Mesenchymal stem cells (MSCs) are clinically useful due to their capacity for self-renewal, their immunomodulatory properties and tissue regenerative potential. These cells can be isolated from various tissues and exhibit different potential for clinical applications according to their origin, and thus comparative studies on MSCs from different tissues are essential. In this study, we investigated the immunophenotype, proliferative potential, multilineage differentiation and immunomodulatory capacity of MSCs derived from different tissue sources, namely bone marrow, adipose tissue, the placenta and umbilical cord blood. The gene expression profiles of stemness-related genes [octamer-binding transcription factor 4 (
Mesenchymal stem cells (MSCs) are multipotent somatic stem cells that have the potential to differentiate into mesodermal and even non-mesodermal lineages and are known to produce trophic factor for tissue repair/regeneration (
Although MSCs were first reported to be derived from bone marrow, a number of studies have reported similar cell types in a wide range of tissues, e.g., umbilical cord blood, the placenta, adipose tissue, amniotic fluid, dental tissue, skin, hair follicles and tonsils (
Currently, there is no consensus on the markers that identify or distinguish MSCs derived from different tissues and fibroblasts. Furthermore, a precise characterization of MSCs derived from different tissues and their properties relating to their therapeutic potential represent an essential requirement for the exploitation and development of optimal MSC-based therapies, since the biological capacity of MSCs (i.e., immunomodulatory capacity, differentiation potential to a specific cell type and endogenous stem cell mobilizing capacity) of one tissue may be superior to others.
The aim of the present study was to compare the biological characteristics of MSCs originating from different tissues, i.e., bone marrow (BM-MSCs), umbilical cord blood (CB-MSCs), placenta (P-MSCs) and adipose tissue (A-MSCs), with respect to cell morphology, growth rate, immunophenotype, gene expression profile, immunomodulatory capacity and differentiation potential under the same conditions. The characterization of MSCs derived from different tissues with identifying molecular signatures may prove to be helpful for selecting a suitable source for a specified clinical application.
Bone marrow samples (from 3 male donors, aged 21, 26 and 27 years, respectively) were obtained from normal allogeneic hematopoietic stem cell donors after obtaining written informed consent. Umbilical cord blood was collected in a bag with CPDA anticoagulant following delivery (from 3 donor babies, 1 male and 2 females). This study was approved by the Institutional Review Boards of Severance Hospital (an affiliated hospital of Yonsei University Health System, Seoul, Korea). The mononuclear cell (MNC) fraction was separated by Ficoll-Hypaque density gradient centrifugation (Pharmacia Biotech, Uppsala, Sweden), and the MSCs were cultured as previously described (
To compare the growth characteristics of the cells, the growth rate and population doubling time (PDT; period of time required for cells to proliferate or grow) were measured. All cells were plated at a density of 2×104 cells in 12-well plates. On days 2 and 4, the cells were harvested and counted by Trypan blue staining. The PDT was calculated based on a previously reported formula (
The capacity of the cells for self-renewal can be evaluated by CFU-F assay. To assess the self-renewal capacity of the cells, 1×103 cells at passage 3 were seeded in 100-mm plates (Corning Inc., Corning, NY, USA). Following cultivation for 14 days, the cells were washed with phosphate-buffered saline (PBS; Invitrogen) and stained with 0.5% crystal violet (Sigma-Aldrich, St. Louis, MO, USA) for 5 min at room temperature. Stained colonies with >50 cells were counted.
The cells were stained with the following antibodies: CD14-FITC (555397), CD29-FITC (556048), CD31-PE (555446), CD34-FITC (560942), CD44-PE (555479), CD45-PE (561866), CD73-PE (550257), CD90-FITC (555595), CD105-PE (560839) and CD106-FITC (551146) (all from BD Pharmingen, San Diego, CA, USA). Additionally, phycoerythrin-conjugated and FITC-conjugated isotype controls were applied. The cells were stained with the antibodies for 20 min at 4°C. The stained cells were washed with PBS and fixed with 1% paraformaldehyde (Biosesang, Seongnam, Korea). Subsequently, the labeled cells were analyzed using a flow cytometer (Cytomics Flow Cytometer; Beckman Coulter, Fullerton, CA, USA).
