The number of pro-α cells is known to increase in response to β cell injury and these cells then generate glucagon-like peptide-1 (GLP-1), thus attenuating the development of diabetes. The aim of the present study was to further examine the role and the mechanisms responsible for intra-islet GLP-1 production as a self-protective response against lipotoxicity. The levels of the key enzyme, prohormone convertase 1/3 (PC1/3), as well as the synthesis and release of GLP-1 in models of lipotoxicity were measured. Furthermore, islet viability, apoptosis, oxidative stress and inflammation, as well as islet structure were assessed after altering GLP-1 receptor signaling. Both prolonged exposure to palmitate and a high-fat diet facilitated PC1/3 expression, as well as the synthesis and release of GLP-1 induced by β cell injury and the generation of pro-α cells. Prolonged exposure to palmitate increased reactive oxygen species (ROS) production, and the antioxidant, N-acetylcysteine (NAC), partially prevented the detrimental effects induced by palmitate on β cells, resulting in decreased GLP-1 levels. Furthermore, the inhibition of GLP-1 receptor (GLP-1R) signaling by treatment with exendin-(
Generally, the ectopic overaccumulation of lipids can trigger cellular dysregulation and functional tissue impairment, a process referred to as lipotoxicity (
Recently, interest in GLP-1 has intensified due to numerous important discoveries revealing that a functional GLP-1 system resides in α cells and is responsive to β cell stress and injury (
We thus hypothesized that an intra-islet GLP-1 system may be the direct target of signals and self-preservation mechanisms that enhance β cell survival against lipotoxicity, in which oxidative stress plays a critical role. Our findings suggest that an elevated number of immature pro-α cells and the generation of GLP-1 are an advantage to β cells during conditions of high metabolic demand or stress, and that this ‘self-defense’ behavior facilitates β cell survival by reshaping the oxidative balance and inhibiting inflammation.
Male wild-type C57BL/6J mice were used for all the islet experiments. The mice were maintained under standard light conditions (12/12-h light/dark cycle) and were allowed free access to food and water. The male C57BL/6 mice and their food were purchased from Beijing HFK Bio-Technology Co., Ltd. (Beijing, China). The care and experimental treatment of the animals were approved by the Animal Research Committee of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China. Six-week-old mice, weighing 21±2 g, were randomized into groups and fed either a high-fat diet (HFD; 20% protein, 20% carbohydrate and 60% fat), or a standard rodent chow diet [low-fat diet (LFD); 20% protein, 70% carbohydrate and 10% fat]. After 4 weeks on the HFD or LFD, the mice were injected with liraglutide (200 mg/kg body weight; Novo Nordisk, Princeton, NJ, USA) or a placebo [phosphate-buffered saline (PBS)] daily for 4 weeks. Body weight and food intake were measured weekly. To exclude the differences induced by food intake, all the mice fed the HFD were pair-fed. After the 8 weeks of feeding and drug administration, the mice were anesthetized with an intraperitoneal injection of pentobarbital sodium (0.6 mg/kg body weight).
For the measurement of fasting blood glucagon and insulin levels, the mice were fasted 6 h. The insulin and glucagon concentrations were determined using the the insulin enzyme-linked immunosorbent assay (ELISA) kit (Millipore, Boston, MA, USA). The plasma GLP-1 concentrations were measured using an ELISA kit (Linco Research, St. Charles, MO, USA).
Non-diabetic mouse islets were isolated from the pancreata according to a previously described method (
The non-diabetic islets were seeded into 24-well plates; 25 islets were added to each well. The palmitate solution was prepared as previously described (
After functional analysis, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to determine the proportion of viable cells in the treated group compared to the control group, as previously described (
DNA fragmentation activity in the islets was quantified using a Cell Death Detection ELISA Plus kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer\s instructions. Following treatment, the cells were washed twice with PBS and incubated with lysis buffer for 20 min at room temperature. Following centrifugation to remove the nuclei and cellular debris, the supernatants were diluted 1:5 with lysis buffer, and each sample was analyzed using ELISA.
