A total of 60 male BALB/c mice (8–12 weeks old, weighing 23±2 g) were purchased from the Central Laboratory of Animal Science, Wuhan University (Wuhan, China) and were maintained in a specific pathogen-free facility with a 12-h light/dark cycle and were fed standard laboratory chow with free access to water ad arbitrium. All the animal protocols used in the study were reviewed and approved by the Animal Experiment Center of Wuhan University/Animal Biosafety Level-III Laboratory. 2/3 PH was performed on 8-12-week-old mice using a previously described method (18). Following a laparotomy, the left and median liver lobes were resected in two steps. Five mice were used for each 2/3 PH time point (0, 2, 6, 12, 15, 18, 24, 36, 48, 72, 120 and 168 h). The end of surgery was considered 0 h. All the partial hepatectomies were performed in the early morning hours. The mice were sacrificed (by cervical dislocation) at defined time points following PH. The mice were sacrificed under isoflurane anesthesia as previously described (18). The remaining parts of the livers were surgically removed, cleaned with saline solution and were snap-frozen in liquid nitrogen for RNA and protein analysis and kept at −80°C until further use or fixed in 4% paraformaldehyde for histological analysis and processed for immunohistochemistry. For histological analysis, after being fixed in 4% paraformaldehyde for 48 h, the tissues were embedded in paraffin. The total body weight was measured, and the remnant and regenerated liver tissues were resected and weighed. The acquired data were expressed as a percentage of the ratio between the remnant liver weight (A) divided by the total body weight (B) ×100 (liver-to-body weight ratio (%) = A/B ×100).

At different time points following 2/3 PH, the animals were sacrificed and the liver tissues were harvested. Liver tissues were obtained from the remnant livers and then fixed immediately in 10% buffered formalin phosphate solution, embedded in paraffin and were then cut into 5-mm-thick sections. The sections were stained with hematoxylin and eosin (H&E). The H&E staining kit was obtained from Service Bio Co., Ltd. (Wuhan, China Cat. no. G1005). All tissue sections were examined with an Olympus BH-2 microscope (Olympus Optical Co. Ltd., Beijing, China). Motic Images 2000 (Motic China Group Co. Ltd, Guangzhou, China) was used for the characterization of histopathological changes.

The mice were sacrificed and blood samples were collected via the post-orbital venous plexus at the mentioned observation time points. Serum samples were separated and stored at −80°C until further use. The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and albumin (ALB) were measured using respective ELISA kits (Nanjing Jiancheng Biological Technology, Inc., Nanjing, China) as previously described (19).

Total RNA was isolated from the frozen tissues or cells using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. For RT-qPCR, a reverse transcription kit (Takara Biotechnology Co., Ltd. Dalian, China) was used to synthesize cDNA. A SYBR-Green PCR kit (Toyobo, Osaka, Japan) was used to complete the RT-qPCR analyses. PCR reactions were performed on a CFX96 system (Bio-Rad CFX96; Bio-Rad Laboratories, Inc., Hercules, CA, USA). The results of RT-qPCR were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and the 2^−ΔΔCT values were normalized to the GAPDH levels. All the RT-qPCR experiments were repeated at least 3 times. The primer sequences used in this study are listed in Table I.

NCTC 1469 and BNL CL.2 cells were obtained from the China Center for Type Culture Collection (Wuhan, China). The NCTC 1469 cells were cultured with Dulbecco6s modified Eagle's medium (DMEM H-21, 4.5 g/l glucose) supplemented with 15% horse serum. BNL CL.2 cells were cultured with DMEM supplemented with 10% fetal bovine serum (FBS). The growth media used in the present study contained 5 U/ml penicillin and 5 μg/ml streptomycin sulfate. Full-length MALAT1 (GenBank: NR_002847.2) was cloned into the pcDNA3.1 vector (Invitrogen Life Technologies). An empty vector (pcDNA3.1) was used as a control. siRNAs against MALAT1 were designed and synthesized by Beijing View Solid Biotechnology (Beijing, China). The siRNA target sequences used in this study are listed in Table I. The MALAT1 expression levels were detected by RT-qPCR. Scramble siRNA was used as a control. Transfection was conducted using a LipoJet™ in vitro DNA and siRNA transfection kit (both from SignaGen Laboratories, Gaithersburg, MD, USA) according to the manufacturer's instructions. The hepatocytes were fixed with 4% paraformaldehyde 48 h after transfection for further analysis.

