The cell line infected with the scrapie agent Chandler and its cured cell line SMB-PS were obtained from The Roslin Institute (Scotland, UK). SMB-S15 was originally taken from the brain of a mouse infected by the Chandler scrapie strain (17). SMB-PS denotes SMB cells which have been permanently cured by pentosan sulfate (PS) (16). Cells were cultured in DMEM with 10% fetal calf serum, in an atmosphere with 5% CO₂ and at 33°C. Cells were collected, counted and stored at −20°C for further study.

Approximately 1×10⁸ SMB-S15 and SMB-PS cells were homogenized in 2 ml phosphate-buffered saline (PBS; pH 7.4), respectively. We verified that the content of PrP^Sc in the cell homogenates was comparable with that in ME7- or 139A-infected brain homogenates by western blot analysis (data not shown). Cell debris was removed with low-speed centrifugation at 2,000 × g for 10 min, and the supernatants were collected as inoculums prior to challenging. Five microliters of SMB-S15 or SMB-PS cell homogenates were intracerebrally injected into 3 to 4-week-old CD1, C57BL/6 and Balb/c mice, respectively. Each of the 6 groups (the CD1, C57BL/6 and Balb/c mice injected with either SMB-S15 or SMB-PS) consisted of 10 female mice. Before the injection, all mice were narcotized with halothane. The animals were monitored twice a week before the appearance of clinical symptoms by experienced staff, but once per day after the appearance of clinical symptoms, until the animals died or were sacrificed. The clinical symptoms and signs were scored as previously described (18). The incubation time was calculated from the inoculation to the onset of clinical manifestations, and clinical course was evaluated from the onset of clinical manifestations to death at the terminal stage of the disease. The main clinical manifestations at the end of the disease included progressive ataxia, sluggishness, loss of weight and extreme emaciation. At the end of the clinical phase, the animals were sacrificed using ether and exsanguinated, and the brains were surgically removed from the mice. Three brains were fixed with formalin, and the others were stored at −80°C for further analyses. In addition, two untreated 3 to 4-week-old mice from each strain were sacrificed using ether, and 200 µl blood was collected and anticoagulated with ethylenediaminetetraacetic acid (EDTA) for gene sequencing.

For successive passage, each brain from 3 SMB-S15-inoculated strains and each from SMB-PS-inoculated strains were homogenized (1:10, w/v). Before injection, western blot analysis indicated that the 3 S15-inoculated brains were positive for PrPSc, while the SMB-PS-inoculated brains were negative. One microliter of each brain homogenate was intracerebrally injected into corresponding 3 to 4-week-old CD1, C57BL/6 and Balb/c mice. Each group consisted of 10 female mice. These mice were termed second passage SMB-inoculated mice.

Total DNA was extracted from the blood of the mice (the 2 untreated mice from each strain) with a DNeasy Blood & Tissue kit (cat. no. 69504; Qiagen, Hilden, Germany) according to the manufacturer's instructions. The mouse PRNP gene was amplified using PCR in a Bio-Rad S1000 Thermal Cycler (Bio-Rad, Hercules, CA, USA). Two pairs of primers were used for better accuracy. The information of the primers was as follows: pair 1 forward, TCAGCCT AAATACTGGGCAC and reverse, AGATGAGGAGGATG ACAGGA; and pair 2 forward, GCCTAAATACTGGGC ACTGATAC and reverse, AGGAGATGAGGAGGATGACA; the size of both amplicons was 791 bp. The reaction mixtures consisted of a total of 50 µl, containing 1 µl DNA, 20 pmol sense and antisense primers, 21 µl RNase-free water and 25 µl 2X Taq Master Mix (CW0682; CWBio, Beijing, China). The touchdown method was adopted to increase the specificity of the PCR products. Details of the PCR conditions are as follows: denaturing at 94°C for 40 sec, annealing at 59°C for 45 sec with a decrease of 0.5°C every cycle in the first 8 cycles and 55°C for the other 30 cycles, and a final extension at 72°C for 55 sec. All PCR assays were carefully carried out in the PCR laboratory in four separate rooms to avoid DNA contamination.

