The protocol was approved by the Institutional Review Board of Tangdu Hospital (approval ID no. TDLL-2013009) (Shaanxi, China) and written informed consent was obtained from all the participating patients. OA articular cartilage samples were collected from the femoral condyles and tibial plateaus of 12 patients with primary OA undergoing total knee arthroplasty (TKA) (mean age ± SD, 63.1±9.1 years) at the Department of Orthopedics of Tangdu Hospital. Healthy cartilage samples were obtained from 10 trauma patients with no history of OA or other joint diseases (46.8±12.7 years).

To isolate primary human chondrocytes, cartilage specimens were dissected into small sections and subjected to sequential digestion with 0.1% trypsin (Invitrogen, Carlsbad, CA, USA) for 30 min and then with 0.2% collagenase Type II (Millipore Corp., Billerica, MA, USA) in Dulbecco's modified Eagle's medium (DMEM) (Gibco) for 10 h at 37°C. Isolated chondrocytes were filtered through 100-µm nylon filters. The cells were seeded in culture flasks in DMEM/F12 medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (HyClone, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco), and incubated at 37°C in a humidified atmosphere with 5% CO₂.

Primary chondrocytes were used to compare gene expression levels in normal and OA chondrocytes. The cells from passages 1 to 2 were used for the subsequent experiments.

Total RNA was extracted from primary chondrocytes using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. RNA was reverse-transcribed to generate first-strand complementary DNA (cDNA) using high-capacity cDNA reverse transcription kits (Applied Biosystems Life Technologies, Foster City, CA, USA). Real-time PCR was performed with the Power SYBR-Green PCR Master Mix and 7900 HT Fast Real-Time PCR system (both from Applied Biosystems, Carlsbad, CA, USA). The data were given as a threshold cycle (Ct). The levels of mRNA were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA controls using the comparative 2^−ΔΔCt method. The specific primers used for different mRNAs were: for human SIRT1, 5′-TGGCAAAGGAGCAGATTAGT AGG-3′ (forward) and 5′-CTGCCACAAGAACTAGAGG ATAAGA-3′ (reverse); for human GAPDH, 5′-ATTCCACCC ATGGCAAATTC-3′ (forward) and 5′-TGGGATTTCCAT TGATGACAAG-3′ (reverse).

To evaluate the miR-34a expression levels, total RNA was reverse transcribed into cDNA using the TaqMan MicroRNA Reverse Transcription kit and TaqMan MicroRNA assays (Applied Biosystems) according to the manufacturer's instructions. The small nuclear RNA U6 (RNU6) was used as an endogenous control for miRNA detection.

miR-34a mimic, miR-34a inhibitor and non-specific negative control (NC) were synthesized and purified by Guangzhou RiboBio Co., Ltd. (Guangzhou, China). There was a fluorescent FAM label linked with the 5′ terminal of miR-34a mimic, which was used for transfection validation. When the chondrocytes were grown to 80% confluence, miR-34a mimic, miR-34a inhibitor or non-specific negative oligonucleotides were transfected at a working concentration of 100 nmol/l using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Twenty-four hours after incubation, the transfection efficiency was observed using a fluorescence microscope (Olympus Co., Ltd., Beijing, China) and miR-34a expression level was evaluated by quantitative PCR.

Cell proliferation was measured with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltet-razolium bromide (MTT) assay. Chondrocytes were seeded in 96-well plates at a density of 5×10³ cells/well containing 100 µl of culture medium. The cells were transfected with 100 nM miR-34a mimic, miR-34a inhibitor or non-specific NC for 6 h. After transfection, 20 µl of MTT (5 mg/ml) (Sigma-Aldrich, St. Louis, MO, USA) was added every 24 h, followed by incubation for another 4 h at 37°C. The medium was removed, and 100 µl of dimethyl sulfoxide was added to each well to dissolve the formazan. The optical density (OD) was evaluated by measuring the absorbance at the wavelength of 490 nm, with a reference wavelength of 630 nm, using a microplate reader (Multiskan Ascent 354; Thermo Labsystems, Vantaa, Finland).

The apoptotic rate of chondrocytes was detected and quantified by flow cytometry. Briefly, chondrocytes were transfected with 100 nM miR-34a mimic, miR-34a inhibitor or NC. Forty-eight hours after transfection, 1×10⁵-treated cells of each group were collected, washed and incubated with Annexin V-FITC and propidium iodide (PI) (both from Millipore Corp.) for 15 min at a room temperature of 20°C in the dark. The cells were analyzed using a fluorescence-activated cell sorting (FACS) flow cytometer (BD Biosciences, San Diego, CA, USA).

