Increasing epidemiological data have suggested a link between vitamin D deficiency and the incidence of inflammatory bowel disease (IBD). In the present study, we confirmed that vitamin D deficiency, as well as the decreased local expression of vitamin D receptor (VDR), was prevalent in an IBD cohort. The excessive apoptosis of intestinal epithelial cells (IECs) partly accounts for the development of colonic inflammation and eventually results in IBD. Based on the established inhibitory effects of the vitamin D/VDR pathway on IEC apoptosis, we treated mice with 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis with paricalcitol, a vitamin D analog, in order to investigate the mechanisms responsible for the inhibitory effects of the vitamin D/VDR pathway. We observed that following treatment with vitamin D, the mice presented with only minor bodyweight loss, and the mice also showed improved histological scores and decreased intestinal epithelial permeability compared with the vehicle-treated group. The colonic mRNA expression of inflammatory cytokines and chemokines was markedly suppressed, indicating less severe colitis in the vitamin D-treated mice. Subsequently, we investigated p53 upregulated modulator of apoptosis (PUMA) and p53, two major independent pathways of apoptosis, as well as caspase-3. We found that the vitamin D-treated mice had lower expression levels of caspase-3 than the vehicle-treated mice. PUMA expression showed the same tendency; however, the p53 protein level was not altered. The present study indicates that vitamin D attenuates the development of TNBS-induced colitis by inhibiting the apoptosis of IECs. The mechanisms involved include the downregulation of PUMA expression. Our data provide experimental support for the clinical trials of vitamin D intervention in patients with IBD.
Crohn’s disease (CD) and ulcerative colitis (UC) are the two major forms of chronic inflammatory bowel disease (IBD). Increasing epidemiological data have suggested a link between vitamin D deficiency and the incidence of IBD, and vitamin D deficiency has been shown to be prevalent in patients with IBD (
The intestinal epithelial barrier plays an important role in the development of colitis, which consists of a monolayer of epithelial cells and intercellular junctions between adjacent cells that seal the paracellular gap (
1,25-Dihydroxyvitamin D3 (calcitriol) is the active form of vitamin D and binds with VDR. Apart from its classical calcium-regulating effect, vitamin D serves as a potent regulator of multiple biological activities, including antimicrobial activities, the inhibition of apoptosis and immunomodulatory functions (
Human biopsies were collected through endoscopic examination from patients with UC and CD at the Shengjing Hospital of China Medical University between January 2012 and December 2012. Non-IBD control subjects were selected from subjects who underwent endoscopic examination for the elimination of other bowel diseases and were proven to be free of gut-related diseases. Written informed consent was obtained from each subject prior to enrollment in the study.
Male adult C57BL6/J mice, weighing 20–25 g, were supplied by the Center of Experimental Animals of China Medical University, Shenyang, China. All animal procedures were reviewed and approved by the Laboratory Animal Ethics Committee of China Medical University. The mice were anaesthetized by an intraperitoneal (i.p.) injection of cocktail anesthetics [ketamine (ketavest 100 mg/ml); Pfizer, New York, NY, USA) and [xylazine (Rompun 2%); Bayer HealthCare, Leverkusen, Germany). The mice were treated with 100 mg/kg TNBS (Sigma-Aldrich, St. Louis, MO, USA) dissolved in 50% ethanol by intrarectal injection with an 18-gauge stainless steel gavage needle. The control group was treated with 50% ethanol without TNBS, as previoulsy described (
The TNBS and control groups were randomly divided into 2 groups, respectively. One group was treated with the vitamin D analog, paricalcitol (Sigma-Aldrich), dissolved in propylene glycol:ethanol, 90:10 at 0.5
The mice were sacrificed 48 h after the TNBS injection. A 2-cm section of the colon was cut from each mouse and the colonic mucosa was harvested. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from 3
The colonic mucosa lysates were separated by SDS-PAGE, and the proteins were transferred electrophoretically onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). We used ImageJ software (National Institutes of Health, Bethesda, MD, USA) to quantify the density of the bands normalized to that of β-actin. The antibodies used in the present study included: anti-VDR (C20; 1:2,000; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), anti-β-actin (A5316; 1:10,000; Sigma-Aldrich), anti-p53 (9282; 1:3,000; Cell Signaling Technology, Beverly, MA, USA), anti-p53 upregulated modulator of apoptosis (PUMA; 7467; 1:3,000; Cell Signaling Technology) and anti-caspase 3 (9662; 1:1,000; Cell Signaling Technology) antibodies.