The PCR products were analyzed in 1.2% agarose gel and recovered from gel with a QIAquick Gel Extraction kit (cat. no. 28706; Qiagen) according to the manufacturer's instructions. Direct sequencing was performed using the same PCR primers and an ABI Prism™ 3730XL DNA Analyzer.

The brain samples of the SMB-S15- and SMB-PS-inoculated mice were homogenized in 10% lysis buffer (100 mM NaCl, 10 mM EDTA, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, and 10 mM Tris, pH 7.5) according to a previously described protocol (19). Briefly, tissue debris was removed with low-speed centrifugation at 2,000 × g for 10 min, and the supernatants were collected. To detect the presence of PK-resistant PrP^Sc in brain tissues, the brain homogenates were firstly digested with a final concentration of 50 µg/ml PK at 37°C for 60 min prior to western blot analyses. To evaluate the PK resistances of PrP^Sc from the three mouse strains, the brain homogenates of the SMB-S15-inoculated mice were treated with different amounts of PK (70663-4; Merck KGaA, Darmstadt, Germany) at final concentrations of 100, 200, 500, 1,000, 2,000 and 5,000 µg/ml at 37°C for 60 min. PK digestion was terminated by heating the samples at 100°C for 10 min.

Aliquots of brain homogenates were separated on 15% SDS-PAGE and electroblotted onto nitrocellulose membranes using a semi-dry blotting system (Bio-Rad). Membranes were blocked with 5% (w/v) non-fat milk powder (NFMP) in 1X Tris-buffered saline containing 0.1% Tween-20 (TBST) at room temperature for 1 h and probed with anti-PrP monoclonal antibody (mAb 6D11, sc-58581; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) at 4°C overnight. After washing with TBST, blots were incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (cat. no. 31460; Thermo Fisher Scientific, Waltham, MA, USA) at room temperature for 2 h. Blots were developed using an enhanced chemiluminescence system (ECL) (NEL103E001EA; PerkinElmer, Waltham, MA, USA) and visualized on autoradiography films. Images were captured by the ChemiDoc™ XRS⁺ Imager (Bio-Rad).

After being mixed with equal volumes of glycoprotein denaturing buffer (New England Biolabs, Ipswich, MA, USA), various PK-treated brain homogenates were heated at 100°C for 10 min. Subsequently, 50 mM sodium phosphate, pH 7.5, containing 1% NP-40 and 2 µl N-glycosidase F (1,800,000 U/mg; New England Biolabs) were added to the samples, and the mixtures were incubated at 37°C for 2 h. PrP signals in each preparation were detected by western blot analysis, as described above.

Brain tissues of the differently inoculated mice were fixed in 10% buffered formalin solution. Before histological processing, all fixed tissues were immersed in 98% formic acid for at least 1 h for inactivation and paraffin-embedded. The paraffin-embedded sections (5 µm thickness) were then subjected to conventional staining with hematoxylin and eosin (H&E). The spongiform degeneration in the brain regions infected with various scrapie strains was monitored using a light microscope (BX41; Olympus, Tokyo, Japan), and the severity and distribution of vacuolation were measured according to previously described protocol (20). Briefly, 0 denotes no lesions; 0.5, minimum vacuolation (2–3 vacuoles in half an ×40 objective field); 1.0, little vacuolation (3–5 vacuoles in half a field); 2.0, moderate vacuolation (several vacuoles evenly scattered); 3.0, extensive vacuolation (many vacuoles distributed in half a field); and 4.0, severe vacuolation (numerous vacuoles, often coalescing).

