 4% formaldehyde (freshly prepared from paraformaldehyde), rinsed in PBS, and stored in 70% ethanol at −20°C. The fixed cells were blocked for 30 min in blocking solution (PBS supplemented with 2% goat serum, 1% BSA, 0.1% gelatin, 0.1% Triton X-100 and 0.05% Tween-10), and incubated overnight with the primary antibody (at the dilution indicated by the manufacturer) at 4°C. After washing, the cells were incubated with the secondary antibody (FITC-conjugated anti-rat IgG for nesprin-1) for 30 min. Finally, the coverslips were washed, mounted in glycerol and examined under an epifluorescence microscope (Olympus, Tokyo, Japan).

After washing with PBS, the BMSCs were scraped off the culture dish and transferred to centrifuge tubes. Following centrifugation at 700 × g for 10 min at 4°C, the pellets were lysed in hot Laemmli loading buffer (62.5 mmol/l Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.05% β-mercaptoethanol, 0.05% bromophenol blue). Equal amounts of protein extracts (20 mg/lane) were subjected to SDS-PAGE on a 5% stacking gel and a 10% separating gel, followed by transfer of the proteins onto nitrocellulose membranes (20 min at 10 V). After blocking in PBS containing 0.05% Triton X-100 (TBS) and 5% FCS for 1 h, the blots were incubated overnight with primary antibodies (rabbit anti-rat nesprin-1) at 4°C. After washing, the membranes were incubated with the secondary antibody (HRP-conjugated goat anti rabbit IgG) for 1 h; the bound antibody was detected by ECL. β-actin was used as an internal control.

The nesprin-1 DNA and protein sequence was according to the GenBank accession no. NM_001029909.1. The nesprin-1 gene siRNA sequence and the corresponding miRNA oligonucleotide sequence were then designed and synthesized using Ambion design software and the sequences were verified using BLAST software: (5′-CGGGAGTTGTTG ACTATGAAA-3′); the corresponding miRNA oligonucleotide sequence was as follows: nesprin-1 forward, TGCTGTTTCATAGTCAACAACTCCCGGTTTTGGCCACTGACTGACCGGGAGTTTGACTATGAAA; and reverse, CCTGTTTCATAGTCAAACTCCCGGTCAGTCAGTGGCCAAAACCGGGAGTTGTTGACTATGAAAC. The Vector Cloning kit was then used for restructuring; the double-stranded miRNA oligonucleotide was inserted into the miRNA expression vector (Invitrogen), and the cells were transfected with miRNA plasmids infected with E. coli DH5. The oligonucleotides were annealed and cloned into the BglII-HindIII site. The pDONR221 vector was processed with BP recombination reaction, in order to obtain the entry vector containing the siRNA. The sequence of the entry vector with siRNA and the lentiviral expression vector pLenti6/V5-DEST were processed with LR recombination reaction in order to obtain the lentiviral expression vector expressing siRNA targeting nesprin-1 (LV-siNesprin-1).

The 293T cells were co-transfected with a plasmid expressing GFP together with a plasmid expressing siRNA specific for GFP (siGFP) at a ratio of 1:5 using FuGENE^® transfection reagent (Roche, Indianapolis, IN, USA).

Recombinant lentiviruses were produced by the transient transfection of 293T cells using the calcium-phosphate method as previously described (13–15). Infectious lentiviruses were harvested at 48 and 72 h post-transfection and filtered through 0.22-μm-pore cellulose acetate filters as previously described (13–15). Recombinant lentiviruses were concentrated by ultracentrifugation (2 h at 50,000 × g) and subsequently purified on a sucrose 20% gradient (2 h at 46,000 × g) as previously described (16). Vector concentrations were analyzed using an immunocapture p24-gag ELISA (Alliance; DuPont/NEN, Boston, MA, USA) as previously described (16); the concentrated suspension of the activity of the viral titer was measured (1×10⁶ TU/ml).

Protein levels were analyzed by western blot analysis (concrete steps as the former) and immunoblotting was carried out according to standard methods with rabbit moclonal antibody against GFP (Abcam) or β-actin (Sigma-Aldrich Chemical Co.). Fluorescence-activated cell-sorter analysis was carried out as previously described (17–19).

The cells were plated on 24-well plates (2×10⁴ cells/well) in the growth medium for the assays. The protocols for MTT assays were as previously described (20). In brief, growth medium containing 0.25 mg/ml MTT was added to each well and the cells were further incubated at 37°C for 20 min, following which the medium was replaced by 0.2 ml DMSO/well. MTT dye conversion was determined by measuring the OD_{540 nm} of the DMSO extracts using DMSO as the blank control.

