In the present study, we compared mesenchymal stem cells (MSCs) derived from 4 different sources, human bone marrow (BM), adipose tissue (AT), umbilical cord Wharton’s Jelly (WJ) and the placenta (PL), in order to determine which population of MSCs displayed the most prominent immunosuppressive effects on phytohemagglutinin-induced T cell proliferation, and which one had the highest proliferative and differentiation potential. MSC and T lymphocyte co-culture (mixed culture) was used to determine whether the MSCs inhibit T cell proliferation, as well as which population of MSCs has the strongest inhibitory ability. The expression of immune-related genes was analyzed by RT-PCR and RT-qPCR. The proliferation and differentiation potential of the MSCs were determined using standard methods. Following MSC and T cell co-culture, mitogen-induced T cell proliferation was effectively suppressed by all 4 populations of MSCs. This occurred through soluble factors rather than direct contact inhibition. Among the 4 populations of MSCs, the WJ-MSC has the strongest suppression effects. On immune related genes, WJ-MSC has the weakest expression of MHC II genes, TLR4, TLR3, JAG1, NOTCH2 and NOTCH3. To compare the proliferation potential, WJ-MSCs showed the most rapid growth rate followed by the AT-, PL- and BM-MSCs. As regards differentiation potential, the WJ-MSCs had the strongest osteogenetic ability followed by PL, AT and BM-MSC. AT-MSC has the strongest adipogenetic ability followed by the WJ-, BM- and PL-MSCs. These data indicated that the WJ-MSCs had the strongest immunomodulatory and immunosuppressive potential. In light of these observations, we suggest that WJ-MSCs are the most attractive cell population for use in immune cellular therapy when immunosuppressive action is required.
Mesenchymal stem cells (MSCs) are multipotent stromal cells that have been isolated from both adult and fetal tissues and are defined as adherent, fibroblast-like cells. In the early 1970s, Friedenstein
MSCs possess 2 major properties, a self-renewal ability and the potential for multilineage differentiation. MSCs can differentiate into a variety of cell types, including osteoblasts, chondrocytes, adipocytes and myocytes (
It has been demonstrated that MSCs have both immunosuppressive and immunomodulatory functions (
MSCs were isolated from 4 different sources: BM, AT, WJ and PL tissue. The BM and AT samples were obtained from healthy volunteer donors, while the WJ and PL samples were from tissue following normal caesarean birth. All individuals provided written informed consent and the study was approved by the Ethics Committee of the China-Japan Union Hospital, Jilin University, Changchun, China. The age range of the donors was as follows: the BM was from individuals aged 18 to 43 years, the AT was from individuals aged 23 to 50 years, and the WJ and PL tissue were from individuals aged 23 to 38 years. The MSCs derived from BM, AT, WJ and PL were isolated according to previously described methods (
The MSCs were removed from the culture flasks by incubation in 0.05% trypsin-EDTA at 37°C and then washed twice with PBS. The cell suspensions were then incubated with antibodies against CD44-phycoerythrin (PE), CD73-PE, CD14-PE, CD34-PE, CD90-fluorescein isothiocyanate (FITC), CD45-FITC and CD105-PerCP (BD Biosciences, Franklin Lakes, NJ, USA) and protected from light for 30 min at 4°C. Following incubation, the cells were washed twice with PBS. The fluorescence intensity of the cells was evaluated using a flow cytometer (FACScan; BD Biosciences) and the data were analyzed using CellQuest software (BD Biosciences).
A total of 5x104 MSCs/cm2 was seeded into a 12-well plate and incubated in MSC growth medium (α-MEM with 10% FBS) at 37°C in a humidified atmosphere with 5% CO2 for a minimum of 2 h or up to 4 days (to near or complete confluence) before re-seeding with adipogenic differentiation medium (StemPro® Adipogenesis Differentiation kit; Invitrogen Australia Pty Ltd.). The MSCs will continue to undergo limited expansion as they differentiate under adipogenic conditions. The cultures were re-fed every 3–4 days. After 21 days under differentiating conditions, the medium was removed from the wells, and the cells were rinsed once with PBS, and fixed with 4% formaldehyde solution for 30 min. After fixation, the cells were rinsed twice with PBS, stained with Oil Red O (Sigma) for 15 min, rinsed twice with PBS and visualized under a light microscope (Olympus, Tokyo, Japan). Images were captured for qualitative and quantitative analyses. Fifteen fields at x400 magnification under the microscope were randomly selected and the stained cell and total cell numbers were counted. The sample number was 3 each for all 4 populations of MSCs.