Paraffin-embedded sections (5 µm thickness) of brain tissues were prepared, and IHC assays were performed according to protocol described in a previous study (18). Prior to the staining with PrP mAb, brain sections were treated with 6M GdnHCl at 4°C for 2 h. In sections, endogenous peroxidases were quenched in 3% H₂O₂ in methanol for 15 min, and then sections were pretreated for enzyme digestion antigen retrieval for 1 min. After blocking in 1% normal goat serum, the sections were incubated at 4°C overnight with anti-PrP mAb (6D11), rabbit anti-glial fibrillary acidic protein (GFAP) polyclonal antibody (pAb; Boster Biological Tech Ltd.) or rabbit anti-Iba1 pAb, respectively. The sections were then incubated with HRP-conjugated goat anti-mouse or rabbit secondary antibody (cat nos. 31460 and 31430; Thermo Fisher Scientific) at 37°C for 60 min, and visualized by incubation with 3,3-diaminobenzidine tetrahydrochloride (DAB). The sections were counterstained with hematoxylin, dehydrated and mounted in permount (ZLI-9559, ZSGB-BIO, Beijing, China).

Statistical analysis was performed using SPSS 17.0 statistical package (SPSS, Inc., Chicago, IL, USA). Quantitative analysis of the western blots was carried out using ImageJ software. The gray values of each target blot were evaluated. Statistical analyses were performed using the Kruskal-Wallis test and Student's t-test, as appropriate. A P-value <0.05 was considered to indicate a statistically significant difference.

The present study was approved by the Ethical Committee of the National Institute for Viral Disease Control and Prevention, China (CDC) under protocol no. 2009ZX10004-101.

C57BL/6, CD1 and Balb/c mice are commonly used experimental mice strains with clearly distinct phenotypes. In order to study the homogeneity of the PRNP gene in the three different types of mice, genomic DNA was extracted from peripheral blood cells, and the PRNP genes were obtained using a specific PCR technique. Sequencing assays of the 791-bp PCR products revealed 100% homogeneity between the C57BL/6 and Balb/c mice, which were also identical to the mouse PRNP sequences found on NCBI (CT010345.1), whereas only one different nucleotide at the position of nt 564 (C-T exchange) in CD1 mice was noted (Fig. 1A). According to the codon table, it was confirmed that this C564T variation in CD1 mice was a synonymous single nucleotide polymorphism (SNP) which did not cause any change of the encoded amino acid (valine). The polymorphisms of codon 128 of PrP proteins of those three strains of mice, which corresponded to the polymorphism of codon 129 in humans, were all methionine/methionine (Met/Met) homozygote (Fig. 1B). These data indicate a homogeneity in the PRNP gene among the three strains of mice.

Cell lysates of SMB-S15 with detectable PK-resistant PrP^Sc were intracerebrally inoculated into 10 CD1, Balb/c and C57BL/6 mice, respectively, and cell lysates of SMB-PS without detectable PrP^Sc were also intracerebrally inoculated into the mice of each strain as controls. One mouse in each SMB-S15-inoculated group died within a week of inoculation, and we considered this to be due to the acute mechanical brain damage suffered during inoculation. Animals infected with SMB-S15 lysates began to exhibit abnormal signs 165 days after inoculation, and the onset times of diseases within the groups, or among the different strains, were quite similar. The average incubation times of CD1, Balb/c and C57BL/6 mice were 175.4±1.0, 175.3±1.2 and 172.8±1.8 days, respectively, and no statistical difference was noted (P=0.382) (Table I). Severe weight loss, extreme emaciation and sluggishness were observed in all infected animals. Compared with the individual SMB-PS-inoculated mice at the same survival time, SMB-S15-inoculated mice were of obviously lower weight. The average weight (in 95% CI) of the S15-infected CD1, Balb/c and C57BL/6 mice dropped down to 76, 85 and 84%, respectively, thus exhibiting significant differences (see Table I and Fig. 2A). Ataxia (such as moving unsteadily with uncoordinated movements) was easily identified in the S15-inoculated C57BL/6 and Balb/c mice, but less frequently in CD1 mice. A small proportion of C57BL/6 and Balb/c mice, but not CD1 mice, trembled (Table I). The clinical manifestations progressed so quickly that almost all S15-treated mice died within 7–20 days after the onset of symptoms. The average clinical courses of S15-inoculated mice were 11.9±5.1 (CD1), 11.4±4.6 (Balb/c) and 12.7±6.6 (C57BL/6) days (Table I). The survival times of the S15-inoculated mice were 187.3±2.5 (CD1), 186.8±2.6 (Balb/c) and 185.4±3.4 (C57BL/6) days, respectively (Fig. 2B). Animals inoculated with SMB-PS lysates did not show any abnormality until the end of observation (>250 days after inoculation).