Total RNA was extracted using TRIzol reagent (Invitrogen). Standard reverse transcription (RT) was performed using transcriptase II (Invitrogen). RT-PCR was performed using PCR primers (Bioneer, Daejeon, Korea) under the conditions listed in
To induce osteogenic, adipogenic and chondrogenic differentiation, the cells derived from each type of tissue were seeded simultaneously in osteogenic induction medium, chondrogenic induction medium, and adipogenic induction medium (Cambrex, Lonza, MD, USA). The cells were then cultured for 3 weeks, and the medium was changed every 3 or 4 days. Whenever the medium was changed during chondrogenesis, 10 ng/ml transforming growth factor (TGF)-β3 (Cambrex) was added. After 3 weeks, the cells were analyzed for osteogenesis, adipogenesis and chondrogenesis by von Kossa staining, Oil Red O staining, and Safranin O staining. The stained cells were photographed using a phase microscope (Olympus IX-71; Olympus).
To assess the ability of MSCs to suppress T cell proliferation, the MSCs were treated with 50 ng/ml of mitomycin C (Sigma-Aldrich) for 60 min to inactivate their proliferation. Subsequently, 2×105 cells of human peripheral blood MNCs were co-cultured with 2×104 MSCs of each type in a 96-well plate. To activate T cells, 10
Quantitative data are expressed as the means ± SD. All statistical comparisons between groups were performed by one-way analysis of variance (ANOVA) with post hoc Bonferroni corrections. A p-value <0.05 was considered to indicate a statistically significant difference.
All MSCs and fibroblasts exhibited similar growth properties on day 2. However, of the MSCs derived from different tissues, the P-MSCs displayed the highest proliferative capacity between days 2 and 4 (
In order to identify the molecular signature, we examined the expression of stemness markers in the MSCs derived from different tissues (
Flow cytometric analysis was performed with the MSCs derived from different tissues, and we revealed that all cell types displayed similar immunophenotypic patterns. The cells were negative for CD14, CD31, CD34, CD45 and CD106, which are known markers of hematopoietic and endothelial cells, whereas the MSCs were positive for CD29, CD44, CD73, CD90 and CD105, which are known markers of MSCs. Positive MSC markers were expressed in all of the cell types, even in fibroblasts (
To investigate the differentiation potential of the MSCs, the cells were subjected to osteogenic, adipogenic and chondrogenic differentiation (
Subsequently, we evaluated the osteogenic, adipogenic and chondrogenic gene expression in the cells by RT-PCR (
To confirm the differential expression of
To assess the immunomodulatory effects of MSCs on activated T cells, we performed a BrdU ELISA assay in T cells co-cultured with various MSCs. The proliferation of T cells was suppressed by MSCs derived from different tissues to varying degrees (
It is well known that the immunomodulatory properties of MSCs are mediated by HLA and soluble cytokines. The expression of
Due to their regenerative and immunosuppressive properties, MSCs derived from adult tissues have become a preferred cell type in the field of regenerative medicine and are being extensively investigated for their clinical applications (
The data obtained demonstrated that MSCs derived from different tissues and the fibroblasts (used as controls) exhibited a similar morphology, clonogenic capacity and immunophenotype, but differed in terms of proliferative rates and differentiation potential. The P-MSCs consistently grew faster and more robustly than the cells derived from other tissues, with a rapid population doubling time. MSCs have a limited life span and enter replicative senescence during
Although a list of surface molecules was proposed by ISCT as one of the minimal criteria for MSC identification, all tested markers did not distinguish MSCs from fibroblasts. Thus, the identification of a single definitive marker and precise characterization of MSCs derived from various tissues with regard to their multipotency will be a significant advance for their clinical application. In our phenotypic analysis, we noted that MSCs derived from various sources were positive for the expression of the MSC markers, CD44, CD73, CD90, and CD105, and were negative for CD14, CD34 and CD45. However, CD90 expression, which is known to be associated with haematopoiesis and cell migration, was slightly different among the P-MSCs, and its biological significance needs to be determined. As the function of MSCs is governed by differential molecular profiles, we analyzed the expression of pluripotency genes in order to provide further insight into the differences between MSCs from different tissues. In this study,
It is well known that MSCs possess immunosuppressive properties and can inhibit the proliferation and function of major immune cell populations, including T cells (
Concerning the multipotency of MSCs derived from different tissues, their multilineage differentiation capacity was confirmed by
Our finding of the variation in
In conclusion, in this study, we demonstrated that there are significant differences in the characteristics of MSCs derived from various tissue sources and fibroblasts (used as controls), including their multipotency, stemness signature and lineage associated markers. Specifically, the BM- and A-MSCs exhibited full tri-lineage (osteogenic, adipogenic and chondrogenic) differentiation potential, and this ability was associated with the expression of
This study was supported by a grant from the Korean Health Technology R&D Project, Ministry of Health and Welfare, Republic of Korea (HI13C1270).