The MSCs were seeded into a 12-well plate at 5x104 cells/cm2. The cells were fed in α-MEM with 10% FBS and incubated at 37°C in a humidified atmosphere with 5% CO2. Osteogenic differentiation medium (StemPro® Osteogenesis Differentiation kit; Invitrogen Australia Pty Ltd.) was added to the cells the second day after the cells attached to the bottom of the petri dish. MSCs will undergo limited expansion during differentiation under osteogenic conditions. The cultures were re-fed every 3–4 days. On day 35, the medium was removed from the 12-well plate and the cells were rinsed twice with PBS. The cells were fixed with 4% formaldehyde solution for 30 min. After fixation, the cells were rinsed with distilled water and stained with 2% Alizarin Red S solution (Alizarin Staining kit; Genmed, Shanghai, China) for 5 min. The cells were rinsed 3 times with distilled water and visualized under a light microscope (Olympus). Images were captured for qualitative or quantitative analyses. Bone nodule numbers of a total of 3 wells were counted for each sample. Three samples from each population of MSCs were analyzed.
The 4 populations of MSCs beginning from passage 1 were trypsinized from the culture discs before plating into the 6-well plates at a density of 105/well. Each population of MSCs was seeded in triplicate. Every 4 days, the cells were harvested with trypsin/EDTA and counted using a hemacytometer for up to 8 passages. The mean value of the cell number counts was calculated from 7 tissue samples from each cell population and the mean population doubling time was obtained for each passage according to the following formula: population doubling time = T x lg2/(lgNt - lgN0), where T is the culture time, N0 is the initial cell number and Nt is the harvested cell number.
Total cellular RNA was extracted using TRIzol reagent (Invitrogen Life Technologies, Grand Island, NY, USA) according to the manufacturer’s instructions. RNA integrity was electrophoretically verified by ethidium bromide staining and a OD260/OD280 nm absorption ratio (OD >1.9). Total RNA (500 ng) was reverse transcribed using AWV reverse trancriptase, oligo(dT)15 (~20 mer, Takara, Dalian, China) according to the manufacturer’s instructions. No amplification control (NAC) was included without adding reverse transcriptase. Reactions were incubated at 42°C for 30 min, then 95°C for 5 min and 5°C for 5 min.
Twenty five nanograms of cDNA was used in a 25-μl reaction volume with 0.15 μl Takara Ex Taq HS (Takara), 5 μM of gene-specific forward and reverse primers (Sangon Biotech, Shanghai, China), 5 μl 5X PCR buffer and sterile water. Reactions were incubated at 94°C for 30 sec, 56°C for 30 sec and 72°C for 30 sec for total 30 cycles.
RT-qPCR was carried out to assess the expression of genes, including HLA-DMA, HLA-DRA, HLA-DPB1, JAG1, TLR4, TLR3, NOTCH2 and NOTCH3 in the MSCs derived from the 4 different tissue sources. Primers were designed using primer3 input (
The co-culture of the MSCs and T cells was carried out using 24-well plates (contact culture) and the Transwell system (isolated culture) in which the T cells and MSCs were physically separated by a membrane permeable for soluble factors. The inner hanging cell culture insets with 0.4-μm pore size membrane of a 24-well plate were purchased from Millipore (Billerica, MA, USA). The BM-, AT-, WJ- and PL-MSCs were seeded at 105 cells/well in regular 24-well plates and 24-well Transwell plates containing α-MEM, 10% FBS and 100 U/ml penicillin/streptomycin. After 24 h, 10 μg/ml mitomycin C (MMC; Sigma) were added to inhibit MSC proliferation, and the cells were incubated for 2 h at 37°C followed by 5 extensive washes with medium. A total of 105 T cells/well was added and stimulated with 10 g/ml phytohemagglutinin (PHA; Sigma) and 10 ng/ml interleukin (IL)-2 (Sigma). IL-2/PHA-activated T cells were cultured in the presence or absence of MSCs. The cultures were plated in triplicate and incubated for 5 days before the addition of 5-bromo-20-deoxyuridine (BrdU). After 18 h, proliferation was assessed using the BrdU-Assay kit (Roche Applied Science, Penzberg, Germany) according to the manufacturer’s instructions.