The quantification of intracellular ROS levels was carried out using the fluorescent probe, 2,7-dichlorofluorescein diacetate (DCFH-DA), as described in our previous study (
The islets were seeded into 24-well plates; 50 islets were added to each well. Following treatment, the islets were washed with PBS prior to the addition of cell lysis buffer containing protease inhibitor cocktail and PhoshopStop tablets (Roche Applied Science). The primary antibodies used were PC1/3 (1:1,000; AB10553; Millipore) and pancreatic duodenal homeobox 1 (PDX1) (1:1,000; 5679; Cell Signaling Technology, Boston, MA, USA). An antibody against mouse β-actin (A1978) was obtained from Sigma-Aldrich. Densitometric analysis was performed using ImageJ software.
After the mice were euthanized, and their pancreata were removed, the pancreatic tissue was harvested and fixed in 4% formaldehyde overnight and stored in 70% ethanol. Fixed sections of pancreatic tissues were embedded in paraffin and cut into 5-
Total RNA from the isolated islets and mouse pancreatic tissue samples was extracted using TRIzol reagent (Invitrogen). First-strand cDNA synthesis was performed using a cDNA synthesis kit (Takara Shuzo Co., Ltd., Kyoto, Japan) and qPCR was performed using a LightCycler (Roche Diagnostics GmbH). The primers used in this study are listed in
The results of the present study are expressed as the means ± SEM values, and data were analyzed using the Student’s t-test or one-way analysis of variance (ANOVA) followed by the Bonferroni post-hoc test. A value of p<0.05 was considered to indicate a statistically significant difference.
Following the incubation of the isolated mouse islets for 24, 48 or 72 h, treatment with 0.5 mmol/l palmitate for24, 48 and 72 h led to a significant decrease in islet viability and an increase in cell death in a time-dependent manner (
Importantly, incubation of the cells with 0.5 mmol/l palmitate for 24, 48 or 72 h markedly induced the release of GLP-1 into the culture medium by 3.15-, 6.55- and 5.62-fold, respectively (
After 8 weeks of being fed a HFD, PC1/3 protein expression in the HFD group markedly increased (
Treatment with exendin-(
Considering the short biological half-life of exendin-(
Unlike the defined α cell mantle and β cell core characteristics of the islets from the mice fed a LFD, the islets from the mice fed a HFD maintained a more scattered organization and a higher percentage of α cells. Furthermore, in the HFD group, there was a greater difference in the expression of insulin (
Incubation of the cells with 0.5 mmol/l palmitate for 24, 48 or 72 h markedly increased the intra-islet ROS levels by approximately 3.01-, 5.12- and 6.45-fold, respectively (
Given the intermediary role of oxidative stress in palmitate-induced injury, we hypothesized that GLP-1R signaling may re-shape the oxidative balance by suppressing the generation of ROS and enhancing antioxidant defenses. The inhibition of GLP-1R signaling by exendin-(
Based on the fact that the nuclear factor-κB (NF-κB) activation by ROS (
To the best of our knowledge, the present study for the first time examined the hypothesis that lipotoxicity directly stimulates the generation of immature pro-α cells, resulting in pro-α cells producing endogenous GLP-1 to facilitate β cell survival by maintaining the oxidative balance and by inhibiting islet inflammation. Prolonged exposure to palmitate induced lipotoxicity, and a HFD induced PC1/3 expression and, in turn, increased the synthesis and release of GLP-1, which were partly mediated by lipotoxicity-induced oxidative stress. The activation of GLP-1R signaling was attributed to the normalization of islet function and structure. Furthermore, GLP-1 exerted protective effects against lipid overload, partially by increasing antioxidant gene expression and decreasing the levels of ROS, NF-κB and inflammatory factors.