In order to successively passage the scrapie agents from the brains of SMB-S15-infected mice (first passage) onto the same strain of mice, 10% brain homogenates with detectable PK-resistant PrP^Sc were intracerebrally inoculated into ten CD1, Balb/c and C57BL/6 mice, respectively. Brain homogenates of SMB-PS-inoculated mice without detectable PrP^Sc were also intracerebrally inoculated into the mice of each strain as controls. Two mice from the groups of C57BL/6 and Balb/c died within a week of inoculation, which was attributed to acute mechanical brain damage. The mice of second passage showed abnormal signs 140 days after inoculation. The clinical manifestations of the second passage S15-inoculated mice were almost the same as those of the first passage animals: among them, loss of body weight, ataxia and sluggishness were the most noticeable signs. The average incubation times of the second-passage S15-inoculated CD1, Balb/c and C57BL/6 mice were 148.0±2.3, 146.8±1.8 and 153.0±2.2 days, respectively, and no statistical difference between the three strains of mice was noted (P=0.166) (Table II). However, compared with those of first passage mice, all second passage mice exhibited significantly shorter incubation times. The average clinical courses of second passage mice were 10.9±4.2 (CD1), 16.8±3.0 (Balb/c) and 14.0±3.2 (C57BL/6) days, respectively. The survival times of the second passage mice were significantly shorter than those of the first passage mice: 158.9±3.3 (CD1, P<0.001), 163.5±1.4 (Balb/c, P<0.001) and 167.0±2.7 days (C57BL/6, P=0.001), respectively (Fig. 2B). Moreover, no abnormality was noted in PS-inoculated animals until the end of observation (>200 days after inoculation).

To assess the presence of PrP^Sc in the brains of S15-inoculated mice, the brain homogenates of all diseased animals of the first passage were subjected to PK digestion and subsequently to western blot analysis with PrP-specific mAb 6D11. As with the SMB cell lysates (Fig. 3A), PK-resistant PrP signals were detected in the brain homogenates of all diseased mice of three different strains (Table I), which presented three predominant bands and migrated from 21–27 kDa (Fig. 3B). On the contrary, no trace of PK-resistant PrP signal was observed in the brain tissues of SMB-PS inoculated mice, regardless of whether they were CD1, Balb/c or C57BL/6 mice.

To address the similarity in electrophoresis and glycosylation of PrP^Sc molecules in the brains of the strains of mice inoculated with SMB-S15 cell lysates, the PK-treated and PK-untreated brain homogenates of the three different types of mice were separated on one SDS-PAGE together with those of scrapie strains 139A- and ME7-infected C57BL/6 mice and evaluated by PrP-specific western blot analysis. A band of roughly 21-kDa was observed in all preparations of S15-inoculated mice that had not been treated with PK, which was located in the same location as those of 139A- and ME7-infected mice (Fig. 3C and D), possibly indicating that the same size C2 fragments of PrP were generated in brains infected with those three scrapie strains. Three PK-resistant PrP bands in three strains of S15-inoculated mice mobilized at the same positions as those in 139A- and ME7-infected mice, in which the monoglycosyl PrP^Sc was the predominant form, followed by non-glycosyl and diglycosyl PrP^Sc (Fig. 3C and D). Further deglycosylation of the PrP^Sc molecules in the brains of S15-inoculated C57BL/6, CD1, Balb/c mice with PNGase F revealed a signal PrP-specific band that was located in the same positions (Fig. 3E).