Statistical analyses were performed using SPSS software version 17.0 (SPSS Inc., Chicago, IL, USA). The differences among the treatment groups were analyzed by one-way analysis of variance (ANOVA) and two-way ANOVA with post-hoc analysis using the Dunnett’s test. Parametric data are expressed as the means ± standard deviation (SD). A value of P<0.05 was considered to indicate a statistically significant difference.
The MSCs derived from 4 different sources (BM, AT, WJ and PL) presented the typical morphology of fibroblastic cells and displayed a high capacity to adhere to the plastic disc (
The cell-surface antigen profiles of these cells after 3 passages in culture were analyzed by flow cytometry. These cells were strongly positive for MSC-specific surface markers, such as CD44, CD73, CD90 and CD105, but negative for CD14, CD34 and CD45 (
Oil Red O staining revealed that the MSCs were positive for lipid vesicle-forming adipocytes (
As regards osteogenesis, the cell volume began to increase after 1 week of induction. The shape of the cells gradually became triangular or polygonal and granular matter appeared in the cytoplasm. After 3 weeks of induction, yellow substances accumulated in the MSCs from all 4 tissue sources, particulary in the WJ-MSCs, and gradually, these sediments increased in size to form round or polygonal nodules (
During cell proliferation, the MSCs were cultured up to passage 8. The WT-MSCs displayed the highest cumulative cell population followed by the AT-, PL- and BM-MSCs (
The MSCs were screened for their surface expression of HLA antigens, co-stimulatory factors and immune tolerance molecules. Through RT-qPCR of HLA-DMA, HLA-DPB1 and HLA-DRA, we found that the BM-MSCs had the highest expression of MHCII molecules than the other MSC populations. The WJ-MSCs had the lowest expression of these molecules among the 4 cell populations. The expression of DMA, DRA and DPB1 in the BM-MSCs was 16-, 36- and 4-fold higher, respectively compared with the WJ-MSCs (
PHA/IL-2-activated T cells were incubated on a layer of MSCs derived from BM, AT, WJ and PL tissue. T cell proliferation decreased significantly following co-culture with the MSCs. The ratio of growth retardation of the T lymphocytes in the contact culture was: BM-MSCs, 41.4±3.2%; AT-MSCs, 35.5±1.7%; WJ-MSCs, 22.6±0.9% and PL-MSCs, 30.4±1.2% when compared to the T cells cultured alone. The results from Transwell culture were similar to those of the contact culture (P>0.05). The inhibitory effects of the AT-MSCs, WJ-MSCs and PL-MSCs on T cell proliferation were more prominent than those of the BM-MSCs (P<0.01). The inhibitory effects of the WJ-MSCs on T cell proliferation were the most prominent (P<0.01;
BM is the earliest tissue source for MSC extraction and represents the most commonly used source for MSCs in clinical treatments. However, there are some limitations in using BM-MSCs due to the high degree of viral exposure and the significant decrease in cell number and proliferation/differentiation capacity with the increasing age of the donor (
In this study, we performed a side-by-side comparison of 4 populations of MSCs derived from BM, AT, WJ and PL simultaneously. We observed significant differences in the proliferative potential among the 4 populations of MSCs; the WJ-MSCs exhibited the highest growth rate. The growth curve showed that the proliferative capacity of the WJ-, AT- and PL-MSCs was significantly greater than that of the BM-MSCs. These data coincide with those of previous studies (
Some believe that the growth differences may not reflect compartment-specific characteristics, but most probably reflect differences in newborn and adult donors (
MSCs derived from different tissues have been demonstrated in a large number of studies to differentiate into cells in the mesodermal lineages, such as osteoblasts and adipocytes (
As regards osteogenesis, the results revealed that the WJ-MSCs had the greatest potential in osteogenesis followed by the PL-MSCs, AT-MSCs and MB-MSCs. Since the WJ and PL tisssues were obtained from individuals who were much younger than the individuals the AT and BM tissues were obtained from, we predicted that the MSCs derived from younger tissue sources would differentiate more easily into osteoblasts that those obtained from older tissue sources. Baksh
It is a widely accepted fact that MSCs have immunosuppressive and immunomodulatory functions. Due to their ability to regulate immune responses, MSCs are a potential candidate for treating a wide range of immune-mediated diseases (
HLA-DRA is one of the HLA class II α chain paralogues. This class II molecule is a heterodimer consisting of an α and a β chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins, such as HLA-DPB1. HLA-DMA is an antigen processing and presentation-related gene. Our data demonstrated that the WJ-MSCs expressed the lowest levels of the HLA class II genes, HLA-DRA, HLA-DPB1 and HLA-DMA, than any other 3 populatinos of MSCs, while the BM-MSCs expressed the highest level of these 3 genes. These data suggest that the WJ-MSCs may be the most effective population of MSCs for clinical application.