Evidence examining the striking innate plasticity of islets has recently received significant attention as the dedifferentiation of hyperplastic α cells maintains an immature pro-α phenotype in response to β cell stress or injury (
Unequivocally, in our study, intra-islet GLP-1 enhanced β cell survival against lipotoxicity through a pleiotropic mechanism. Initially, intra-islet GLP-1/GLP-1R signaling partially decreased the palmitate-induced damage to β cells. The GLP-1R antagonist, exendin-(
Our data suggest that oxidative stress plays a role as the bridge between lipid overload and the intra-islet GLP-1 system. Oxidative stress is a common biochemical trigger of stress-sensitive signaling pathways, including NF-κB, p38 MAPK and JNK (
In conclusion, the findings of the present study suggest that endogenous GLP-1/GLP-1R signaling is a ‘self-defense’ pathway that facilitates islet survival against lipotoxicity. The protective mechanism of intra-islet GLP-1 may be the achievement of oxidative balance, as well as the inhibition of islet inflammation. Further research on the intra-islet GLP-1 system is required to obtain a better understanding of the mechanisms through which adult β cells maintain or change their identity due to lipotoxicity.
The present study was supported by a grant provided by the National Natural Science Foundation of China (no. 81370880).
Palmitate induces injury to isolated mouse islets. Following incubation with 0.5 mmol/l palmitate for the indicated periods of time (24, 48 and 72 h), islet (A) viability and (B) apoptosis were analyzed by examining histone-associated DNA fragments and by MTT assay, respectively. Following incubation with 0.5 mmol/l palmitate for 48 h, (C) the insulin mRNA and (D) pancreatic duodenal homeobox 1 (PDX1) mRNA and protein levels were determined by qPCR and immunoblot analysis, respectively. The relative transcript levels were normalized to those of 36B4. n=3 separate islet preparations; *p<0.05; **p<0.01.
Prolonged exposure to palmitate induces the activation of the glucagon-like peptide-1 (GLP-1) system in isolated mouse islets. After the islet cells were incubated with 0.5 mmol/l palmitate for the indicated periods of time, the GLP-1 levels in the (A) cell medium and (B) lysates were determined by insulin enzyme-linked immunosorbent assay (ELISA), and (C) prohormone convertase 1/3 (PC1/3) mRNA expression in cell lysates was determined by qPCR and (D) the PC1/3 protein level was determined by immunoblot anlaysis. n=3 separate islet preparations; **p<0.01; ***p<0.001.
High-fat diet (HFD) induces intra-islet glucagon-like peptide-1 (GLP-1) system activation. (A) Representative images of immunofluorescence staining for insulin (green) and prohormone convertase 1/3 (PC1/3) (red) in the pancreatic islets of mice that were fed a low-fat diet (LFD) (n=6) or a HFD (n=7) for 8 weeks. The arrows indicate the insulin-negative and PC1/3-positive cells. (B) PC1/3 mRNA expression in the pancreata of mice from each group was detected by qPCR. (C) Plasma GLP-1 levels in the mice were detected by insulin enzyme-linked immunosorbent assay (ELISA). LFD compared with HFD; **p<0.01; ***p<0.001.
Glucagon-like peptide-1 receptor (GLP-1R) inhibition exacerbates the detrimental effects of palmitate. Isolated islets were pre-treated with the GLP-1R antagonist, exendin-(
The glucagon-like peptide-1 receptor (GLP-1R) signaling agonist, liraglutide, attenuates lipotoxicity-induced islet dysfunction. Isolated non-diabetic islets were pre-treated with 100 nmol/l liraglutide and/or 0.5
Liraglutide normalizes the islet architecture of mice fed a high-fat diet (HFD). (A) Representative images of staining for insulin (green) and glucagon (red). After immunofluorescence, areas labeled for insulin (β-cell) and glucagon (red) were measured, and the results are expressed as the mean (B) islet size, (C) α/β ratio, (D) β cell mass and (E) α cell mass. Analyses were performed on histological sections obtained from mice fed a low-fat diet (LFD) + the placebo (phosphate-buffered saline) (LFD; n=6), a HFD + placebo (phosphate-buffered saline) (HFD; n=7) or a HFD + liraglutide (n=6). *p<0.05; ***p<0.001.
Prolonged exposure to palmitate induces reactive oxygen species (ROS) productin and activates the glucagon-like peptide-1 (GLP-1) system. (A) Following incubation with 0.5 mmol/l palmitate for the indicated periods of time, ROS levels were detected by DCFH-DA. Following pre-incubation with 5 mmol/l N-acetylcysteine (NAC) for 48 h, cell (B) viability (by MTT assay) and (C) apoptosis (by examining histone-associated DNA fragments), and (D) prohormone convertase 1/3 (PC1/3) mRNA (by qPCR) and (E) GLP-1 levels (by ELISA) in the cell lysates were determined. n=3 separate isolated islet preparations; *p<0.05; **p<0.01; ***p<0.001.