NCTC 1469 cells were treated with HGF (Cat. no. #315-23; PeproTech, Rocky Hill, NJ, USA) using a concentration range of 5–20 ng/ml. It is recommended to reconstitute the lophilized HGF in sterile 18MΩ-cm H₂O not less than 100 μg/ml, which can then be further diluted to other aqueous solutions.

The cells transfected with siRNA or the pcDNA3.1 vector were collected at 48 h post-transfection. Following double-labeling with Annexin V-FITC and propidium iodide (PI), apoptosis was analyzed using a flow cytometer (FACScan^®; BD Biosciences, Franklin Lakes, NJ, USA) equipped with CellQuest 3.3 software. For the cell cycle analysis, 1×10⁶ cells were plated into a 60-mm dish and incubated for 24 h. The cells were subsequently stained with 1 ml of staining solution [PI (50 μg/ml) and RNase A (20 μg/ml)] for 15 min using the Cycletest™ PLUS DNA reagent kit (BD Biosciences) according to the manufacturer's instructions.

The liver tissue samples and hepatocytes were homogenized in lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) and incubated for 30 min on ice. For the detection of β-catenin, cytoplasmic and nuclear protein extracts were prepared from the cells using the NE-PER Nuclear and Cytoplasmic Extraction Reagent kit (Cat. no. 78835; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. Total protein was electrophoresed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The membranes were incubated with the corresponding primary antibodies overnight at 4°C. The following day, the membranes were incubated with secondary antibodies [goat anti-rabbit IgG (H+L)-HRP (LK2001; Sungene Biotech Co., Ltd., Tianjin, China)] for 1–2 h. Proteins were detected using the ECL immunoblotting kit (Beyotime Institute of Biotechnology). The fluorescent bands were observed in a dark room with infrared light. The above procedure was performed according to the manufacturer's instructions. The information for the antibodies is listed in Table II.

A Cell Counting Kit-8 kit (CCK-8; Dojindo, Kumamoto, Japan) was used for the cell proliferation assays. Approximately 3–5×10⁴ cells were plated in triplicate in 96-well plates and cultured in growth medium. The plate was incubated at 37°C and 5% CO₂ for an appropriate length of time (4–6 h) until cell adherence. Ten microliters of CCK-8 solution were then added to each well of the plate. The absorbance was measured at 450 nm using a microplate reader (168-1000XC; Bio-Rad Laboratories, Inc.) at the indicated time points.

The EdU incorporation assay was performed using an EdU Apollo DNA in vitro kit (C10310-1; Guangzhou RiboBio Co.,Ltd., Guangzhou, China) according to the manufacturer's instructions. The hepatocytes were stained with EdU 48 h following transfection. First, the cells were incubated with 100 ml of 50 mM EdU/well for 2 h. The cells were then fixed with 4% paraformaldehyde for 15 min at room temperature. Following fixation and washing with phosphate-buffered saline (PBS), the cells were incubated with 50 μl of 2 mg/ml glycine for 5 min. One hundred microliters of permeabilization buffer (PBS containing 0.5% Triton X-100) was added to each well, and the cells were incubated with 100 μl 1X Apollo solution for 30 min at room temperature in the dark. Then, 100 μl 1X Hoechst 33342 solution was added dropwise into each cell climbing slice for 15 min. The cell climbing slices were washed, dried, mounted and then observed under a fluorescence microscope (Olympus BX53; Olympus, Tokyo, Japan).

Paraffin-embedded tissue was cut into 4-μm-thick sections and processed for IHC in accordance with a previously described protocol (20). For IF, the cells were fixed with 4% paraformaldehyde, permeabilized using 0.2% Triton X-100 and incubated with primary and secondary antibodies according to the manufacturer's instructions. The cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Calbiochem, San Diego, CA, USA) and imaged using a confocal laser scanning microscope (Olympus FV1000; Olympus).