Growth characteristics and stemness marker expression of human mesenchymal stem cells (MSCs) derived from different tissues. (A) Growth kinetics. Population doubling time (PDT, measured in hours) was determined at each subcultivation. MSCs derived from bone marrow (BM-MSCs), umbilical cord blood (CB-MSCs), the placenta (P-MSCs) and adipose tissue (A-MSCs) that were cultured under identical conditions. (B) Long-term expandability. The finite population doublings, defined as the total number of serial cell passaging before reaching replicative senescence. **p<0.01. (C) Clonogenic capacity was measured by colony forming unit-fibroblast (CFU-F) assay. The results (A–C) were obtained from 3 independent donors and are represented as the means ± SD. (D) Stemness marker expression in MSCs derived from different tissues. RT-PCR analysis for pluripotency markers in MSCs derived from bone marrow, umbilical cord blood, the placenta and adipose tissue compared to induced pluripotent stem (iPS) cell and fibroblasts (F). RT(−) denotes the absence of reverse transcriptase as a control. One representative of 3 independent experiments is shown.
Tri-lineage differentiation of mesenchymal stem cells (MSCs) derived from different tissues. (A)
(A) Adipogenenic differentiation potential of mesenchymal stem cells (MSCs) derived from different tissue sources. Adipogenic differentiation was carried out for MSCs and fibroblasts isolated from different donors and terminated after 21 days. Fibroblast, bone marrow (BM)-, cord blood (CB)-, placental (P)-, adipose tissue (A)-derived MSCs from different donors were stained by Oil Red O for intracellular lipid vesicles after induction (×400). (Scale bar, 50
Correlation of
Immunomodulatory effects of mesenchymal stem cells (MSCs) derived from various sources on activated T cells co-cultured with MSCs. (A) Suppression of human peripheral blood mononuclear cells (MNCs) by MSCs. Proliferation of MNCs (2×105 cells) co-cultured with MSCs (2×104 cells) from different tissues in the presence of 10
Primer sets used for RT-PCR.
Gene | Primer sequence (5′→3′) | Annealing temperature (°C) | Product size (bp) |
---|---|---|---|
GAPDH | Forward: GTGGTCTCCTCTGACTTCAACA | ||
Reverse: CTCTTCCTCTTGTGCTCTTGCT | 62 | 210 | |
OCT4 | Forward: GACAACAATGAGAACCTTCAGGAGA | ||
Reverse: TTCTGGCGCCGGTTACAGAACCA | 62 | 218 | |
SOX2 | Forward: AACCAAGACGCTCATGAAGAAG | ||
Reverse: GCGAGTAGGACATGCTGTAGGT | 62 | 341 | |
c-Myc | Forward: TCGGATTCTCTGCTCTCCTC | ||
Reverse: CGCCTCTTGACATTCTCCTC | 62 | 413 | |
KLF4 | Forward: ATTCTCTCCAATTCGCTGACCC | ||
Reverse: TTCAGCACGAACTTGCCCAT | 62 | 376 | |
NANOG | Forward: ATAGCAATGGTGTGACGCAG | ||
Reverse: GATTGTTCCAGGATTGGGTG | 62 | 219 | |
REX1 | Forward: CTGAAGAAACGGGCAAAGAC | ||
Reverse: GAACATTCAAGGGAGCTTGC | 58 | 344 | |
LIN28 | Forward: GCTCCGTGTCCAACCAGCAG | ||