Calculating the relative gray values of each glycosyl PrP^Sc band in the western blots showed that the percentages of di-, mono- and non-glycosyl forms in the brains of three S15-inoculated mice were 29, 42 and 29% in C57BL/6; 30, 43 and 27% in CD1; and 26, 43 and 31% in Balb/c mice. Compared with the glycosylating distributions of PrP^Sc molecules in 139A-infected mice (23, 45 and 32%) and ME7-infected mice (27, 43 and 30%). No significant differences were noted between the three strains of S15-inoculated mice or between the mice infected with 139A, ME7 and S15 (Fig. 3F).

To compare the potential differences in the levels of PK resistance of PrP^Sc in the brains of SMB-15-inoculated C57BL/6, CD1 and Balb/c mice, the brain homogenates from 3 randomly selected mice of first passage were selected from each group and pooled as the representative samples. The samples were exposed to digestion with different amounts of PK, ranging from 100–5,000 µg/ml. Western blot analysis revealed clear and similar PK-resistant PrP signals in all three types of mice in the preparations treated with a low concentration of PK (from 100–2,000 µg/ml). However, as the concentration of PK increased to 5,000 µg/ml, the PrP^Sc signals in Balb/c mice clearly became weaker, whereas PrP^Sc in the other two strains of mice remained almost unchanged (Fig. 4). These results indicate the strong PK resistance of PrP^Sc in the brains of S15-inoculated mice. The PrP^Sc formed in the infected Balb/c mice seems to have slightly weaker PK-resistant properties than PrP^Sc in C57BL/6 and CD1 mice.

In order to examine the characteristics of PrP^Sc deposits in the brains of mice infected with SMB-S15, brain sections from SMB-S15-inoculated mice of the first passage were analyzed by PrP^Sc-specific IHC assays. After treatment with GdnHCl, large amounts of brown PrP^Sc deposits were detected in the cortex regions of S15-inoculated C57BL/6, CD1 and Balb/c mice, accompanied by various sizes of vacuoles, whereas no PrP^Sc signal was observed in the cortex tissues of SMB-PS inoculated mice (Fig. 5). PrP^Sc in the S15-infected mice mainly appeared in a dispersed manner. In the regions with more vacuoles, PrP^Sc accumulated and formed relatively dark-stained particles around the vacuoles. Three S15-inoculated mice presented quite similar PrP^Sc deposit features in the cortex, regardless of the signal intensity or accumulating type. Obvious PrP^Sc signals were also observed in the cerebellum regions of S15-inoculated mice, which presented as numerous granular structures on a background of dispersive deposits, particularly in the regions of the gray layer. Noticeably, the PrP^Sc deposits in the cerebellum of the infected CD1 mice were significantly less than the other two types of mice (Fig. 5).

To study the neuropathological characteristics of infected mice, brain sections of the S15- and PS-inoculated C57BL/6, CD1 and Balb/c mice of the first passage were analyzed by H&E staining, and GFAP- and Iba1-specific IHC tests. Numerous various-sized vacuoles were observed in the brain tissues of S15-inoculated mice, but not in those of PS-inoculated mice (Fig. 6). The majority of the vacuoles were round or oval and varied in terms of size. Generally, spongiform changes in the cortex were more obvious than those in the cerebellum. CD1 mice seemed to have more and larger vacuoles than the other two groups of mice. Calculations of the severity and distribution of vacuoles in the cortex and cerebellum of the infected mice revealed that the average lesion scores in the cortex of C57BL/6, CD1 and Balb/c mice were 3.3, 3.7 and 3.0, respectively, while those in cerebellum were all 0.5. Abundant, large GFAP positive-stained astrocytes were noted in the brain tissues of all three strains of infected mice, and astrogliosis in the cortex region was more notable than that in cerebellum region (Fig. 7). Iba1-specific IHC assays identified abundances of microglia with much larger round- or amoeboid-shaped cell bodies in the sections of S15-infected mice, and no significant difference between the cortex and cerebellum was noted between the three strains of mice (Fig. 8). These data confirm that all three types of mice infected with SMB-S15 lysates exhibit typical neuropathological abnormalities representative of experimental TSEs