The whole colons were harvested on day 4 after the TNBS injection. The colon morphology was recorded and scored according to a macroscopic scoring system (
The human serum 25-hydroxyvitamin D concentration (nmol/l) was measured using a commercial 25-hydroxyvitamin D EIA kit (Immunodiagnostic Systems PLC, Boldon, Tyne & Wear, UK) according to the manufacturer’s instructions.
The mice were denied access to food, but were allowed to drink water for 4 h before gavage. FITC-4 kDa dextran (50 mg/ml) (Sigma-Aldrich) was administered by gavage at a dose of 4
The average serum 25-hydroxyvitamin D levels in the patients with UC and CD were significantly lower than those of the normal controls (
We used a mouse model of TNBS-induced colitis to mimic the pathological process of IBD. Paricalcitol, a vitamin D analog, was administrated to investigate the protective role of the vitamin D/VDR signaling pathway. Paricalcitol has been proven to exert the same curative effect as calcitriol, but it produces less side-effects, including less hypercalcemia (
We further examined the expression of pro-inflammatory cytokines and chemokines in the colonic mucosa. The mRNA expression of cytokines and chemokines was markedly increased by the TNBS injection, while paricalcitol markedly reversed this increase in the expression of the majority of cytokines. This tendency was most obvious with the expression of tumor necrosis factor (TNF)-α and interleukin (IL)-17, two important cytokines associated with the Th1 and Th17 response, respectively. However, monocyte chemotactic protein-1 (MCP-1) was the only chemokine which showed no statistically significant differences in its expression between the VD and VE group (
We evaluated intestinal permeability following the administration of vitamin D in our mouse model of TNBS-induced colitis. After the TNBS injection, the permeability of the intestinal barrier increased in both the VD and VE group, while the serum concentration of FITC-4-kDa dextran in the mice in the VD group was exclusively lower than that of the mice in the VE group. In other words, the administration of vitamin D protects the integrity of the intestinal barrier and, thus, inhibits the increase in intestinal permeability (
In order to further disclose the mechanisms responsible for the protective effects of vitamin D, we analyzed the expression of p53 and PUMA, two upstream pro-apoptotic proteins of caspase-3. They independently mediate the apoptosis of IECs in patients and mice with colitis (
Epidemiological evidence suggests a link between vitamin D deficiency and an increased risk of developing IBD (
VDR is highly expressed in the intestine. The classical function of VDR in the small intestine is to regulate the transportation and absorption of calcium and maintain calcium homeostasis. However, the function of VDR in the colon remains to be illustrated. Kong
Clinical studies have revealed that vitamin D supplementation can deter the pathological process of IBD and relieve the symptoms (reviewed in 28); however, the mechanisms responsible for this effect have not yet been fully elucidated. In this study, we found that the vitamin D analog, paricalcitol, substantially alleviated the severity of colitis induced by TNBS, a model of Th1-mediated colitis. The effects of paricalcitol were, at least in part, mediated through the inhibition of the apoptosis of IECs.
PUMA is a key mediator of IEC apoptosis in IBD (
In conclusion, this study provides evidence that vitamin D attenuates the development of colitis by inhibiting the apoptosis of IECs. The mechanisms involved include the downregulation of PUMA expression. The present study may shed new light on the curative mechanisms of vitamin D in patients with IBD.
The present study was supported by the National Natural Science Foundation of China (81271938) and the Outstanding Scientific Fund of Shengjing Hospital.
