Glucocorticoids (GCs) contribute to the increased incidence of secondary osteoporosis and osteonecrosis, and medications for the prevention and treatment of these complications have been investigated for many years. Vitamin K2 (VK2) has been proven to promote bone formation both
Glucocorticoids (GCs) have been extensively used in the treatment of a variety of diseases, due to their potent anti-inflammatory effects. However, the long-term and excessive use of GCs is one of the most common causes of atraumatic osteonecrosis of the femoral head and likely increases the incidence of secondary osteoporosis (
Vitamin K (VK), whose active form has been demonstrated to be a coenzyme for γ-carboxylase, plays an important role in bone metabolism (
Several studies have reported the protective effects of VK2 on prednisolone-treated rats (
The cell culture medium, Dulbecco's modified Eagle's medium (DMEM; low glucose, 1 g/l), was obtained from HyClone, Logan, UT, USA. Fetal bovine serum (FBS) and the penicillin-streptomycin solution (10,000 U/ml penicillin; 10 mg/ml streptomycin) were purchased from Gibco Laboratories (Grand Island, NY, USA). VK2, L-ascorbic acid and β-glycerophosphate disodium salt hydrate were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Dexamethasone (DEX) was obtained from Sigma and was used at a concentration of 1
Mouse osteoblastic MC3T3-E1 cells (GNM15) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM supplemented with 10% FBS, penicillin (100 U/ml) and streptomycin (10
The MC3T3-E1 cells (5,000/well) were plated in 96-well plates and incubated overnight. Ten microliters of Cell Counting Kit-8 (CCK-8) solution were then added to 100
The Annexin V-FITC cell apoptosis detection kit (Beyotime Biotechnology, Shanghai, China) was used to detect cell apoptosis. The MC3T3-E1 cells were incubated with or without DEX and various concentrations of VK2 (10−5, 10−6 and 10−7 M) for 6 days, collected, resuspended in 200
Trypan blue staining was performed to evaluate cell viability. The MC3T3-E1 cells were treated with both DEX and various concentrations of VK2 (10−5, 10−6 and 10−7 M) in FBS-free medium for 6 days and then collected. Ten microliters of trypan blue (Invitrogen, Carlsbad, CA, USA) were mixed with 10
The cells were cultured in osteogenic differentiation medium and treated with DEX or DEX with various concentrations of VK2 (10−5, 10−6, and 10−7 M). Total RNA was extracted using TRIzol reagent (Invitrogen) at 1, 3 and 7 days following treatment, and the RNA was then reverse transcribed into cDNA using the EasyScript one-step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech Co., Ltd., Beijing, China), according to the manufacturer's instructions. RT-qPCR for ALP, OCN and Runx2 was performed using the TransStart Tip Green qPCR SuperMix (TransGen Biotech Co., Ltd.) with ABI Prism 7900 (Invitrogen). The reaction conditions were 1 cycle of 95°C for 30 sec and 40 cycles of 95°C for 5 sec and 60°C for 30 sec. Subsequently, a 65–95°C solubility curve was constructed. The relative amount of each mRNA was normalized to the β-actin mRNA. The primer sequences of each cDNA are presented in
To assay the ALP activity in the cells subjected to the different treatments, the total protein was harvested at 1, 3 and 7 days after the different treatments, as described above. ALP activity was evaluated using the ALP assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer's instructions. The values were measured at 520 nm and normalized to the protein concentration determined using the BCA protein assay kit (Thermo Fisher Scientific, Rockford, IL, USA). In addition, ALP staining was performed 7 days following incubation with the conditioning medium using the BCIP/NBT ALP Color Development kit (Beyotime Biotechnology), according to the manufacturer's instructions.
Following incubation with DEX or DEX plus various concentrations of VK2 (10−5, 10−6, and 10−7 M), the cell cultures were rinsed 3 times with PBS, fixed with 4% paraformaldehyde for 30 min, and then stained with Alizarin Red (Beyotime Biotechnology) for a further 30 min. The cultures were then evaluated under a light microscope (CKX31; Olympus, Tokyo, Japan).
Following 7 days of incubation with the different conditioning media, the MC3T3-E1 cells were fixed with 4% paraformaldehyde for 20 min, treated with 0.1% Triton X-100 for 15 min, and blocked with 10% FBS for 30 min at 37°C. The cells were then incubated with a rabbit anti-Runx2 monoclonal antibody (1:1,000 dilution; #12556; Cell Signaling Technology, Danvers, MA, USA) or an anti-OCN antibody (1:200 dilution; AB10911; Millipore, Billerica, MA, USA), followed by an anti-rabbit Alexa Fluor™ 488 secondary antibody (1:500 dilution; A32731; Invitrogen) for 1 h at 37°C. Finally, the MC3T3-E1 cells were stained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) for a further 30 sec, rinsed with PBS and then examined under a fluorescence microscope (Leica DM IL LED; Leica, Wetzlar, Germany).
