C57BL/6 mice were provided by the Laboratory Animal Center of Sun Yat-Sen University (Guangzhou, China). Six 6–10-week-old and three 7-day-old female mice were used (type C57BL/6), typically weighting 25 g and 6.0 g, respectively. All animal experiments were approved by the Institutional Animal Care and Use Committee at the School of Life Sciences at Sun Yat-Sen University. All experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals and the Institutional Ethical Guidelines for Animal Experiments. C57BL/6 mice were employed for cell cultures. Calvarial osteoblasts from postnatal and bone marrow (BM) cells from adult C57BL/6 mice were collected.

All primers were designed and synthesized by Invitrogen Life Technologies (Carlsbad, CA, USA). The reverse transcription reagent kit and the real-time polymerase chain reaction (PCR) reagents were purchased from Takara Bio (Dalian, China). A BCA Protein Assay kit and BCECF-AM solution were acquired from Beyotime Institute of Biotechnology (Nanjing, China). The TRAP staining kit was purchased from Sigma-Aldrich (St. Louis, MO, USA). The AKP staining kit was purchased from Jiancheng Bioengineering Institute (Jiancheng, Nanjing, China). Bovine PTH [bPTH-(1–34)] was purchased from Bachem Bioscience Inc. (King of Prussia, PA, USA). Soluble murine RANKL and macrophage colony-stimulating factor (M-CSF) were purchased from R&D Systems (Minneapolis, MN, USA). Antibodies to the V-ATPase a₃-subunit (Cat. no. H00010312-K) and d₂-subunit (Cat. no. H00245972-M01) were purchased from Abnova, Inc. (Taipei, Taiwan). Anti-rabbit IgG-FITC antibody (Cat. no. sc-2012), and PTH1R (Cat. no. sc-20749) and PTH2R (Cat. no. sc-30005) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

The amino acid sequences of murine and bovine PTH are highly conserved, as has been previously observed (24). bPTH is frequently used in research to intervene in cell multiplication and differentiation processes (25–27). In the present study, bPTH-(1–34) powder was dissolved in 0.1% bovine serum albumin (BSA) and stored at −20°C. The control cultures were treated with the same concentration of BSA. In our experiments, the treated groups were incubated with bPTH from day 5 to 6. The final concentration of bPTH in the culture medium was 0.1, 1.0, 10 and 100 ng/ml.

BM cells were isolated from the femurs of 6–10-week-old C57BL/6 mice by flushing the shaft with phosphate-buffered saline (PBS) using needles, and the cells were further dispersed several times by gentle, repeated pipetting with a sterile pipette. The isolated cells were cultured for 24 h in α-MEM containing 100 U/ml penicillin, 100 µg/ml streptomycin and 10% FCS. Non-adherent BM-derived monocytes were collected and cultured for 48 h in α-MEM (Invitrogen, Shanghai, China) containing 100 U/ml penicillin (Gibco, Shanghai, China), 100 µg/m streptomycin (Gibco), 10% FCS (Biological Industries, Kibbutz Beit-Haemek, Israel) and 25 ng/ml recombinant M-CSF as previously described (28). After the BM-derived monocytes were induced to differentiate into mononuclear macrophages, the stromal cells and lymphocytes which cannot adhere to the suspension culture dish were removed and the adherent cells were collected, pelleted and counted before being seeded at 10⁴ cells/cm² in the presence of recombinant RANKL. Fresh medium containing 35 ng/ml RANKL was added every 2 days until multinucleated osteoclasts formed (approximately 5 days). After the mononuclear macrophages were cultured for 5 days, the cells were fixed and stained using the TRAP kit based on the manufacturer's instructions (Sigma-Aldrich). TRAP-positive multinucleated cells containing 3 or more nuclei were identified as osteoclasts.

The osteoclasts were induced in 6-well plates as mentioned above and cultured with bPTH from day 5 to 6. Fresh medium containing a different concentration of bPTH was replaced every 2 days. Following culture for 6 days, total RNA was isolated from the osteoclasts using TRIzol reagent. For RT-qPCR, cDNA was synthesized from 1 µg total RNA using reverse transcriptase and oligo(dT) primers in a volume of 10 µl, and the reaction mixture was finally adjusted to 50 µl with TE buffer for PCR. The cDNA amplification reaction mixture was initially incubated at 95°C for 30 sec to denature DNA. Amplification was performed for 40 cycles of 95°C for 5 sec and 60°C for 34 sec, respectively. qPCR was performed under the following conditions: 95°C for 2 min, then 40 cycles of 95°C, 30 sec; 60°C, 1 min; 72°C, 2 min. The specificity of the PCR products was verified by melting curve analysis. Data were normalized using the GAPDH housekeeping gene as an endogenous control. All primers were derived against murine sequences. The following primer sets were used: GAPDH forward, CCATGTTTGTGATGGGTGTGAACC and reverse, TGTGAGGGAGATGCTCAGTGTTGG; V-ATPase a₃-subunit (Atp6v0a3) forward, GAGA CCTCAACGAATCCGTGA and reverse, CGATCCGTTTCCTCCTGGA; V-ATPase d₂-subunit (Atp6v0d2) forward, CTGGTTCGAGGATGCAAAGC and reverse, GTTGCCATAGTCCGTGGTCTG; PTH1R forward, GCACACAGCAGCCAACATAA and reverse, CGCAGCATAAACGACAGGAA; and PTH2R forward, GGCTGATTCTCAGTAGCTGTCT and reverse, GGGCCAACAAATGATCCCATC.