Quantitative data are presented as the means ± standard deviation (SD) from at least 3 independent experiments. Statistical significance was assessed using the Student's t-test, χ² test or Fisher's exact test, which were performed using SPSS 22.0 statistical software (IBM SPSS, Inc., Chicago, IL, USA). Differences were considered statistically significant when P-values were <0.05.

To determine the impact of MALAT1 on liver regeneration, we first generated mouse model of 2/3 PH. To assess rehabilitation from acute liver injury, the serum levels of ALT, AST and ALB were determined 0, 24, 36, 48, 72 and 168 h following 2/3 PH. As shown in Fig. 1A–C, all the indicators returned to normal at 168 h following 2/3 PH. H&E staining of the liver was carried out at different time points. Following hepatectomy, we observed obvious cell edema at 15 and 36 h. Mitotic figures were clearly observed at 72 h, and the hepatic lobe structure was close to normal at 120 h (Fig. 1D). Mouse hepatocyte proliferation was determined in vivo by staining for proliferating cell nuclear antigen (PCNA) (Fig. 1D) using IHC. We found that the number of PCNA-positive nuclei reached a peak at 36 h following 2/3 PH. The cell proliferative ability was reduced at 72 and 120 h, and the proliferation at 24 and 168 h was not significant (Fig. 1D). The remnant liver/body weight ratio is shown in Fig. 1E.

2/3 PH in male BALB/c mice caused a >5-fold increase in MALAT1 expression. MALAT1 expression increased from 2 h, peaked at 15 h following PH, and then returned to almost normal levels 120 h following 2/3 PH (Fig. 1F). These results suggested that MALAT1 was specifically overexpressed in hepatic tissue following 2/3 PH. Taken together, this sharp increase indicates that MALAT1 may play a role in liver regeneration.

As it has been previously demonstrated that hepatocytes from adult male mice enter the S phase at 36 h following 2/3 PH (18) and that the expression of MALAT1 reaches a maximum after 12–18 h of liver regeneration, we hypothesized that MALAT1 may play an important role in regulating the cell cycle, as the expression of MALAT1 peaked before 36 h.

First, we analyzed MALAT1 expression in BNL CL.2 and NCTC 1469 cells. MALAT1 expression was significantly higher in the BNL CL.2 cells than in the NCTC 1469 cells (Fig. 2A). As shown in Fig. 2B, siRNA-2 was the most effective at silencing MALAT1. MALAT1 expression was upregulated almost 18-fold following transfection of the NCTC 1469 cells with the pcDNA3.1 vector carrying MALAT1. CCK-8 (Fig. 2C) and EdU immunofluorescence assays (Fig. 2D) were used to detect changes in the proliferative ability of the MALAT1-silenced BNL CL.2 cells and MALAT1-overexpressing NCTC 1469 cells. The experimental results revealed that cell proliferation was reduced when MALAT1 was silenced in the BNL CL.2 cells and was increased when MALAT1 was overexpressed in the NCTC 1469 cells. As shown in Fig. 2D, the MALAT1-overexpressing NCTC 1469 cells had more EdU-positive cells than the control group, while the MALAT1-silenced BNL CL.2 cells had fewer EdU-positive cells than the control cells. Moreover, FACS analysis indicated that the MALAT1-silenced BNL CL.2 cells were arrested in the G0/G1 phase of the cell cycle. Furthermore, the number of cells in the G0/G1 phase decreased significantly and the number of cells in the S phase increased significantly when MALAT1 was overexpressed in the NCTC 1469 cells (Fig. 2E). At the same time, the rate of apoptosis increased when the BNL CL.2 cells were transfected with MALAT1-siRNA-2, but decreased when the NCTC 1469 cells were transfected with pcDNA3.1-MALAT1 (Fig. 2F). To further examine the role of MALAT1 in cell cycle progression, the expression of cyclin E1 and B1 was examined in the MALAT1-silenced BNL CL.2 cells. The results revealed that the G0/G1 phase was extended when MALAT1 was silenced in the BNL CL.2 cells (Fig. 2G). Thus, the above-mentioned data indicate that MALAT1 facilitates liver cell proliferation by accelerating cell cycle progression and blocking liver cell apoptosis.

