Hypoxia/reoxygenation (H/R) is a critical factor in the pathogenesis of tissue injury following myocardial infarction (MI) which can lead to tissue damage and pathological remodeling. Therefore, it is necessary to try and prevent myocardial H/R injury in order to optimize the treatment of MI. This study aimed to explore the functions and molecular mechanisms of action of high mobility group box 1 (HMGB1) and its role in H/R injury to H9c2 cells. The mRNA expression of levels genes were detected by RT-qPCR. The protein levels were examined by western blot analysis. The Beclin 1 expression level was further determined by immunocytochemistry (ICC). In addition, an HMGB1 overexpression vector and a shRNA lentiviral vector were constructed in order to induce the overexpression and silencing of HMGB1, respectively. The apoptotic rate of the H9c2 cells was determined by flow cytometry. The expression of miR-210 was markedly increased following the exposure of the cells to H/R, thus indicating that the cell model of H/R injury was successfully established. In addition, an
Myocardial infarction (MI), also known as a 'heart attack', results from a reduction in coronary blood flow which is extensive enough to render the oxygen supply to myocardial tissues insufficient (
High mobility group box 1 (HMGB1, also known as amphoterin) is an abundantly occurring parental form of HMG proteins and an exceptional member of the family of HMG-box proteins (
The cardiomyocyte cell line, H9c2 cells was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). The cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 1% antibiotic-antimycotic solution (100 U/ml penicillin and 100
The exposure of the cells to H/R was performed as previously described in the study by Cao
A total of 40 male Sprague-Dawley rats (weighing 320±20 g) were obtained from the Experimental Animal Center of the Second Xiangya Hospital of Central South University, Changsha, China. All animal experiments were performed in accordance with the National Institutes of Health Guidelines on the Use of Laboratory Animals and were approved by the Ethics Committee of the Second Xiangya Hospital. The rats were kept in plastic cages and had access to pelleted food and water
Total RNA was extracted from the cells and heart tissue using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and the cDNA was reverse transcribed as the protocol for the reverse transcription system (Fermentas, Burlington, ON, Canada). The amplification primers were designed using Primer 5.0 with melting temperatures at 58°C. The forward and reverse sequences of the primers used are presented in
Protein extracts from the H9c2 cells were prepared using RIPA Lysis buffer (Auragene Bioscience Co., Changsha, China) following the manufacturer's instructions. The protein concentration was determined according to the Bradford Protein assay reagent (Beyotime Institute of Biotechnology, Shanghai, China) using bovine serum albumin as a standard. Western blot analysis was subsequently carried out in order to detect the protein levels of HMGB1, cleaved caspase-3, Bcl-2, Beclin 1, light chain 3 (LC3)-II/I and DDR1. Equal amounts of lysate were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes (Millipore, Bedford, MA, USA) using a semi-dry transfer method. The membranes were blocked with 5% non-fat milk in TBST buffer at room temperature for 2 h and then incubated overnight with the following primary antibodies: HMGB rabbit polyclonal antibody (1:1,000; sc-33199; Santa Cruz Biotechnology, Inc. Dallas, TX, USA), cleaved caspase-3 rabbit polyclonal antibody (1:1,000; sc-22171-R, Santa Cruz Biotechnology, Inc.), Bcl-2 rabbit polyclonal antibody (1:800; sc-492; Santa Cruz Biotechnology, Inc.), E-cadherin mouse monoclonal antibody (1:800; BM0339; Abzoom, Dallas, TX, USA), vimentin mouse monoclonal antibody (1:1,000; sc-32322; Santa Cruz Biotechnology, Inc.), fibroblast-specific protein (FSP) rabbit polyclonal antibody (1:1,500; orb89918; Biocompare, South San Francisco, CA, USA), Beclin rabbit monoclonal antibody (1:1,000; 2026-1; Epitomics, Burlingame, CA, USA), LC3B rabbit polyclonal antibody (1:1,000; ab51520; Abcam, Hong Kong, China), p62 rabbit polyclonal antibody (1:1,000; ab96134; Abcam) and DDR1 rabbit polyclonal antibody (1:1,000; sc-532; Santa Cruz Biotechnology, Inc.). The membranes were then incubated for 1 h with the appropriate secondary antibodies (goat anti-rabbit antibody, 1:2,000; 111-035-003; goat anti-mouse antibody, 1:2,000; 111-035-008; Jackson Immunoresearch, Inc., West Grove, PA, USA; and donkey anti-goat antibody, 1:2,000; CW0214; CWBio, Beijing, China). Electrochemiluminescence was performed with an IPP6.0 system.
