3-Methyladenine (3-MA; autophagy inhibitor), rapamycin (autophagy activator), SM7368 (NF-κB inhibitor), PD98059 (ERK inhibitor), SP600125 (JNK inhibitor) and SB203580 (p38 MAPK inhibitor) were purchased from Calbiochem (Danvers, MA, USA). TNF-α and IL-1β were obtained from Peprotech, Inc. (Rocky Hill, NJ, USA). Beclin-1 (#3495), LC3 (#12741), GAPDH (#2118) antibody and rabbit immunoglobulin G (IgG) conjugated with horseradish peroxidase were obtained from Cell Signaling Technology, Inc. (Beverly, MA, USA), while the MMP3 (#ab52915) and COX2 (#ab179800) antibodies were purchased from Abcam (Cambridge, UK). NF-κB reporter construct, psPAX2, pMD2.G, pRL-TK and pLKO.1 plasmids were kindly provided by Dr D Xiao (Nanfang Medical University, Guangzhou, China) (26). IKKβ shRNA (TRCN0000018917) was purchased from Dharmacon, Inc. (Lafayette, CO, USA), and the knockdown sequence was ATGTTCAAGATATGAACCAGC.

Consistent with the Institutional Review Board guidelines of Sun Yat-sen University (Guangzhou, China), human NP tissue samples of Pfirrmann grades 1–2 (27) were obtained from two female thoracolumbar fracture patients undergoing spinal fusion. Informed consent for sample collection was obtained from each patient. All the Sprague-Dawley rats were obtained from the Laboratory Animal Center of Sun Yat-sen University. Experimental procedures were approved by the Animal Care and Use Committee of Sun Yat-sen University.

NP cells were isolated as described by Ye et al (28). For isolation of rat NP cells, following euthanization by an overdose of pentobarbital (100 mg/kg body weight), the lumbar IVDs of Sprague-Dawley rats, aged 2 months, were collected. Subsequently, NP tissues were separated from AF tissues under the microscope. Later, the NP tissues from the same rats were cut into small pieces, digested with 0.2% pronase medium (Sigma, St. Louis, MO, USA) for 1 h and subsequently cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco-BRL, Gaithersburg, MD, USA) with 10% fetal bovine serum (FBS) and antibiotics (100 U/ml penicillin and 100 U/ml streptomycin) at 37°C in a 5% CO₂ incubator. The medium was refreshed every 3 days. Subsequent to reaching 80% confluence, the NP cells were treated with TNF-α or IL-1β and at corresponding time-points the cell RNA or protein extraction was performed. The inhibitor or activator was added 1 h before TNF-α or IL-1β.

Rat NP cells were plated in 96-well plates (6×10³ cells/well). After the treatment with TNF-α and IL-1β for 24 h, NP cells were fixed with 4% paraformaldehyde, permeabilized with 1% Triton X-100 for 10 min and blocked with phosphate-buffered saline (PBS) containing 5% FBS serum for 1 h at room temperature. The cells were subsequently incubated with antibodies against LC3-II antibody (1:200; Cell Signaling Technology, Inc.) at 4°C overnight. The following day, NP cells were washed with PBS and were incubated with Alexa Fluor 488-conjugated anti-rabbit (Invitrogen Life Technologies, Carlsbad, CA, USA) secondary antibody at a dilution of 1:100 for 1 h and 50 µM propidium iodide for 15 min at room temperature. The images were captured with a fluorescent microscope.

Rat NP cells were seeded in 48-well plates (4×10⁴ cells/well) with 2% Opti-MEM. The following day, 250 ng of NF-κB reporter construct and 250 ng pRL-TK plasmids were premixed with the transfection reagent, Lipofectamine 2000 (Invitrogen Life Technologies) and were co-transfected cells. At 48 h after transfection, the cells were treated with TNF-α (50 ng/ml) or IL-1β (10 ng/ml) for 24 h, and subsequently the cells were harvested. Firefly and Renilla luciferase activities were measured by a dual-luciferase reporter assay (Promega Corporation, Madison, WI, USA). All the luciferase assays were performed in triplicate and every experiment was repeated ≥3 times.

As described previously (28), HEK 293T human embryonic kidney cells at a density of 3×10⁶ cells/10-cm plate were seeded in DMEM with 10% heat-inactivated FBS. Approximately 24 h later, cells were transfected with 9 µg of shRNA control sequence or IKK shRNA plasmids, along with 6 µg psPAX2 and 3 µg pMD2.G. The transfection medium was replaced with DMEM with 10% heat-inactivated FBS 16 h later. At 48 and 60 h after transfection, the plasmid medium containing lentiviral particles was harvested from HEK 293T cells. Subsequently, a virus solution replaced the medium in the plate-seeded human NP cells at a density of 0.5×10⁶ cells/10-cm plate, along with 6 mg/ml polybrene. Five days later, cells were harvested for protein extraction.

