Contributed equally
Acute liver failure, i.e., the fatal deterioration of liver function, is the most common indication that emergency liver transplantation is necessary. Moreover, in the USA, drug-induced liver injury (DILI), including acetaminophen (APAP)-induced hepatotoxicity, is the main cause of acute liver failure. Matching a donor for liver transplantation is extremely difficult, and thus the development of a novel therapy for DILI is urgently needed. Following recent approval by the FDA of the proteasomal inhibitor bortezomib, its therapeutic effects on various human diseases, including solid and hematologic malignancies, have been validated. However, the specific action of proteasomal inhibition in cases of DILI had not been elucidated prior to this study. To examine the effects of proteasomal inhibition in DILI experimentally, male C56Bl/6 mice were injected with 1 mg bortezomib/kg before APAP treatment. Bortezomib not only alleviated APAP-induced hepatotoxicity in a time- and dose-dependent manner, it also alleviated CCl4- and thioacetamide-induced hepatotoxicity. We also noted that bortezomib significantly reduced cytochrome P450 2E1 (CYP2E1) expression and activity in the liver, which was accompanied by the induction of endoplasmic reticulum (ER) stress. In addition, bortezomib decreased hepatocyte nuclear factor-1α-induced promoter activation of CYP2E1 in Hep3B cells. By contrast, another proteasome inhibitor, MG132, did not cause ER stress and did not markedly affect CYP2E1 enzyme activity. Liver injury induced by APAP was aggravated by MG132, possibly via elevation of connexin 32 expression. This study suggests that proteasome inhibition has different effects in cases of DILI depending on the specific inhibitor being used. Furthermore, results from the mouse model indicated that bortezomib, but not MG132, was effective in alleviating DILI. ER stress induced by proteasome inhibition has previously been shown to exert various effects on DILI patients, and thus each available proteasomal inhibitor should be evaluated individually in order to determine its potential for clinical application.
Drug-induced liver injury (DILI) is the most frequent cause of acute liver failure (
The proteasome is a multisubunit enzyme complex that degrades ubiquitin-tagged proteins; it plays a critical role in the regulation of proteins that control cell-cycle progression and apoptosis. Consequently, it has become an important target for anticancer therapy (
To investigate the role of the proteasome and the effects of its inhibition on DILI, we examined the effects of two proteasome inhibitors, bortezomib and MG132, on drug- and chemical-induced hepatotoxicity. Interestingly, bortezomib alleviated APAP-induced hepatotoxicity, whereas MG132 had the opposite effect. In addition, bortezomib treatment decreased liver damage induced by CCl4 or thioacetamide (TAA) and significantly decreased hepatic CYP2E1 transcription, leading to diminished enzyme activity. Results of the present study suggest that clinical treatment with bortezomib may be useful for alleviating DILI and possibly other forms of acute liver disease.
Bortezomib was purchased from Biovision (Mountain View, CA, USA). APAP, CCl4, TAA, MG132, sodium 4-phenylbutyrate (4-PBA), and 2-aminoethyl diphenylborinate (2-APB) were purchased from Sigma-Aldrich (St. Louis, MO, USA). The primary antibodies used in this study were anti-CYP2E1 (AB1252; Millipore, Bedford, MA, USA), anti-connexin 32 (CX32; 35-8900; Invitrogen, Carlsbad, CA, USA), anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; MAB374) (Millipore, Billerica, MA, USA), anti-binding immunoglobulin protein (BiP; 3177; Cell Signaling Technology, Beverly, MA, USA), anti-CCAAT-enhancer-binding protein homologous protein (CHOP; 5554; Cell Signaling Technology) and anti-β-actin (A5316; Sigma-Aldrich).
Male C57BL/6J mice, which were 6–8 weeks of age, were purchased from Orient Bio, Inc. (Seoul, Korea) and housed under special pathogen-free conditions. All animals were treated in accordance with the Animal Care Guidelines of Ewha Womans University. To induce hepatotoxicity, mice were injected intraperitoneally with the following: APAP (350 or 500 mg/kg), TAA (200 mg/kg), or CCl4 (2 ml/kg), as described previously (
Human hepatocarcinoma Hep3B cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) heat-inactivated foetal bovine serum, penicillin, and streptomycin (Gibco, Carlsbad, CA, USA). Cells were maintained at 37°C in a humidified atmosphere containing 5% CO2. Prior to RNA extraction for expression studies or luciferase assays, cells were treated with bortezomib (10-250 nM) (
Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels were measured by the Korean Animal Clinical Research Center (Guri, Korea) using a Hitachi 7020 automatic biochemical analyser (Hitachi, Tokyo, Japan).