To examine the effects of DEX or DEX and VK2 on the differentiation of the MC3T3-E1 cells, total protein was harvested from the cells cultured in the osteogenic medium described above for 1, 3 and 7 days. The protein concentrations were measured using the BCA protein assay kit (Thermo Fisher Scientific). The protein samples were then separated on a 10% SDS-PAGE gel and transferred onto a PVDF membrane. The membrane was blocked with 5% BSA and incubated with the primary antibodies overnight at 4°C, followed by incubation with a horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h. After rinsing 3 times with PBST, the membrane was scanned in an Odyssey scanner (Li-COR Biosciences, Lincoln, NE, USA). The antibodies used for the western blot analysis were as follows: monoclonal rabbit anti-rat GAPDH antibody (1:1,000 dilution; #2118), monoclonal rabbit anti-rat Runx2 antibody (1:1,000 dilution; #12556), and an HRP-conjugated rat anti-rabbit antibody (1:2,000 dilution; #7074) (all from Cell Signaling Technology, Danvers, MA, USA). The bands were quantified using Quantity One software and normalized to GAPDH.
Following incubation in the conditioning medium for 1, 3 and 7 days, the MC3T3-E1 cells were incubated with regular medium for a further 24 h. The media were then harvested and the concentrations of OCN in the media were detected using an ELISA kit (Mlbio, Shanghai, China); the values were normalized to the total protein concentration, which was determined using a BCA kit (Invitrogen).
SPSS 20.0 software (Microsoft, SPSS, Inc., Chicago, IL, USA) was used to analyze the values in each group. All the experiments in this study were performed in triplicate and the data are expressed as the means and standard deviation (SD). A statistical comparison of the data between the groups was performed using one-way analysis of variance (ANOVA) with a Student-Newman-Keuls (SNK) post hoc test. A P-value <0.05 was considered to indicate a statistically significant difference.
A CCK-8 assay was performed at 48, 96 and 144 h following treatment with DEX alone or with DEX and VK2. The results revealed that MC3T3-E1 cell proliferation was significantly suppressed at 96 and 144 h by DEX, although no significant change was observed at 48 h. However, the addition of VK2 promoted cell proliferation at these 3 time points, particularly following treatment with 10−6 and 10−7 M VK2. We did not observe a dose-dependent effect of VK2 (
The results of cell apoptosis assay indicated that VK2 inhibited apoptosis and enhanced the survival of the DEX-treated cells, which was also demonstrated by trypan blue staining. In this experiment, only 65.3% of the MC3T3-E1 cells in the DEX group survived after being treated with DEX in FBS-free medium for 6 days, while significantly more cells survived in the other groups. Cell viability imaging also yielded similar results (
To verify whether VK2 enhances the osteogenic differentiation potential of DEX-treated MC3T3-E1 cells, we also detected the mRNA expression levels of both early and mature osteogenic markers in the MC3T3-E1 cells. The results revealed that, following incubation, the mRNA levels of Runx2, ALP and OCN were downregulated by DEX and upregulated by VK2, particularly following treatment with 10−6 M VK2 (
We performed immunofluorescence staining and western blot analysis to detect the expression of Runx2, an early osteogenic marker. We observed that the Runx2 level in the DEX-treated MC3T3 cells was significantly decreased, while the Runx2 protein levels were significantly upregulated in the presence of VK2, particularly 10−6 M VK2 (
Following 7 days of incubation with DEX or DEX and various concentrations of VK2, we performed ALP staining to detect osteogenesis in the MC3T3-E1 cells. As shown in
OCN is a mature stage osteogenic marker; therefore, the OCN levels in the media of the MC3T3-E1 cells treated with DEX and VK2 were detected on days 1, 3 and 7. The results revealed that the OCN levels in the media increased over time. The DEX-treated MC3T3-E1 cells secreted evidently less OCN than the controls at all time points, while the MC3T3-E1 cells treated with DEX and VK2 had more OCN in the media, particularly the cells treated with 10−6 M VK2 (
GC-induced osteoporosis greatly increases the risk of fracture, and pharmacological therapy is recommended as soon as possible and has been studied for many years (
Several studies have indicated that GCs inhibit osteoblast proliferation
The critical role of Runx2 in osteoblasts has been well described by previous studies (
OCN is a non-collagenous, VK-dependent protein that is secreted in the late stage of osteoblast differentiation. One role of VK2 in bone metabolism is to act as a coenzyme for the γ-carboxylation of OCN, which combines with hydroxyapatite to ultimately promote bone mineralization (
Studies have demonstrated that treatment with 10−5 M VK2 alone promotes mineralization and increases the Ca2+ concentrations more effectively than lower concentrations (
In conclusion, in this study, we demonstrated that VK2 promoted osteoblast proliferation and osteogenic differentiation, inhibited cellular apoptosis and enhanced cellular survival, supporting the view that VK2 is a promising option for the prevention and treatment of GC-induced osteoporosis and osteonecrosis.