The osteoclasts were induced in 12-cm petri dishes. Following 48 h of co-culture with bPTH (0.1, 1.0, 10 and 100 ng/ml), protein lysates of osteoclasts were prepared in RIPA buffer (Beyotime Institute of Biotechnology). Cell lysates (30 µg) were electrophoresed on 12% polyacrylamide-SDS gels. Proteins were then transferred onto a nitrocellulose membrane and incubated with the following rabbit anti-mouse antibodies (0.2 µg/ml): anti-V-ATPase a₃-subunit, anti-V-ATPase d₂-subunit, anti-PTH1R, anti-PTH2R and anti-GAPDH as an internal control, followed by 1 µg/ml anti-rabbit immunoglobulin G-horseradish peroxide conjugate. The bands were scanned, and the intensity was measured using a digital gel electrophoresis image processing and analysis system (Tanon, Shanghai, China).

The osteoclasts were induced in 24-well plates and treated with 0.1, 1, 10 and 100 ng/ml bPTH from day 5 to 6. Following culture for 6 days, the cells were harvested and treated with 20 mM ammonium chloride for 15 min and washed twice with α-MEM free of phenol red and then placed into a 24-well plate with cover slips. The cells were then stained with the dyeing agent, BCECF-AM, a fluorescent probe that binds specifically to hydrogen ions, and incubated at 37°C for 30 min. A total of 10 osteoclasts from each well were selected randomly to determine the fluorescence intensity (excitation at 488 nm, emission detected at 535 nm) under a laser scanning confocal microscope (Leica SP5-FCS; Leica Microsystems GmbH, Wetzlar, Germany), with the help of the image analyzing software Image-Pro Plus 6.0 (Media Cybernetics, Inc., Houston, TX, USA).

To investigate V-ATPase activity, protein samples were extracted from 5 groups with the method described in the study by Koizumi et al (29). The protein concentration was determined using the BCA Protein Assay kit. V-ATPase activity assay was performed using the c (Genmed Scientifics, Inc., Arlington, MA, USA). In the presence or absence of bafilomycin A₁ (APExBIO Technology, Houston, TX, USA), which is a sensitive inhibitor of V-ATPase, V-ATPase hydrolyzed the substrate ATP in a pyruvate kinase and lactate dehydrogenase (LDH) system. In this reaction, NADH was converted to NAD, and the activity of V-ATPase was calculated according to the change of absorbance at 340 nm. The unit of measurement is µmol ATP/min/mg. These assay protocols were executed according to the manufacturer's instructions.

The osteoclasts were induced using the foregoing method and grown in each well of Osteo Assay Surface multiple-well plates (Corning, NY, USA) for 6 days. Various concentrations of bPTH were added to the culture from day 5 to 6; 10 nM bafilomycin A₁ was used to block V-ATPase. Following culture for 6 days, the plates were washed with saline and a solution of 5% sodium hypochlorite was added for 5 min in order to detach the cells. The cells were then stained with 1% toluidine blue. The resorption area was examined under a microscope and each group was compared using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

The primary antibodies used were polyclonal rabbit anti-mouse PTH1R (Cat. no. sc-20749) and PTH2R (200 µg/ml; Cat. no. sc-30005) (both from Santa Cruz Biotechnology, Inc.) diluted at 1/50. The secondary antibodies were FITC-conjugated goat anti-rabbit (Cat. no. sc-2012; Santa Cruz Biotechnology, Inc.). DAPI (1 mg/ml) was used to identify the nuclei. The cells were fixed in 4% PFA prior to antibody staining. After being washed with PBS (0.01 M, pH 7.4) solution 3 times, glass cover slips were saturated with washing solution (5% BSA) for 30 min. The cells were incubated with the primary antibody diluted in washing solution for 30 min and then rinsed in the same solution for 15 min prior to incubation with the secondary conjugated antibodies (1:100 dilution) for 30 min at room temperature. The cells were then washed for 15 min and incubated with DAPI (1:1,000 dilution) for 5 min. Finally, the cells were washed for 15 min. Primary mouse calvarial osteoblasts were isolated from 7-day-old C57BL/6 mice using the method described by Wang et al (30). In brief, osteoblasts were isolated from the calvaria of 7-day-old C57BL/6 mice by 4 sequential 15-min enzyme digestions at 37°C in solution containing 0.05% trypsin-EDTA and 0.1% collagenase P (Gibco). The cells released from the second to fourth digestions were pooled, centrifuged, resuspended and plated at 1.5×10⁴/cm² in 25cm² culture plates in DMEM (Invitrogen, Shanghai, China) containing 10% (v/v) FCS (Biological Industries), 100 U/m penicillin (Gibco), 100 µg/mL streptomycin (Gibco) and non-essential amino acids (100 µM). The plated cells became confluent around days 5–7. Then the culture medium was changed to differentiation medium. The osteoblasts were then cultured in plastic dishes or plates containing α-MEM supplemented with 10% (v/v) FCS, 100 U/ml penicillin (Gibco), 100 µg/ml streptomycin (Gibco) and 2 mM glutamine (Amresco, Solon, OH, USA). Following 48 h of culture, the cells were stained as positive controls. Immunofluorescence and confocal microscopy were performed immediately. No specific staining was observed if the primary antibodies were omitted.