Total mRNA from the liver tissues was extracted using an RNeasy Mini kit (Qiagen, Valencia, CA, USA), and cDNA was prepared from the mRNA using a Verso cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. Primer sets are described in
Liver tissues were lysed in radioimmu-noprecipitation assay buffer [50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% (v/v) Nonidet P-40, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) SDS] containing 50 mM NaF, 2 mM Na3VO4, and protease and phosphatase inhibitors (Sigma-Aldrich). Protein concentration was quantified using Bradford assay reagent (Bio-Rad Laboratories, Hercules, CA, USA). Protein samples (40
Liver tissues were fixed in 4% (w/v) paraformaldehyde, embedded in paraffin, sectioned at 4-
Levels of GSH in the fresh liver were measured using a GSH assay kit (Biovision) according to the manufacturer's instructions. Briefly, 40 mg of liver tissues were homogenized with cold glutathione assay buffer, and 6 N perchloric acid was added. The samples were then precipitated with 3 N potassium hydroxide, and then centrifuged for 2 min at 13,000 x g. The neutralized samples were incubated with the
In order to measure CYP2E1 activity, the rate of transformation of
In the present study, a 540-bp human CYP2E1 gene promoter using 5′-TAGGTACCCAGAAGTGAGATTCCTGTTCT-3′ and 5′-CCCAAGCTTTGCCGATGGGGCTCCACTCT-3′ as primers was subcloned into the corresponding restriction sites of the luciferase reporter pGL3-basic vector (Promega, San Luis Obispo, CA, USA), as described in a previous study (
The luciferase assay was performed with the Dual-Luciferase Reporter assay system (Promega) as previously described (
Values are expressed as the means ± SEM. Statistical significance was determined using the Student's t-test, and a p-value <0.05 was considered to indicate a statistically significant difference.
In order to determine the effect of bortezomib on DILI induced by APAP, we injected bortezomib intraperitoneally twice: first at different time points (1 mg/kg) (as indicated in
Since the toxic mechanism differs between various drugs and chemicals, we investigated whether bortezomib treatment also protects against liver damage caused by other chemicals. Surprisingly, bortezomib treatment also alleviated CCl4- and TAA-induced hepatotoxicity (
GSH is an important antioxidant that detoxifies NAPQI by conjugation, and GSH depletion leads to toxic cascades of NAPQI (
In order to confirm whether bortezomib regulates CYP2E1 transcription, we transfected a hepatocyte cell line (Hep3B cells) with the reporter plasmid containing the CYP2E1 gene promoter region, and performed luciferase assays. Bortezomib treatment significantly decreased CYP2E1 promoter activity by itself (
Since bortezomib can lead to ER stress
In the present study, in order to investigate whether this effect of bortezomib is due to proteasome inhibition, we injected MG132, another well-known proteasome inhibitor, before APAP administration. By contrast to bortezomib treatment (
Since we noted that MG132, a second proteasome inhibitor, aggravated APAP-induced liver injury, by contrast with bortezomib (
In addition to CYP2E1 enzyme activity, it has previously been suggested that the common toxic mechanism of all three chemicals (APAP, TAA, and CCl4) may also involve gap junctions (
Protein metabolism, including both synthesis and degradation, is crucial for cellular homeostasis. Eukaryotic cells possess three different systems which are necessary for protein degradation: mitochondrial proteases, which degrade the majority of mitochondrial proteins; lysosomal proteases, which degrade membrane and endocytosed proteins; and the ubiquitin-proteasome system, which degrades the vast majority (80–90%) of intracellular proteins (
Hepatic CYP2E1 levels were markedly decreased upon bortezomib treatment. Since CYP2E1 degradation involves the ubiquitin-proteasome pathway (
Interestingly, the effects of two well-known proteasome inhibitors, bortezomib and MG132, exerted opposite effects on APAP-induced liver injury. Since proteasome inhibition potentiates CYP2E1-mediated toxicity in HepG2 cells by elevating CYP2E1 levels (
Since bortezomib is currently being used in clinical settings, the protective effect of bortezomib on APAP-induced liver injury has clinical importance despite its unclear mechanism. Unfortunately, our study shows that bortezomib in mice was only effective when treatments longer than 3 h were used before APAP administration. Considering that the half-life of CYP2E1 protein is 6–7 h (
Proteasome inhibition has recently emerged as an effective therapeutic target in several human diseases. The present study suggests that proteasome inhibition has different effects with respect to DILI, depending on the specific drug employed. Bortezomib, but not MG132, was effectively used for alleviating drug- and chemical-induced liver injury in mice. Since ER stress, induced by proteasome inhibition, has distinct effects, each proteasome inhibitor should be individually scrutinised for its therapeutic applicability in future studies.