The H9c2 cells were washed with phosphate-buffered saline (PBS) 3 times and fixed for 30 min in 4% paraformaldehyde. At that point, the cells were permeabilized for 15 min with PBS containing 0.3% Triton X-100, and treated with 3% H2O2 for 30 min followed by goat serum (Auragene Bioscience Co.) for 10 min, and then incubated with Beclin 1 monoclonal antibody (1:500; 2026-1; Epitomics) overnight at 4°C. Following 3 rinses with PBST, the cells were incubated for 30 min with the secondary antibody (donkey anti-goat, 1:1,000; CW0218, CWBio) and for a further 30 min with SABC complex (both from Auragene Bioscience Co.) at room temperature. Following 3 additional PBST rinses, the immunoreactive cultured cells were observed.
Primers were designed using the HMGB1 sequence in GenBank, which contained the
The mRNA sequence of HMGB1 shRNA was designed using online software (
The cells were transfected with the lentiviral vector carrying HMGB1 shRNA (Lv-HMGB1-shRNA) or with the HMGB1 overexpression lentiviral vector (Lv-HMGB1), or with the respective negative control vectors [Lv-NC or the scramble shRNA vector (Lv-shRNA-scr)]. The cells were transfected using Lipofectamine 2000 (Life Technologies/Thermo Fisher Scientific, Grand Island, NY, USA) according to manufacturer's instructions. Untransfected cells were used as the controls (Con).
We also used TALEN technology to knockdown the DDR1 gene in the H9c2 cells. TALENs designed to target the DDR1 gene were purchased from Sidansai Biotechnology Co., Ltd. (Shanghai, China). The cells in 24-well plates were transfected with 400 ng TALEN expression plasmids (DDR1-TALEN) using Lipofectamine 2000 (Invitrogen Life Technologies), according to the manufacturer's instructions. Western blot analysis was performed to measure the protein expression levels of DDR1 and to confirm the efficiency of the TALEN-mediated knockdown.
The H9c2 cells were washed twice with cold PBS and then resuspended in 500
All statistical analyses were performed using SPSS 17.0 software. The differences between 2 groups were compared using the Student's t-test. Differences between nultiple groups were compared using one-way analysis of variance (ANOVA). Data are expressed as the means ± standard deviation (SD). A p-value <0.05 was considered to indicate a statistically significant difference.
In order to determine the role of the expression of HMGB1 in myocardial necrosis, the differential expression of HMGB1 in normal and myocardial tissue was detected. We found that the mRNA expression of HMGB1 was significantly increased at weeks 1 and 2 post-MI in the tissue with myocardial necrosis from the rats with I/R injury when compared with the control heart tissue from the sham-operated rats (p<0.05;
To determine the effects of HMGB1 on apoptosis during H/R in cardiomyocytes, we measured the expression levels of caspase-3 and Bcl-2 (apoptosis-related proteins) in the cells. The results revealed that the protein expression level of cleaved caspase-3 was increased following H/R in the H9c2 cells, whereas the protein level of Bcl-2 was decreased (p<0.05;
To determine the effects of HMGB1 on EMT during H/R in cardiomyocytes, the protein levels of the EMT biomakers, E-cadherin, vimentin and FSP, were detected by western blot analysis. In comparison to the Con + H/R group, the protein level of the epithelial marker, E-cadherin, was upregulated when the H9c2 cells were transfected with Lv-HMGB1-shRNA during H/R, while it was downregulated when the cells were transfected with Lv-HMGB1 during H/R (p<0.05;
Furthermore, in comparison to the Lv-HMGB1-shRNA group, the protein level of the epithelial marker, E-cadherin, was decreased when the H9c2 cells were transfected with Lv-HMGB1 during H/R. However, compared to the Lv-HMGB1 +H/R group, the level was increased when the cells were transfected with both Lv-HMGB1-shRNA and DDR1 TALEN during H/R (p<0.05;