Total RNA was extracted with TRIzol reagent (Invitrogen Life Technologies) following the manufacturer's instructions. Single-stranded cDNA templates were prepared from 2,000 ng total RNA using SuperScript III Reverse Transcriptase (Invitrogen Life Technologies). Template cDNA and gene-specific primers were added to Fast SYBR Green Master mix (Applied Biosystems, Foster City, CA, USA) and mRNA expression was quantified using the 7900HT Fast Real-Time PCR System (Applied Biosystems). Hprt was used to normalize the expression. Each sample was analyzed in duplicate. All the primers used were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China).

The primers were as follows: MMP2 sense, GGTGGTGGTCACAGCTATTT and antisense, CCAGCCAGTCCGATTTGAT; MMP3 sense, CAGGGAAAGTGACCCACATATT and antisense, CGCCAAGTTTCAGAGGAAGA; MMP9 sense, CCCAACCTTTACCAGCTACTC and antisense, GTCAGAACCGACCCTACAAAG; ADMATS4 sense, GGAGATCGTGTTTCCAGAGAAG and antisense, CAAAGGCTGGTAATCGGTACA; COX2 sense, TCAACCAGCAGTTCCAGTATC and antisense, GTGTACTCCTGGTCTTCAATGT; and Hprt sense, GCTGACCTGCTGGATTACAT and anti-sense, CCCGTTGACTGGTCATTACA.

Following the treatment, the plates with NP cells were placed on ice immediately. The condition medium was collected with corresponding collection tubes, and cells were washed with ice-cold PBS twice and collected with scrapers. Following centrifugation (10,000 × g), the cells were treated with lysis buffer, including 1X Protease Inhibitor Cocktail (Roche Diagnostics GmbH, Mannheim, Germany), NaCl (5 mM), NaF (200 µM), Na₃VO₄ (200 µM) and dithio-threitol (0.1 mM). Subsequently, total cell proteins (30 ng) qualified with bicinchoninic acid reagent were resolved on 10–15% SDS-polyacrylamide gels and transferred by electroblotting to PVDF membranes (Bio-Rad, Hercules, Hercules, CA, USA). The membranes were blocked with 5% non-fat dry milk in 50 mM Tris (pH 7.6), 150 mM NaCl and 0.1% Tween-20, and incubated overnight at 4°C with anti-Beclin-1 (1:1,000), anti-LC3 (1:1,000), anti-COX2 (1:1,000), anti-MMP3 (1:500), anti-IKKβ (1:1,000) and anti-GAPDH (1:3,000). Finally, the membranes were incubated in anti-serum against rabbit or mouse IgG conjugated with horseradish peroxidase (Cell Signaling Technology, Inc.) (1:1,000–5,000) for 1 h and subsequently treated with ECL Plus according to the manufacturer's instructions (Amersham Pharmacia Biotech, Umeå, Sweden). Blot intensity was determined by densitometric analysis using Kodak 1D 3.6 software (Kodak, Rochester, NY, USA). Beclin-1, LC3-II, COX2, MMP3 and IKKβ protein expression data were normalized to GAPDH expression, which was the internal control.

As a marker of autophagy, the volume of the cellular acidic compartment was visualized by acridine orange staining; acridine orange staining of rat NP cells was performed as described by Paglin et al (29) and Wang et al (30). Rat NP cells (6×10³ cells/well) were seeded in 96-well plates, and at 50% confluence the cells were treated with TNF-α and SM7368 or SP600125. The cells were incubated with acridine orange (1 µg/ml) 24 h later at 37°C. After 30 min, the acridine orange was removed and a confocal microscope was used to immediately detect the autophagy; 488 nm excitation light, and 520–530 nm (green) and 650 nm (red) emission light were used. The acidic autophagic vacuoles exhibit red fluorescence, whereas the cytoplasm and nucleus of the stained cells exhibit bright green fluorescence.

All the experiments were performed in triplicate. All the data are presented as the mean ± standard error. Differences between the groups were analyzed by one-way analysis of variance. P<0.05 were considered to indicate a statistically significant difference.