We also analyzed the mRNA expression of JAG1, TLR4, TLR3, NOTCH2 and NOTCH3 since they are expressed in MSCs and are closely related to immune response (
It has been shown that MSCs possess the intrinsic homing ability to migrate to injured tissues and actively participate in tissue repair. In addition, MSCs possess the unique ability to suppress immune responses, both
In this study, we demonstrate that the proliferative potential of WJ-MSCs is higher than that of AT-MSCs, PL-MSCs and BM-MSCs. WJ-MSCs have the strongest osteogenic ability followed by the PL-MSCs, AT-MSCs and BM-MSCs. WJ-MSCs have the weakest expression of MHC II genes, while BM-MSC have the highest. WJ-MSCs have the weakest expression of the immune-related genes, TLR4, TLR3, JAG1, NOTCH2 and NOTCH3. Furthermore, WJ-MSCs have the most prominent suppressive effect on T lymphocytes among the 4 populations of MSCs in the co-culture experiments. Therefore, WJ-MSCs may be one of the best sources of MSCs for tissue regeneration in future clinical application.
The morphology of mesenchymal stem cells (MSCs) derived from 4 different types of human tissue. MSCs derived from 4 different types of human tissue were isolated and cultured in a 100-mm Petri dish. The cells displayed a fibroblast-like phenotype. Cells in the images are passage 4. Phase contrast magnification, x100. The scale bar represents 100 μm. BM, bone marrow; AT, adipose tissue; WJ, umbilical cord Wharton’s jelly; PL, placenta.
Flow cytometric analysis of mesenchymal stem cell (MSC) makers. Cells at passage 3 were used. BM, bone marrow; AT, adipose tissue; WJ, umbilical cord Wharton’s jelly; PL, placenta. The conjugated fluorescent dyes are: CD44-PE, CD73-PE, CD14-PE, CD34-PE, CD90-FITC, CD45-FITC and CD105-PerCP. The positively stained cells are expressed as a percentage in the middle of the frame. BM, bone marrow; AT, adipose tissue; WJ, umbilical cord Wharton’s jelly; PL, placenta.
Adipogenesis of mesenchymal stem cells (MSCs). Red color indicates the staining of lipid vesicle-forming adipocytes. All the images have a x100 magnification. The scale bar represents 100 μm. BM, bone marrow; AT, adipose tissue; WJ, umbilical cord Wharton’s jelly; PL, placenta.
Osteogenesis of mesenchymal stem cells (MSCs). Deposition of calcified nodules was visualized by Alizarin red staining. The ‘red clouds’ demonstrates the mineral deposits in some of the MSCs. All images have a x100 magnification. The scale bar represents 100 μm. BM, bone marrow; AT, adipose tissue; WJ, umbilical cord Wharton’s jelly; PL, placenta.