The H9c2 cells were subjected to H/R, and the protein expression levels of Beclin 1, LC3-II/LC3-I and p62, markers of autophagy, were then examined by western blot analysis. The results revealed that the levels of Beclin 1 and the ratio of LC3-II/LC3-I were increased, whereas the expression of p62 was decreased in the H9c2 cells following H/R, suggesting that H/R induces autophagy in H9c2 cells (p<0.05;
In this study, we also examined the effects of HMGB1 on H9c2 cell autophagy following H/R. We found that the protein levels of Beclin 1 and LC3-II/I were decreased when the cells were transfected with Lv-HMGB1-shRNA, whereas these levels were increased when the H9c2 cells were transfected with Lv-HMGB1 during H/R (p<0.05;
In order to further explore the mechanisms of action of HMGB1 and its effects on autophagy during H/R in cardiomyocytes, the expression of DDR1 in myocardial tissue from rats with H/R injury and in H9c2 cells subjected to H/R injury was determined by RT-qPCR and western blot analysis. The results revealed that the mRNA expression of DDR1 was significantly increased at weeks 1 and 2 post-MI in the tissue with myocardial necrosis from the rats with I/R injury when compared with the control heart tissue from the sham-operated rats (p<0.05;
We also examined the effects of HMGB1 on the expression and phosphorylation of mTOR. The results revealed that OSI-027, an inhibitor of mTOR, decreased the phosphorylation level of mTOR (p<0.05), but had no effect on the protein level of mTOR when the cells were transfected with Lv-HMGB1 (p>0.05;
As a protein considered to be representative of damage-associated molecular patterns (
Autophagy is a highly evolutionarily conserved cellular process through which long-lived proteins and damaged organelles are recycled to maintain cellular homeostasis (
It has been reported that the expression of DDR1 is increased in the MI-affected area of rats with congestive heart failure (
In order to further explore the mechanisms of action of HMGB1 in apoptosis and EMT in H/R injury, we examined the alteration of autopagy-related signaling, mTOR following treatment with its inhibitor, OSI-027. The results revealed that OSI-027 decreased the protein level of Beclin 1, and increased the level of p62. It did not alter the protein level of mTOR, but altered its phosphorylation level in H9c2 cells following transfection with an HMGB1 overexpression vector (Lv-HMGB1). This suggests that HMGB1 induces autophagy by downregulating the phosphorylation of mTOR.
In conclusion, the findings of our study demonstrated the following: i) the expression of HMGB1 was upregulated in the myocardial tissue of rats with MI and following H/R injury to H9c2 cells; ii) HMGB1 promoted apoptosis and EMT during H/R in H9c2 cells; iii) in association with the induction of autophagy, HMGB1 induces apoptosis and EMT following H/R in H9c2 cells; iv) HMGB1 induced autophagy by upregulating the expression of DDR1 and downregulating the phosphorylation of mTOR (
Expression of high mobility group box 1 (HMGB1) in myocardial tissue and cardiomyocytes. (A) The mRNA expression of HMGB1 in the area of myocardial necrosis in rats subjected to hypoxia/reoxygenation (H/R). (B) The mRNA expression of the H/R biomarker, miR-210, and HMGB1 during H/R in cardiomyocytes. (C) HMGB1 mRNA expression in cardiomyocytes transfected with a lentiviral vector carrying HMGB1-shRNA or an HMGB1 overexpression vector. (D) HMGB1 protein level in cardiomyocytes transfected with a lentiviral vector carrying HMGB1-shRNA or an HMGB1 overexpression vector. (E) HMGB1 mRNA expression during H/R in cardiomyocytes transfected with a lentiviral vector carrying HMGB1-shRNA or an HMGB1 overexpression vector. (F) HMGB1 protein level during H/R in cardiomyocytes transfected with a lentiviral carrying HMGB1-shRNA or an HMGB1 overexpression vector. Data are expressed as the means ± SD. n=8 or 3 samples/group; *p<0.05 vs. control (Con; untransfected cells); #p<0.05 vs. cells at 1 week or cells transfected with the negative control HMGB1 (Lv + NC), or with Lv-NC + H/R.