Total proteins were extracted from the cells using RIPA buffer (Beyotime Institute of Biotechnology, Shanghai, China) with enzyme inhibitor cocktail (Complete; Roche, Basel, Switzerland). After being lysed on ice for 30 min, the lysate was centrifuged at 13,000 × g for 20 min, and the supernatant was collected for experiments. For the western blot analysis, 25 µg of extracts were separated using 10% SDS-polyacrylamide gel electrophoresis, transferred to a polyvinylidene difluoride membrane (Millipore Corp., Bedford, MA, USA) and incubated with anti-SIRT1 (mouse monoclonal antibody; 1:1,000; Cat. no. 8469), acetylated-p53 (Lys382; rabbit polyclonal antibody; 1:1,000; Cat. no. 2525), p53 (rabbit monoclonal antibody; 1:1,000, Cat. no. 2527), Bax (rabbit monoclonal antibody; 1:1,000; Cat. no. 5023), Bcl-2 (rabbit monoclonal antibody; 1:1,000; Cat. no. 4223) (Cell Signaling Technology, Inc., Danvers, MA, USA) and anti-GAPDH (mouse monoclonal antibody; 1:500; Cat. no. sc-365062; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) antibodies for 24 h at 4°C. GAPDH was used as internal control. The blots were developed using a chemiluminescent substrate kit (Pierce Biotechnology, Inc., Rockford, IL, USA). Intensity of the bands was detected and analyzed using Quantity One analyzing system (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Total RNA (1 µg) from human chondrocytes was reverse-transcribed into cDNA, and the SIRT1 3′-UTR was amplified using the primers: 5′-ATAGGC CGGCATAGACGCGTTGTAATAATTGTGCAGGTAC AGG-3′ (forward) and 5′-AAAGATCCTTTATTAAGCTTA AGTTAACAGAAAAAAGTCAAATGAC-3′ (reverse). The 3′-UTR of SIRT1 (1,796 bp) containing the miR-34a binding sites was cloned into the HindIII and MluI sites of the pMIR-Report Luciferase vector (Ambion, Austin, TX, USA) downstream of the firefly luciferase gene to develop the wild-type 3′-UTR luciferase reporter vector. The mutant 3′-UTR luciferase reporter vector was generated by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA). Human chondrocytes were plated in 24-well plates. The cells at 70–80% confluence were co-transfected with wild-type or mutant-type 3′-UTR-Luc reporter vector plus miR-34a mimic with Lipofectamine 2000 (Invitrogen). The pRL-CMV Renilla luciferase vector (Promega Corp., Madison, WI, USA) was used to normalize cell numbers and transfection efficiency. After an additional 48 h, the luciferase activity was measured using the dual luciferase assay (Promega Corp.) according to the manufacturer's instructions.

Recombinant lentivirus vector encoding antisense miR-34a (anti-miR-34a) or negative control (miR-NC) were constructed and purchased from GeneChem Co., Ltd. (Shanghai, China). Briefly, the oligonucleotides of antisense miR-34a inhibitor and NC were cloned into the lentivirus expression vector of hU6-MCS-CMV-EGFP (GeneChem Co., Ltd.). The recombinational and packaging vectors pHelper 1.0 and 2.0 (GeneChem Co., Ltd.) were co-transfected into 293T cells with Lipofectamine 2000 to produce viral particles of miR-34a antisense inhibitor and NC.

Experiments were performed according to the protocol approved by the Institutional Review Board of Tangdu Hospital and the study was conducted in full compliance with the Declaration of Helsinki and Institutional Animal Care Standards. Twenty-eight 10-week-old male Sprague-Dawley rats (obtained from the Experimental Animal Center of Fourth Military Medical University) were used in the subsequent experiments. The rats were randomly divided into 4 groups (n=7 each): anti-miR-34a, non-specific NC, Sham and No Surgery. For the Sham group, identical surgical procedures were performed, although the ligaments and medial menisci were kept intact. The No Surgery group did not undergo an operation. The animals were anesthetized with 3% pento barbital sodium (Cat. no. 4579; Tocris, Bristol, UK). Briefly, a 10-mm medial parapatellar incision over the distal patella to proximal tibial plateau was made on the right knee joint of rat. Experimental OA was induced through anterior cruciate ligament transection and medial meniscus resection (ACLT+MMx) as previously described (21). The rats were allowed to move freely within the cages after surgery. Two weeks after surgery, the rats in the anti-miR-34a and NC groups received an intra-articular injection of 1×10⁹ plaque forming units (PFU) of lentivirus vector encoding antisense miR-34a or non-specific control diluted in 100 µl phosphate-buffered saline (PBS), respectively. However, the Sham and No Surgery groups received the same dose of normal saline.

Ten weeks after surgery, the animals were sacrificed by cervical dislocation under 3% pentobarbital sodium narcosis and the whole joints were harvested. Tissues were routinely fixed in 10% buffered neutral formalin for 24 h, decalcified in 10% ethylenediaminetetraacetic acid (EDTA) (pH 7.2) for 4 weeks, embedded into paraffin, and coronally sectioned at 6 µm. The sections were deparaffinized in xylene, hydrated with graded ethanol, and stained with Safranin O and Fast Green. Histological evaluation was performed according to the modified Mankin's score, as previously reported (22).

The continuous variables were presented as mean ± standard deviation (SD). Statistical analysis was carried out using SPSS 20.0 (SPSS, Inc., Chicago, IL, USA). Comparisons between groups were made using the Student's t-test. One-way analysis of variance (ANOVA) followed by post hoc least significant difference (LSD) t-test was used for difference analysis in the multiple groups. Mankin's scores were evaluated using non-parametric statistical analyses. Results with values of p<0.05 were considered significant.