Counting of differentiated adipocytes and bone nodules. Fifteen fields of differentiated adopocytes under a microscope and 9 wells of osteocytes were selected randomly from 3 samples in triplicate. The average of 3 is shown. (A) Adipocyte counting. Stained adipocytes were counted at a magnification of x400. There are 39±1% adipocytes per field from the BM-MSC induction, 52±3.2% from the AT-MSC, 45±1.5% from the WJ-MSC and 38±1.4% from the PL-MSC induction medium. (B) Bone nodule counting. Stained bone nodules were counted at a magnification of x100 in each well of a 12-well plate. A total of 7.5±1.3 bone nodules was counted from the BM-MSC, 11±1.7 from the AT-MSC, 19±1.8 from the WJ-MSC and 14±1.1 from the PL-MSC induction medium. ***P<0.001 when compared with BM-MSCs. BM, bone marrow; AT, adipose tissue; WJ, umbilical cord Wharton’s jelly; PL, placenta.
Proliferative potential of mesenchymal stem cells (MSCs). The number of MSCs was counted each time following subculture from 1 to 8 passages. (A) The data are shown as cumulative cell numbers at each passage. Each column represents the mean from 3 MSC populations with standard deviation. (B) The population doubling time was also calculated based on cell counts. ***P<0.001 when compared to BM-MSCs. BM, bone marrow; AT, adipose tissue; WJ, umbilical cord Wharton’s jelly; PL, placenta.
Expression of immune-related genes analyzed by RT-PCR and RT-qPCR. The mRNA level of immune-related genes from the WJ-, AT-, PL- and BM-MSCs was measured by RT-PCR and RT-qPCR. The column charts represent the RT-qPCR data and gel images below the charts represent the RT-PCR data. The data are presented as the means ± SD from 5 independent experiments. **P<0.01 and ***P<0.001 when compared to BM-MSCs. BM, bone marrow; AT, adipose tissue; WJ, umbilical cord Wharton’s jelly; PL, placenta.
T cell proliferation was inhibited by mesenchymal stem cells (MSCs) in co-culture. The first column is the T cell only control. (A) Cell to cell contact co-culture. The T cell proliferation ratio was reduced to 41.4±3.2%, 35.5±1.7%, 22.6±0.9% and 30.4±1.2%, respectively by MSCs derived from bone marrow (BM), adipose tissue (AT), umbilical cord Wharton’s jelly (WJ) and placenta (PL). (B) Transwell co-culture. The T cell proliferation ratio was reduced to 42.6±1.6%, 35.7±1.8%, 24±2.7% and 30.8±1.7%, respectively by co-culture with BM-MSCs, AT-MSCs, WJ-MSCs, and PL-MSCs. The data are expressed as the means ± SD from 5 independent experiments. The inhibitory effect of the AT-, WJ- and PL-MSC co-culture groups on T cell proliferation was more prominent than that of the BM-MSC group. **P<0.01 when compared to the control.
Primers used for RT-qPCR.
Gene name | Primers | Sequences | Product size (bp) |
---|---|---|---|
HLA-DMA | Forward | AAAATCCCGGTGTCCAGAG | 167 |
Reverse | GTAGGCCCAAATCCTTCCA | ||
HLA-DRA | Forward | CCTGACTGTGGGTCTGGTG | 81 |
Reverse | CGTTCTGCTGCATTGCTTT | ||
HLA-DPB1 | Forward | CCTGGTGATGCTGGAAATG | 105 |
Reverse | GACTGTGCCTTCCACTCCA | ||
JAG1 | Forward | CGGCCTCTGAAGAACAGAAC | 82 |
Reverse | TCACCAAGCAACAGATCCAA | ||
TLR4 | Forward | TTTCACCTGATGCTTCTTGCT | 103 |
Reverse | TCCTTACCCAGTCCTCATCCT | ||
TLR3 | Forward | AGGATTGGGTCTGGGAACA | 95 |
Reverse | AAAAACACCCGCCTCAAAG | ||
NOTCH2 | Forward | TGGGCTACACTGGGAAAAAC | 107 |
Reverse | TAGGCACTGGGACTCTGCTT | ||
NOTCH3 | Forward | CTCATCCGAAACCGCTCTAC | 101 |
Reverse | TCTTCCACCATGCCCTCTAC |