Reverse: TTTCCTTTTGGCCGCCTCTC | 58 | 376 | |
GD2 synthase | Forward: CCAACTCAACAGGCAACTAC | ||
Reverse: GATCATAACGGAGGAAGGTC | 59 | 230 | |
DLX5 | Forward: ACCATCCGTCTCAGGAATCG | ||
Reverse: ACCTTCTCTGTAATGCGGCC | 60 | 384 | |
CBFA1 | Forward: TTGCAGCCATAAGAGGGTAG | ||
Reverse: GTCACTTTCTTGGAGCAGGA | 58 | 470 | |
PPARG | Forward: TCTCTCCGTAATGGAAGACC | ||
Reverse: GCATTATGAGACATCCCCAC | 55 | 474 | |
C/EBPA | Forward: CCAAGAAGTCGGTGGACAAGAA | ||
Reverse: TCATTGTCACTGGTCAGCTCCA | 62 | 145 | |
BMP7 | Forward: CCAACGTCATCCTGAAGAAATAC | ||
Reverse: GCTTGTAGGATCTTGTTCATTGG | 60 | 271 | |
SOX9 | Forward: GGTTGTTGGAGCTTTCCTCA | ||
Reverse: TAGCCTCCCTCACTCCAAGA | 61 | 400 | |
HLA-ABC | Forward: CAGATACCTGGAGAACGG | ||
Reverse: TGGCCTCATGGTCAGAGA | 56 | 96 | |
HLA-DR | Forward: CCCCACAGCACGTTTCTTG | ||
Reverse: CCGCTGCACTGTGAAGCTCT | 60 | 274 | |
HLA-G | Forward: GCGGCTACTACAACCAGAGC | ||
Reverse: GCACATGGCACGTGTATCTC | 58 | 900 | |
IL10 | Forward: ACCTGGTAGAAGTGATGCCCCAGGCA | ||
Reverse: CTATGCAGTTGATGAAGATGTCAA | 58 | 237 | |
TNFAIP6 | Forward: GGTGTGTACCACAGAGAAGCA | ||
Reverse: GGGTTGTAGCAATAGGCATCC | 60 | 284 | |
TSG-6 | Forward: GGTGTGTACCACAGAGAAGCA | ||
Reverse: GGGTTGTAGCAATAGGCATCC | 60 | 284 | |
IL6 | Forward: ATGAACTCCTTCTCCACAAGC | ||
Reverse: GTTTCTGCCAGTGCCTCTTTG | 60 | 264 | |
TGFB1 | Forward: GAGGTGACCTGGCCACCATT | ||
Reverse: TCCGCAAGGACCTCGGCTGG | 55 | 194 | |
INHBA | Forward: GATGTACCCAACTCTCAGCCA | ||
Reverse: GCCGATGTCCTTGAAACTGAC | 55 | 866 |
SOX2, sex determining region Y-box 2; DLX5, distal-less homeobox 5; C/EBPA, CCAAT/enhancer-binding protein alpha; BMP7, bone morphogenetic protein 7; IL, interleukin ; TGFB1, transforming growth factor beta 1. OCT4, octamer-binding transcription factor 4; KLF4, Krüppel-like factor 4; DLX5, distal-less homeobox 5; CBFA1, core-binding factor alpha (
Immunophenotyping of cells derived from various sources by flow cytometry.
Surface marker | Fibroblasts | BM-MSCs | CB-MSCs | P-MSCs | A-MSCs |
---|---|---|---|---|---|
CD14 | 1.0±1.5 |
1.4±0.8 | 1.3±0.6 | 0.8±0.8 | 2.0±1.1 |
CD29 | 82.3±15.6 | 97.5±1.9 | 94.4±7.9 | 98.6±1.9 | 68.5±17.9 |
CD31 | 1.2±0.4 | 1.8±1.4 | 1.0±0.9 | 0.4±0.5 | 0.6±0.5 |
CD34 | 0.8±1.2 | 2.3±1.6 | 6.1±8.4 | 0.7±0.7 | 1.8±1.1 |
CD44 | 93.3±11.7 | 100±0.0 | 96.5±6.0 | 93.0±12.0 | 99.8±0.3 |
CD45 | 0.7±0.6 | 1.7± 1.5 | 0.5±0.4 | 0.4±0.3 | 0.9±0.4 |
CD73 | 99.3±0.3 | 99.1±0.9 | 93.7±6.3 | 99.5±0.8 | 90.9±3.0 |
CD90 | 90.9±10.1 | 83.1±20.3 | 66.4±11.2 | 22.2±12.7 | 62.5±16.9 |
CD105 | 91.7±0.6 | 90.3±12.1 | 68.2±27.2 | 73.5±36.3 | 75.0±14.1 |
CD106 | 1.0±1.6 | 4.3±1.6 | 6.3±7.5 | 0.9±1.1 | 2.0±1.2 |
Means ± SD of 3 experiments. BM-MSCs, bone marrow-derived mesenchymal stem cells; CB-MSCs, umbilical cord blood-derived mesenchymal stem cells; P-MSCs, placenta-derived mesenchymal stem cells; A-MSCs, adipose tissue-derived mesenchymal stem cells.