To assess the potential involvement of miR-34a and SIRT1 in the OA process, we initially evaluated the expression levels between healthy and OA cartilage. As shown in Fig. 1A, miR-34a expression was significantly (p<0.01) increased in OA cartilage compared with healthy cartilage. Conversely, the expression level of SIRT1 in cartilage from OA patients was decreased (p<0.01) compared with healthy cartilage confirmed by quantitative PCR (Fig. 1B).

To investigate the function of miR-34a in OA, we transfected human chondrocytes with miR-34a mimic, miR-34a inhibitor and negative oligonucleotides, respectively. At 24 h after transfection, the fluorescence microscopy image showed that the transfection efficiency of miR-34a oligonucleotides into human chondrocytes reached >80% (Fig. 2A). Compared with the NC and blank control (Blank) groups, the miR-34a level in the miR-34a group was elevated by ~105-fold (p<0.01). By contrast, the treatment of chondrocytes with miR-34a inhibitor decreased miR-34a expression by 80% (p<0.01). No statistical significance of miR-34a expression was identified between the NC and Blank groups (Fig. 2B).

As miR-34a was markedly increased in OA chondrocyte, it may function as a promoter of OA. Therefore, the MTT assay was performed and proliferation curve was determined to examine the effects of miR-34a on the proliferation of human chondrocytes. Fig. 3 shows that chondrocytes transfected with miR-34a mimic exhibited a significant decrease in proliferation capacity compared with cells in the NC and Blank groups (p<0.01). By contrast, when transfected with the miR-34a inhibitor, chondrocytes grew at a higher rate (p<0.01). No statistical significance was observed in the proliferation rate between the NC and Blank groups. The results indicated that overexpression of miR-34a inhibited the growth of human chondrocytes in vitro.

We performed Annexin V/PI staining-based flow cytometry analysis to evaluate the effects of miR-34a on chondrocyte apoptosis. Flow cytometry revealed that the chondro cyte apoptotic rate was increased significantly at 48 h after transfection with the miR-34a mimic (p<0.01). Cells in the anti-miR-34a group showed a lower proportion of Annexin V-positive cells (p<0.01). Cells transfected with non-specific oligonucleotides and blank cells had similar apoptotic rates (Fig. 4). Consequently, the results suggested that miR-34a regulates apoptosis of human chondrocytes in vitro.

miR-34a was found to directly repress the expression of SIRT1 in HCT116 cells (20). Our results in Fig. 1 show that cartilage from OA patients had a higher level of miR-34a and a lower level of SIRT1. Therefore, we further elucidated the molecular mechanism of miR-34a-mediated biological functions. The results from the western blot assay demonstrated that the SIRT1 protein level in the miR-34a group exhibited a significant decrease as compared with the NC and Blank groups. By contrast, knockdown of miR-34a by miR-34a inhibitor increased the protein abundance of SIRT1 (Fig. 5A and B). Additionally, the acetylated p53, a major target of SIRT1 deacetylation (16), was elevated by the ectopic expression of miR-34a and decreased by knockdown of miR-34a, while the total protein abundance of p53 was not significantly different between the groups (Fig. 5A, C and D). The protein levels of pro-apoptotic Bax and anti-apoptotic Bcl-2, two SIRT1/p53 pathway downstream genes, were elevated and inhibited, respectively, following miR-34a overexpression in human chondrocytes. The downregulation of miR-34a significantly decreased the Bax protein level and increased Bcl-2 (Fig. 5A, E and F). Furthermore, the levels of SIRT1 mRNA were not altered in chondrocytes transfected with miR-34a mimic or inhibitor (Fig. 5G).

To determine the underlying molecular mechanisms of miR-34a-mediated regulation of SIRT1 expression in human chondrocytes, we developed luciferase reporter vectors containing the wild-type 3′-UTR or mutant-type 3′-UTR of miR-34a binding sites of SIRT1 and detected the effects of miR-34a on the luciferase activity in human chondrocytes. Luciferase analysis revealed that the transfection of miR-34a mimic significantly suppressed the luciferase activity of the wild-type reporter vector while mutation of the miR-34a binding sites blocked this suppressive effect (p<0.05) (Fig. 5H). These data suggest that miR-34a affects SIRT1 expression by post-transcriptional regulation and miR-34a directly targets the SIRT1/p53 signaling pathway in human chondrocytes.

Given the findings in vitro, animal studies were conducted to evaluate the effects of miR-34a on experimental OA. In vivo, lentiviruses encoding miR-34a antisense inhibitor or NC were injected into the knee joints of rats. Cartilage was harvested for histological evaluation. The results revealed cartilage destruction and decreased Safranin O staining in the NC group. Intra-articular injection of miR-34a inhibitor-expressing lentiviruses significantly attenuated surgery-induced cartilage destruction in the anti-miR-34a group (Fig. 6A). Fig. 6B shows the modified Mankin's score in the miR-34a inhibitor-treated joints was significantly lower than that for NC-treated joints (p<0.01).