Rapamycin and 3-MA are an autophagy activator and inhibitor, respectively. To investigate the impact of autophagy on the catabolic effect, rapamycin (1 µM) or 3-MA (5 mM) was added 1 h before 10 ng/ml IL-1β. Compared to the control group, IL-1β stimulation led to ~18- and 30-fold increases of MMP3 and MMP9 mRNA expression in NP cells, respectively, and additional rapamycin treatment resulted in decreases of ~10- and 16-fold, respectively (Fig. 1A and B). Although IL-1β had no effect on MMP2 mRNA expression, rapamycin significantly suppressed MMP2 mRNA expression when IL-1β was present (Fig. 1C). In addition, ADAMTS4 and COX2 mRNA expression were induced to ~9- and 15-fold by IL-1β treatment and reduced to ~4.5- and 5-fold following the additional rapamycin stimulation, respectively (Fig. 1D and E). Since the baseline expression of catabolic factors, such as MMP3 and ADAMTS5, was not too high, we did not observe the effects of rapamycin alone.

Similarly, rapamycin (1 µM) or 3-MA (5 mM) was used to observe the effect of autophagy on the catabolic effect induced by 50 ng/ml TNF-α. TNF-α stimulation led to the increase of MMP3 and MMP9 mRNA expression in NP cells (Fig. 2A–C). However, additional rapamycin treatment decreased MMP3 and MMP9 mRNA expression (Fig. 2A and B). As with IL-1β treatment, MMP2 mRNA expression was not regulated by TNF-α, however, rapamycin reduced MMP2 mRNA expression when TNF-α was present (Fig. 2C). Additionally, ADAMTS4 and COX2 mRNA expression was upregulated by TNF-α, and was markedly suppressed by additional rapamycin treatment (Fig. 2D and E).

To confirm the effect of autophagy on the catabolic effect induced by cytokines, western blot analysis was used to demonstrate the protein expression of the catabolic factors. The results showed that following TNF-α treatment the expression of medium protein, MMP3, and cell protein, COX2, increased to ~12- and 22-fold, respectively. Similar to the mRNA results, additional rapamycin repressed the expression to ~6- and 4-fold, respectively. However, the autophagy inhibitor, 3-MA, significantly upregulated the protein expression to ~18- and 39-fold, respectively (Fig. 3A–C).

There are numerous methods to identify the presence of autophagy in the cultured experimental cells. Among them, electron microscopy, LC3 turnover (LC3-I to LC3-II) and LC3-II expression are frequently used. LC3B immunofluorescence, acridine orange, monodansylcadav-erine staining and other methods are auxiliary methods to identify the presence of autophagy (29–35). To determine the effect of TNF-α and IL-1β on the autophagy of NP cells, immunofluorescence, RT-qPCR and western blot analyses were performed. Immunofluorescence microscopy showed the LC3-II expressed in rat NP cells (Fig. 4A) and no difference was observed following treatment with TNF-α and IL-1β. RT-qPCR and western blot analysis showed 8–24 h TNF-α and IL-1β treatment had no significant effect on the mRNA expression of Beclin-1, a marker of early phagophore formation or autophagy initiation, and LC3-II, the categorical autophagy-specific marker and indicator of autophagosome maturation (Fig. 4B and C). In addition, the Beclin-1 and LC3-II protein turnover showed no significant change after 4–24 h of TNF-α and IL-1β stimulation (Fig. 4D–F).

To investigate the molecular mechanism of NP cell autophagy in inflammatory conditions, TNF-α was used to mimic the inflammatory condition and the NP cells were treated with NF-κB or MAPK inhibitors prior to TNF-α. SM7368, PD98059, SP600125 and SB203580 significantly increased the Beclin-1 and LC3-II mRNA expression in inflammatory conditions (Fig. 5A). However, only SM7368 and SP600125 treatment increased the LC3 protein turnover (LC3-II/LC3-I) (Fig. 5B and C). To further verify the effect of the NF-κB and JNK inhibitor, acridine orange staining was used to detect the autophagosome formation following SM7368 or SP600125 stimulation. The data showed that SM7368 or SP600125 treatment increased the autophagosome formation (Fig. 5D). To verify the efficacy of cytokines TNF-α and IL-1β on rat NP cells, the activity of the NF-κB promoter construct was measured following cytokine stimulation. As expected, the results showed that TNF-α or IL-1β significantly increased the activity of the NF-κB promoter construct (Fig. 5E and F).

To further confirm the involvement of the NF-κB signaling pathway in controlling NP cells autophagy, an IKKβ loss-of-function study in TNF-α conditions using shRNA transduction was performed. As expected, compared to the transduction with control shRNA, densitometric analysis showed transduction with shIKKβ led to ~80% decrease of IKKβ protein in TNF-α conditions (Fig. 6A and B). Accordingly, transduction with shIKKβ in human NP cells resulted in a significant increase of the LC3 protein turnover and Beclin-1 protein in the inflammatory conditions (Fig. 6C and D).