This study was funded by the National Natural Science Foundation of China (no. 81301572) and the SMC-Chen Xing Plan for Splendid Young Teachers of Shanghai Jiao Tong University.
Effects of dexamethasone (DEX) and DEX plus vitamin K2 (VK2) on the proliferation, apoptosis and survival of MC3T3-E1 cells. (A) MC3T3-E1 cell proliferation was detected using Cell Counting Kit-8 (CCK-8) assays. The results revealed that DEX inhibited cell proliferation, particularly at day 6, while VK2 promoted cell proliferation. (B) Detection of MC3T3-E1 cell apoptosis; the values in the right bottom quadrant indicate the apoptotic cells. (C and D) Trypan blue staining and live/dead cell staining showed that significantly fewer MC3T3-E1 cells in the DEX group survived and more cells in the DEX + VK group survived (*P<0.05, significant difference vs. the DEX group).
Expression of osteogenesis-related mRNAs in the MC3T3-E1 cells. The mRNA levels of (A) Runx2, (B) ALP and (C) OCN were downregulated by dexamethasone (DEX) and upregulated by vitamin K2 (VK2), particularly 10−6 M VK2 (*P<0.05, significant difference vs. the DEX group).
Runx2 protein expression in the MC3T3-E1 cells. (A) Immunofluorescence staining of the MC3T3-E1 cells after 7 days of incubation with dexametha-sone (DEX) or DEX and various concentrations of vitamin K2 (VK2). Little green staining was observed in the DEX group. By contrast, more green staining was observed in the DEX + VK groups, particularly the DEX + VK−6 group. (B and C) Western blot analysis results of the Runx2 protein. More protein expression was observed in the DEX + VK groups, particularly the group treated with 10−6 M VK2 (*P<0.05, significant difference vs. the DEX group).
Quantitative and qualitative analysis of the expression of the alkaline phosphatase (ALP) protein. (A) ALP staining of MC3T3-E1 cells treated with dexamethasone (DEX) or DEX combined with vitamin K2 (VK2). Fewer bluish violet cells were observed in the DEX group than the control group, and more were observed in the DEX + VK groups. (B) ALP activity in the MC3T3-E1 cells. The MC3T3-E1 cells in the DEX plus 10−6 M VK2 group exhibited obviously upregulated ALP activity (*P<0.05, significant difference vs. the DEX group).
Protein expression of osteocalcin (OCN) and Alizarin Red staining. (A) Immunofluorescence staining of the MC3T3-E1 cells after a 7-day incubation with dexamethasone (DEX) or DEX and various concentrations of vitamin K2 (VK2). (B) Levels of OCN secretion from the MC3T3-E1 cells. VK2 markedly promoted increased OCN secretion by the MC3T3-E1 cells treated with 10−5 M DEX. (C) Alizarin Red staining of the MC3T3-E1 cells that were induced for 7 days. Increased numbers of calcified nodules were observed in the DEX + VK groups than in the DEX group, although they were still fewer than the control group (*P<0.05, significant difference vs. the DEX group).
Sequences of primers used for RT-qPCR.
Gene | Forward primer | Reverse Primer |
---|---|---|
Runx2 | TGGCCGGGAATGATGAGAAC | TGAAACTCTTGCCTCGTCCG |
ALP | CACTCTGTCCCGTTGGTGTC | TTGACGTTCCGATCCTGCAC |
OCN | TCTGACAAAGCCTTCATGTCCA | AGCCCTCTGCAGGTCATAGA |
β-actin | GTCGAGTCGCGTCCACC | GTCATCCATGGCGAACTGGT |
Runx2, Runt-related transcription factor 2; ALP, alkaline phosphatase; OCN, osteocalcin.