As MALAT1 expression increased during the early stages after 2/3 PH and HGF rapidly increases following PH and plays a substantial role during liver regeneration (6), we hypothesized that the increase in MALAT1 expression may be mediated by HGF. To confirm our hypothesis, the NCTC 1469 cells were treated with 5, 10 or 20 ng/ml HGF to induce hepatocyte proliferation. As shown in Fig. 3A, MALAT1 expression gradually increased following treatment with increasing concentrations of HGF. The increased expression of HGF was detected in the BALB/c mice subjected to 2/3 PH (Fig. 3B). Moreover, as shown in Fig. 3C, we identified a correlation between the HGF and MALAT1 levels in the liver tissue at different time points following 2/3 PH.

It has been demonstrated that the Wnt/β-catenin pathway is associated with proliferation and differentiation (21). Thus, to determine whether MALAT1 accelerates hepatocyte proliferation by activating the Wnt/β-catenin pathway, we evaluated the levels of cyclin D1, β-catenin, the β-catenin-degradation component, Axin1, glycogen synthase kinase (GSK)-3β and APC in MALAT1-silenced BNL CL.2 cells and MALAT1-overexpressing NCTC 1469 cells. The results revealed an increase in the protein and mRNA levels of β-catenin and cyclin D1 in the MALAT1-overexpressing NCTC 1469 cells (Fig. 4A, C and E). The protein and mRNA levels of Axin1 and APC decreased when MALAT1 was overexpressed in the NCTC 1469 cells (Fig. 4B and C); however, there was no significant change in the level of GSK-3β (Fig. 4B and C). The level of c-Myc increased when MALAT1 was overexpressed, but declined following the knockdown of MALAT1 (Fig. 4C).

As shown in Fig. 4D and E, inactive β-catenin was located in the cytoplasm, and total β-catenin staining decreased when MALAT1 was silenced in the BNL CL.2 cells. In addition, western blot analysis of β-catenin demonstrated that the level of β-catenin in the nucleus also decreased significantly when MALAT1 was silenced. These effects were reversed when MALAT1 was overexpressed. There was no significant difference in the level of cytoplasmic β-catenin when MALAT1 was silenced or overexpressed (Fig. 4E). β-catenin phosphorylation occurs in a multiprotein complex that includes the GSK-3β, β-catenin, Axin1 and APC proteins; this phosphorylation leads to the degradation of cytoplasmic β-catenin (22,23).

On the whole, our data demonstrate that MALAT1 promotes cell cycle progression and accelerates hepatocyte proliferation during liver regeneration by activating Wnt/β-catenin signaling. By suppressing Axin1 and APC, MALAT1 indirectly reduces the stability of the β-catenin degradation complex, decreasing the level of inactive β-catenin, while increasing the level of active β-catenin. Active β-catenin is released and begins functioning. Subsequently, active β-catenin translocates to the nucleus to controls the transcription of target genes, such as c-Myc and cyclin D1. Finally, MALAT1 enhances hepatocyte proliferation by promoting cell cycle progression in vitro.

p53 activation is involved in hepatocyte proliferation following PH (24–26). A previous demonstrated shown that the down-regulation of MALAT1 or the upregulation of p53 suppresses the proliferation of murine hematopoietic cells, as p53 specifically binds to the core promoter region of MALAT1. The core binding sequence is CGGCATGGCCGCCAAGGTCGCCGT GCCCT (27).

In this study, in order to determine the biological relevance of the p53-mediated regulation of MALAT1 in vivo, we examined the mRNA and protein levels of p53 during liver regeneration. The results of IHC and western blot analysis indicated that 2/3 PH decreased p53 expression in BALB/c mice, with p53 expression being detectable at 6 h, with the lowest levels being observed at 15 h, and the highest at 120 h. The levels of p53 at 72 and 168 h were close to the levels observed 0 h following PH (Fig. 5A and B). A correlation between MALAT1 and p53 may exist during liver regeneration (Fig. 5C). Cellular functional analysis indicated that MALAT1 had an effect on hepatocyte apoptosis, and thus we specifically detected apoptosis at 15 h following 2/3 PH. The proportion of cells undergoing apoptosis was 11% at 15 h, and the level of apoptosis may be related to p53 and MALAT1 (Fig. 5D). Thus, we hypothesized that MALAT1 may be negatively regulated by p53 during liver regeneration.