The results are represented as the means ± the standard deviation (SD). Data were statistically analyzed by one-way analysis of variance (ANOVA) using SPSS 13.0 software (SPSS Inc., Chicago, IL, USA). All statistical tests were two-sided; a P-value <0.05 was considered to indicate a statistically significant difference.

After the osteoclasts were induced in 96-well plates and cultured with various concentrations of bPTH for 5 days, the number of mature osteoclasts was determined (Fig. 1A). The number of mature osteoclasts in the control group and bPTH-treated groups (0.1, 1, 10 and 100 ng/ml) was 14.5±2.6, 14.0±2.7, 14.8±3.0, 15.8±1.7 and 14.7±2.2, respectively. There were no significant differences observed between the different groups. These results suggest that bPTH does not have a great impact on osteoclast differentiation.

RT-qPCR was used to measure the mRNA expression levels of the V-ATPase a₃-subunit and d₂-subunit. Compared to the control group, the mRNA expression of V-ATPase was found to be 1.5-3-fold higher for the a₃-subunit and 1.5-8-fold higher for the d₂-subunit (Fig. 1B). The protein expression levels increased by 1.4-3.6-fold and 1.7-15-fold for the V-ATPase a₃-subunit and d₂-subunit, respectively, in the bPTH-treated groups compared to the control (Fig. 1C and D). The mRNA and protein expression levels of V-ATPase differed significantly between the bPTH-treated groups and the control (P<0.05). These results indicated that the mRNA and protein expression of the V-ATPase a₃-subunit and the d₂-subunit were elevated in a dose-dependent manner (with increasing concentrations of bPTH).

BCECF-AM is capable of sensing intracellular pH in living cells, with the fluorescence intensity decreasing as the pH value decreases from 9.5 to 6.2. The effect of bPTH on the intracellular pH value in osteoclasts was assessed by laser scanning confocal microscopy. Treatment with increasing concentrations of bPTH, from 0.1 to 100 ng/ml, decreased the fluorescence intensity (Fig. 2). The fluorescence intensity decreased with time in the first 24 h and reached a platform thereafter.

In this study, a significant increase in V-ATPase activity was observed in the bPTH-treated groups compared with the control group. The increase in V-ATPase activity indicated a positive association with the concentrations of bPTH (Fig. 3C). V-ATPase activity was 42.59±9.97, 20.58±5.17, 6.20±2.46, 2.41±0.91 and 0.42±0.12 (µmol ATP/min/mg) in the treated groups (100, 10, 1.0 and 0.1 ng/ml) and the control, respectively.

As a culture dish with its bottom coated with calcium-phosphate thin film that would become a substrate for osteoclasts, the Osteo Assay Surface multiple-well plate (Corning, NY, USA) is designed to measure the bone resorption activity of osteoclasts. The bone resorption activity of the osteoclasts can be measured by direct observation under a phase contrast microscope without using a scanning electron microscope (SEM). The osteoclasts were induced and cultured on plates covered with hydroxyapatite crystals. Following culture for 6 days, the bone resorption area of osteoclasts in the bPTH-treated groups increased by 2–6-fold, in parallel with the increasing concentration of bPTH in the culture medium (Fig. 3). The bone resorption area of the control group and bPTH-treated groups was 0.050±0.007, 0.103±0.026, 0.155±0.011, 0.213±0.027 and 0.290±0.035 mm², respectively. In the osteoclast groups treated with bPTH plus bafilomycin A₁, bone resorption was completely inhibited (Fig. 3A). This implies that exposure to bPTH enhances the bone resorption capability of osteoclasts.

The expression of PTH1R and PTH2R was analyzed using RT-qPCR, western blot analysis and immunofluorescence staining (Fig. 4). The results revealed that the osteoclasts expressed PTH1R mRNA both in the control group and the bPTH-treated group (1 ng/ml), but PTH2R mRNA was not detectable. It seemed that the mRNA expression of PTH1R was not markedly affected by the low dose of bPTH, and neither was PTH1R protein expression, as was also detected by western blot analysis. Moreover, positive staining for PTH1R protein was observed in both osteoblasts and osteoclasts by laser scanning confocal microscopy. These results suggest that PTH exerts its effects on both osteoblasts and osteoclasts by binding to PTH1R and that downstream signaling pathways are initiated to maintain the balance of osteogenesis and osteolysis. However, this balance would be broken by a high serum level of PTH, which exists in pathalogical states, such as hyperparathyroidism.