High mobility group box 1 (HMGB1) induces apoptosis during hypoxia/reoxygenation (H/R) in cardiomyocytes. (A) The protein expression of the apoptosis-related proteins, caspase-3 and Bcl-2. (B) The mRNA expression of apoptosis-related caspase-3 and Bcl-2 during H/R in cardiomyocytes transfected with a lentiviral vector carrying HMGB1-shRNA or with an HMGB1 overexpression vector. (C) The protein level of apoptosis-related caspase-3 and Bcl-2 during H/R in cardiomyocytes transfected with a lentiviral vector carrying HMGB1-shRNA or with an HMGB1 overexpression vector. (D) HMGB1 induces the apoptosis of cardiomyocytes
High mobility group box 1 (HMGB1) induces epithelial-to-mesenchymal transition following hypoxia/reoxygenation (H/R) in cardiomyocytes. The protein levels of EMT biomakers [E-cadherin, vimentin and fibroblast-specific protein (FSP)] during H/R in cardiomyocytes transfected with a lentiviral vector carrying HMGB1-shRNA or with an HMGB1 overexpression vector, or with the HMGB1 overexpression vector and discoidin domain receptor 1 (DDR1) TALEN. Data are expressed as the means ± SD. n=3 samples/group; *,#p<0.05 vs. control (Con) + H/R; △p<0.05 vs. Lv-HMGB1 + H/R.
High mobility group box 1 (HMGB1) regulates autophagy following hypoxia/reoxygenation (H/R) in cardiomyocytes. (A) The protein levels of autophagy biomakers (Beclin 1, LC3-II/I and p62). (B) The protein level of Beclin 1 and LC3-II/I during H/R in cardiomyocytes transfected with a lentiviral vector carrying HMGB1-shRNA or with an HMGB1 overexpression vector. (C) The content of Beclin 1 during H/R in cardiomyocytes transfected with a lentiviral vector carrying HMGB1-shRNA or with an HMGB1 overexpression vector. Data are expressed as the means ± SD. n=3 samples/group, *p<0.05 vs. NC (negative control) or control (Con) + H/R; #p<0.05 vs. Lv-NC + H/R; △p<0.05 vs. Lv-HMGB1 + H/R.
High mobility group box 1 (HMGB1) induces autophagy by upregulating the expression of discoidin domain receptor 1 (DDR1). (A) The mRNA expression of DDR1 in the area of myocardial necrosis of rats subjected to hypoxia/reoxygenation (H/R). (B) The mRNA expression of DDR1 during H/R in cardiomyocytes. (C) DDR1 mRNA expression during H/R in cardiomyocytes transfected with a lentiviral carrying HMGB1-shRNA or with an HMGB1 overexpression vector. (D) DDR1 protein level during H/R in cardiomyocytes transfected with a lentiviral carrying HMGB1-shRNA or with an HMGB1 overexpression vector.. Data are expressed as the means ± SD. n=3 samples/group, *p<0.05 vs. control (Con) or NC (negative control) + H/R or Lv-shRNA-scr + H/R; #p<0.05 vs. Lv-NC + H/R.
High mobility group box 1 (HMGB1) induces autophagy by downregulating the phosphorylation of mammalian target of rapamycin (mTOR). The protein and phosphorylation level of mTOR in cardiomyocytes following treatment with OSI-027; the protein levels of Beclin 1 and p62 in cardiomyocytes following treatment with OSI-027. Data are expressed as the means ± SD. n=3 samples/group, *p<0.05 vs. Lv-HMGB1.
Schematic diagram of the functions of high mobility group box 1 (HMGB1) during hypoxia/reoxygenation (H/R) injury in cardiomyocytes. HMGB1 promoted apoptosis and epithelial-to-mesenchymal transition (EMT) by inducing autophagy through the upregulation of the expression of discoidin domain receptor 1 (DDR1) and the downregulation of the phosphorylation of mammalian target of rapamycin (mTOR following H/R injury in cardiomyocytes. VIM, vimentin; FSP, fibroblast-specific protein.
Forward and reverse primer sequences of targeted genes.
Gene | Name | Sequence |
---|---|---|
HMGB1 | Sense | GATGGGCAAAGGAGATCCTA |
Antisense | CTTGGTCTCCCCTTTGGGGG | |
DDR1 | Sense | ATGGAGCAACCACAGCTTCTC |
Antisense | CTCAGCCGGTCAAACTCAAACT | |
Cleaved caspase-3 | Sense | GAGCTGCCTGTAACTTG |
Antisense | ACCTTTAGAACATTTCCACT | |
Bcl-2 | Sense | TTGCCACGGTGGTGGAGGAAC |
Antisense | GACAGCCAGGAGAAATCAAACAGA | |
β-actin | Sense | AGGGGCCGGACTCGTCATACT |
Antisense | GGCGGCACCACCATGTACCCT |
HMGB1, high mobility group box 1; DDR1, discoidin domain receptor 1.