Glucagon-like peptide-1 receptor (GLP-1R) signaling exerts inhibitory effects on the generation of reactive oxygen species (ROS). (A and B) Following pre-incubation with 100 nmol/l liraglutide and/or 0.5
Glucagon-like peptide-1 receptor (GLP-1R) signaling suppresses islet inflammation. (A) Representative images of staining for insulin (green) and p65 (red)
List of primers used for qPCR using SYBR-Green.
Gene | Gene ID | Forward sequence (5′→3′) | Reverse sequence (5′→3′) | Length |
---|---|---|---|---|
Nkx6.1 | NM_144955.2 | ACTTGGCAGGACCAGAGAG | GCGTGCTTCTTTCTCCACTT | 109 |
PDX1 | NM_008814.3 | TGAACTTGACCGAGAGACACAT | GGTCCCGCTACTACGTTTCTTA | 92 |
PC1/3 | NM_013628.2 | ACATGGGGAGAGAATCCTGTAGGCA | CATGGCCTTTGAAGGAGTTCCTTGT | 220 |
Insulin-1 | NM_008386.3 | GGACCCACAAGTGGAACAAC | GCTGGTAGAGGGAGCAAATG | 130 |
GLUT2 | NM_031197.2 | GCCAAGTAGGATGTGCCAAT | CCCTGGGTACTCTTCACCAA | 110 |
NOX4 | NM_015760.5 | ATTTGGATAGGCTCCAGGCAAAC | CACATGGGTATAAGCTTTGTGAGC | 155 |
p22phox | NM_001301284.1 | GGCACCATCAAGCAACCACC | CTCATCTGTCACTGGCATTGGG | 135 |
gp91phox | NM_007807.5 | TCCGTATTGTGGGAGACTGGACG | AATGGAGGCAAAGGGCGTGAC | 194 |
SOD2 | NM_013671.3 | CAGACCTGCCTTACGACTATGG | CTCGGTGGCGTTGAGATTGTT | 113 |
GPx-1 | NM_008160.6 | CCTCAAGTACGTCCGACCTG | CAATGTCGTTGCGGCACACC | 197 |
IL-1β | NM_008361.3 | GCACACCCACCCTGCA | ACCGCTTTTCCATCTTCTTCTT | 69 |
IL-6 | NM_031168.1 | TCCAGAAACCGCTATGAAGTTC | CACCAGCATCAGTCCCAAGA | 73 |
TNF-α | NM_013693.3 | CTCCAGGCGGTGCCTATG | GGGCCATAGAACTGATGAGAGG | 149 |
36B4 | NM_007475.5 | CAGCAAGTGGGAAGGTGTAATCC | CCCATTCTATCATCAACGGGTACAA | 75 |
Length is indicate in bp. PDX1, pancreatic duodenal homeobox 1; PC1/3, prohormone convertase 1/3; GLUT2, glucose transporter 2; NOX4, NADPH oxidase 4; SOD2, superoxide dismutase 2; GPx-1, glutathione peroxidase 1; TNF-α, tumor necrosis factor-α; IL, interleukin.
The percentage and mean area (
LFD
|
HFD
|
HFD + liraglutide
| ||||
---|---|---|---|---|---|---|
Percentage | Mean area | Percentage | Mean area | Percentage | Mean area | |
Small islets (<5,000 |
70.37 | 1470.86±115.034 | 54.40 | 2122.65±154.12 |
66.67 | 2027.76±148.49 |
Medium islets (5,000–10,000 |
15.43 | 7696.40±256.16 | 25.82 | 7562.77±209.21 | 20.60 | 8101.04±256.92 |
Large islets (>10,000 |
14.20 | 26220.00±3448.25 | 19.78 | 19460.94±1306.30 | 12.73 | 26757.57±3244.72 |
Results are means ± SEM (n=6–7).
p<0.05 vs. control. LFD, low-fat diet; HFD, high-fat diet.