This study was supported by a Gachon University Research Grant from 2014 (GCU 2014-5101) and awards from the National Research Foundation of Korea funded by the Korean government (Ministry of Education, Science and Technology) (NRF-2013R1A1A1057912).
drug-induced liver injury
alanine aminotransferase
acetaminophen
2-aminoethyl diphenylborinate
aspartate aminotransferase
binding immunoglobulin protein
CCAAT-enhancer-binding protein homologous protein
connexin
Dulbecco's modified Eagle's medium
endoplasmic reticulum
US Food and Drug Administration
glyceraldehyde-3-phosphate dehydrogenase
glutathione
hepatocyte nuclear factor
N-acetyl-p-benzoquinone imine
sodium 4-phenyl-butyrate
thioacetamide
Bortezomib alleviates acetaminophen (APAP)-induced hepatotoxicity in a time- and dose-dependent manner. Bortezomib (1 mg/kg) was intraperitoneally injected twice: first at the indicated time points and then at 1 h prior to the administration of APAP (500 mg/kg). The mice were sacrificed 6 h after the APAP injection. (A) Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels and (C) H&E staining of liver sections are shown, and arrows indicate necrotic areas. Various doses of bortezomib (0–1 mg/kg) were injected twice: first at 12 h and then at 1 h prior to the administration of APAP, and (B) serum AST and ALT levels and (D) H&E-stained liver sections are shown. Data are expressed as the means ± SEM (n=6). Image magnification, ×100. The image is representative of six independent experiments. *p<0.05, **p<0.01.
Protective effects of bortezomib on CCl4- and thioacetamide (TAA)-induced hepatotoxicity. Bortezomib (1 mg/kg) was intraperitoneally injected twice: first at 12 h and then at 1 h before CCl4 (2 ml/kg) or TAA (200 mg/kg) treatment. The mice were sacrificed 24 h after the CCl4 or TAA injection. (A) Serum aspartate aminotransferase (AST), alanine aminotransferase (ALT) levels, and H&E-stained sections of liver are shown for the CCl4-injected group. (B) Serum AST, ALT levels, and H&E-stained liver sections are shown for the group injected with TAA. Data are expressed as the means ± SEM (n=4). *p<0.05, **p<0.01, ***p<0.001. Image magnification, ×100. Arrows indicate necrotic areas. The image is representative of four independent experiments.
Bortezomib decreases cytochrome P450 2E1 (CYP2E1) expression and enzyme activity. (A) Glutathione (GSH) levels were measured at the indicated times after acetaminophen (APAP) (500 mg/kg) injection. (B) RT-qPCR of hepatic CYP2E1 gene expression and (C) representative western blot analysis (top panel) and quantification (bottom panel) (n=6) of CYP2E1 levels were examined 12 h after bortezomib (1 mg/kg) administration. (D) Hepatic CYP2E1 enzyme activity was measured 12 h after bortezomib (1 mg/kg) treatment (n=6). Values are expressed as the means ± SEM (n=6). *p<0.05, **p<0.01, ***p<0.001. Data are representative of six independent experiments that provided similar results.