The cells (5×10⁵) were centrifugated for 5 min at 800 rpm, the supernatant was collected, and they were then washed with cold PBS twice and fixed with 700 ml/l cold ethanol at 4°C overnight. The ethanol was removed by centrifugation prior to detection. The cells were washed with PBS twice, then stained with 1 ml PI (bromide tablets) at 4°C for 30 min in the dark.

The cells (5×10⁶) were centrifugated for 5 min at 1,000 rpm, then the culture medium was discarded. They were then washed once with PBS, centrifuged and the supernatant was removed; they were then fixed with 70% cold ethanol at 4°C for 1–2 h. The ethanol was then removed by centrifugation. The cells were resuspended with 3 ml PBS for 5 min, filtered once and centrifuged at 1,500 rpm for 5 min. The PBS was discarded prior to detection. The cells were stained with 1 ml PI and FITC-Annexin V in 4°C for 30 min in the dark.

The cells were passaged when they became nearly confluent. Sterile DAPI solution was added to the culture medium. The MSCs were rinsed 6 times in PBS solution to remove all excess unbound DAPI. The MSCs were cultured in culture medium [DMEM, supplemented with 20% FBS and penicillin (100 U/ml)/streptomycin (100 μg/ml)] at 37°C in a humidified atmosphere with 5% CO₂ for 72 h; they were then examined under a microscope.

Image programmer software was used to analyze the images. Data are presented as the means ± standard deviation (SD). Statistical analyses were performed using paired t-tests where applicable. Statistical analysis was performed using SPSS and GraphPad Prism 5 Demo software. A p-value <0.05, based on a two-tailed test, was considered to indicate a statistically significant difference.

After discarding the non-adherent cells by the first medium change and washing with PBS 3 times at 24 h of primary culture, approximately 80% of the MSCs had adhered to the culture dishes; the medium was then changed to remove the suspension of hematopoietic stem cells. After 3 days in primary culture, the MSCs adhered to the plastic surface, presenting a small population of single cells. The cells were spindle-shaped with a single nucleus (Fig. 1A). Seven to 10 days after initial plating, the cells resembled long spindle-shaped fibroblast cells and began to form colonies (Fig. 1B and C). After replating, almost 100% of the cells had adhered to the culture dishes, and were polygonal or spindle-shaped, with long processes.

The rat MSC surface antigen profiles obtained by flow cytometry (Fig. 2), were positive for CD90, CD29 and negative for CD45. The percentage of CD90 and CD29 was 99.96 and 99.75%, respectively; however, the percentage of CD45 was 1.12%.

Immunofluorescent staining for nesprin-1 protein verified the presence of rat MSCs (Fig. 3A), with granular green fluorescence distributed around the nuclear membrane of the MSCs. The protein expression of nesprin-1 was detected by western blot analysis (Fig. 3B).

The MSCs were successfully transfected with LV-siNesprin-1 or LV-GFP, as shown by green fluorescence (Fig. 4A–C). After the MSCs were transfected with LV-siNesprin-1, the protein expression of nesprin-1 in the LV-siNesprin-1 group was lower than that in the LV-GFP and normal group (Fig. 4D). The protein expression of nesprin-1 in the LV-GFP group was the same as that in the normal group, but was significanlty different from that in the LV-siNesprin-1 group (P=0.03 and P=0.028, respectively; P<0.05) (Fig. 4E). The expression of β-actin did not differ between the 3 groups (P=0.10 and P=0.12, respectively; P>0.05).

The 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 24, 48, 72 and 96 h under the same conditions. The proliferation of the cells was then detected by MTT assay at 24, 48, 72 and 96 h. As shown in Fig. 5, the knockdown of nesprin-1 expression led to a decrease in the proliferation of MSCs; however, the proliferation rate of the cells in the LV-GFP group was not altered and was similar to the normal group.

The 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 72 h under the same conditions. The cell cycle was detected by flow cytometry. In the LV-siNesprin-1 group, the cells were mainly in the G0/G1 phase of the cell cycle (Fig. 6).

The 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 72 h under the same conditions. The apoptosis of the cells was detected by flow cytometry. In the LV-siNesprin-1 group, the apoptotic rate of the cells was higher than that of the cells in the LV-GFP and normal group (Fig. 7).

As shown in Fig. 8, the morphology of the nucleus in the LV-siNesprin-1 group was altered; morphological changes such as fusion and fragmentation were observed.