Low vitamin Ds level and reduced VDR expression in patients with UC and CD compared to the normal controls. (A) Serum 25(OH)D concentrations in normal controls and patients with IBD. (B) Relative expression of VDR in normal controls and patients with IBD analyzed by RT-qPCR. (C) Representative western blots of colonic biopsies from normal controls and patients with IBD. (D) Densitometric quantification of VDR expression compared to β-actin. Values are presented as the means ± SD. UC, ulcerative colitis; CD, Crohn’s disease (n>10 in each group). VDR, vitamin D receptor; IBD, inflammatory bowel disease; 25(OH)D, 25-hydroxyvitamin D.
The vitamin D analog, paricalcitol, ameliorates TNBS-induced colitis. (A) Body weight changes over time in the vehicle-treated group and vitamin D-treated group after the TNBS injection. **P<0.01, ***P<0.001 vs. vehicle treatment (n=8 in each group). (B) Colon morphology. (C) Macroscopic scoring of colon morphology. (D) H&E staining of distal colon. (E) Microscopic scoring of H&E-stained slides (original magnification, x100) from the vehicle- and paricalcitol-treated groups on day 4 after the TNBS injection or from the control group (50% ethanol injection). TNBS, 2,4,6-trinitrobenzene sulfonic acid.
RT-qPCR quantification of pro-inflammatory cytokines and chemokines in the colon mucosa from the vehicle- and paricalcitol-treated mice on day 2 after the TNBS injection or in the control group (50% ethanol injection). #P>0.05, *P<0.05, **P<0.01, ***P<0.001 (n=6-8 in each group). TNBS, 2,4,6-trinitrobenzene sulfonic acid.
Paricalcitol decreases colon mucosa permeability after the TNBS injection. #P>0.05, *P<0.05 (n=4–5 in each group). TNBS, 2,4,6-trinitrobenzene sulfonic acid; conc, concentration.
Vitamin D supplementation attenuates colon epithelial cell apoptosis. (A) Western blot analysis and (B) densitometric quantification of the colonic mucosal apoptotic proteins, p53, p53-upregulated modulator of apoptosis (PUMA) and caspase-3, in the vehicle- and paricalcitol-treated mice after the TNBS injection on day 2. #P>0.05, *P<0.05 (n=6 in each group). TNBS, 2,4,6-trinitrobenzene sulfonic acid.
Primers used in this study for PCR.
Primer name | Forward (5′→3′) | Reverse (3′→5′) |
---|---|---|
Human VDR | ACCTGGTCAGTTACAGCATC | ACTGACGCGGTACTTGTAGT |
Human B2M | TGGGTTTCATCCATCCGACA | ACGGCAGGCATACTCATCTT |
Mouse IL-1β | AATGAAAGACGGCACACCCA | TGCTTGTGAGGTGCTGATGT |
Mouse IL-6 | CCTCTGGTCTTCTGGAGTACC | ACTCCTTCTGTGACTCCAGC |
Mouse TNF-α | ATGAGCACAGAAAGCATGA | AGTAGACAGAAGAGCGTGGT |
Mouse IFN-γ | TTCTTCAGCAACAGCAAGGC | TCAGCAGCGACTCCTTTTCC |
Mouse MCP-1 | GCTCAGCCAGATGCAGTTAA | TCTTGAGCTTGGTGACAAAAACT |
Mouse IL-17 | TCTCCACCGCAATGAAGACC | CACACCCACCAGCATCTTCT |
Mouse IL-23 p19 | GCTGTGCCTAGGAGTAGCAG | TGGCTGTTGTCCTTGAGTCC |
Mouse B2M | CGGCCTGTATGCTATCCAGA | GGGTGAATTCAGTGTGAGCC |
VDR, vitamin D receptor; B2M, β2 microglobulin; IL, interleukin; TNF, tumor necrosis factor; MCP-1, monocyte chemoattractant protein-1.