Bortezomib diminishes cytochrome P450 2E1 (CYP2E1) promoter activity
Bortezomib induces endoplasmic reticulum (ER) stress
Sodium 4-phenylbutyrate (4-PBA) partially recovered diminished cytochrome P450 2E1 (CYP2E1) promoter activity caused by bortezomib
Protective effects of bortezomib on acetaminophen (APAP)-induced hepatotoxicity. Mice were intraperitoneally injected with bortezomib twice: first at 12 h (1 mg/kg) and then at 1 h (1 mg/kg) before APAP treatment (350 mg/kg). The mice were sacrificed 6 h after the APAP injection. (A) Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels were measured, and (B) hematoxylin and eosin (H&E)-stained slides of liver sections are shown. Arrows indicate necrotic areas. Similar to bortezomib administration, mice were intraperitoneally injected with MG132 (5 mg/kg) twice: first at 12 h and then at and 1 h prior to APAP administration (350 mg/kg). The mice were sacrificed 6 h after the APAP injection. (C) Serum AST and ALT levels were measured, and (D) liver sections were stained with H&E, and arrows indicate necrotic areas. Data are expressed as the means ± SEM (n=5–6). **p<0.01, ***p<0.001. Image magnification, ×100. The image is representative of at least five independent experiments.
The proteasome inhibitor MG132 does not influence cytochrome P450 2E1 (CYP2E1) enzyme activity. The compound MG132 (5 mg/kg) or bortezomib (1 mg/kg) was injected at 12 h and 1 h before liver extraction. (A) Hepatic mRNA levels of CYP2E1 and (B) CYP2E1 enzyme activity were examined 12 h after bortezomib (1 mg/kg) or MG132 administration. RT-qPCR analysis of (C) binding immunoglobulin protein (BiP) and (D) CCAAT-enhancer-binding protein homologous protein (CHOP) expression was performed. Values are expressed as the means ± SEM (n=5–6). **p<0.01, ***p<0.001.
Proteasome inhibitors affect hepatic connexin (CX) 32 levels differently, depending on the drug used. The inhibitor MG132 (5 mg/kg) was injected twice: first at 12 h and then at 1 h prior to the administration of APAP. (A) Elevated CX32 protein levels after 12 h of MG132 treatment are demonstrated by western blot analysis (upper panel), with results quantified in the lower panel (n=6). 2-Aminoethyl diphenylborinate (2-APB) (20 mg/kg), a gap junction inhibitor, was injected 1 h before a second MG132 administration, and APAP was then intraperitoneally injected after 2 h. The mice were sacrificed at 6 h after the APAP injection. (B) Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels were measured (n=6). (C) Decreased CX32 protein levels after bortezomib (1 mg/kg) treatment for 12 h are illustrated by western blot analysis (upper panel), and results are quantified in the lower panel (n=6). (D) RT-qPCR analysis of CX32 and CX43 mRNA was performed at the indicated times after bortezomib administration (n=6). Values are expressed as the means ± SEM. Data are representative of six independent experiments that provided similar results. *p<0.05, **p<0.01 and ***p<0.001.
Primers used for quantitative PCR.
Species | Gene | Primer sequences (5′→3′) | Refs. |
---|---|---|---|
Mouse | CYP2E1 | F: GTTGCCTTGCTTGTCTGGAT | |
R: AGGAATTGGGAAAGGTCCTG | |||
BiP | F: TCATCGGACGCACTTGGAA | ( | |
R: CAACCACCTTGAATGGCAAGA | |||
CHOP | F: GTCCCTAGCTTGGCTGACAGA | ( | |
R: TGGAGAGCGAGGGCTTTG | |||
CX32 | F: TGGTCCCTGCAGCTTATCTT | ( | |
R: CCTCAAGCCGTAGCATTTTC | |||
CX43 | F: ATCCAAAGACTGCGGATCTC | ( | |
R: GACCAGCTTGTACCCAGGAG | |||
GAPDH | F: CACTCTTCCACCTTCGATGC | ||
R: CCCTGTTGCTGTAGCCGTAT |
CYP2E1, cytochrome P450 2E1; BiP, binding immunoglobulin protein; CHOP, CCAAT-enhancer-binding protein homologous protein; CX32, connexin 32; CX43, connexin 43.