Oxidative signaling and oxidative stress contribute to aging, cancer and diseases resulting from lung fibrosis. In this study, we explored the anti-oxidative potential of oligomeric proanthocyanidins (OPCs), natural flavonoid compounds. We examined the protective effects of OPCs against hydrogen peroxide (H2O2)-induced oxidative stress in non-small cell lung cancer cells (A549). We demonstrated that OPC markedly attenuated H2O2-induced A549 cell viability, as shown by by 3-[4,5-dimethylthiazol-2-yl)]-2,5-diphenyl-tetrazolium bromide (MTT) assay. At the same time, OPC inhibited H2O2-induced oxidative stress by significantly increasing the activities of superoxide dismutase, catalase and glutathione, and reducing the levels of reactive oxygen species (ROS) and malondialdehyde (MDA). Treatment of the A549 cells with OPC significantly promoted the nuclear translocation of NF-E2-related factor 2 (Nrf2) and significantly enhanced the expression of its target genes [heme oxygenase-1 (HO-1), NAD(P)H quinone dehydrogenase 1 (NQO1) and thioredoxin reductase 1 (TXNRD1)] with different fold change values at both the mRNA and protein level. The knockout of Nrf2 using CRISPR/Cas9 technology attenuated OPC-mediated ARE gene transcription, and almost abolished the OPC-mediated protective effects against H2O2-induced oxidative stress. On the whole, our study suggests that OPC plays an important role in controlling the antioxidant response of A549 cells via the Nrf2-ARE pathway.
Oligomeric proanthocyanidins (OPCs) are extensively distributed in the plant kingdom and are present in high concentrations in certain plant-based foods and beverages (
Nuclear factor erythroid 2-related factor 2 (Nrf2) is commonly known to play a role in the transcriptional regulation of genes encoding antioxidant proteins under stress conditions (
In this sudy, we investigated the anti-oxidative potential of OPCs against H2O2-induced oxidative stress in A549 non-small cell lung cancer cells. OPCs prevent oxidative stress by the accumulation of Nrf2 protein in A549 cells. Further research will be crucial in determining how this inhibitor mediates lung protection and its use as a clinical approach in lung disease.
OPC (purity ≥98%) was purchased from Zelang Biological Technology Co., Ltd. (Nanjing, China). H2O2 was obtained from Sigma-Aldrich (St. Louis, MO, USA). RPMI-1640 medium and fetal bovine serum (FBS) were obtained from Gibco Industries, Inc. (Grand Island, NY, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), trypsin, L-glutamate, MK-801 and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich. The DCFH-DA ROS assay kit was purchased from the Beyotime Institute of Biotechnology (Jiangsu, China). GSH-Px, CAT and SOD assay kits were procured from Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). The bicinchoninic acid (BCA) protein reagent was from the Beyotime Institute of Biotechnology Co. Ltd., Shanghai, China).
For this study, A549 cells were obtained from the cell bank of the Chinese Academy of Science (Shanghai, China). The A549 cells were cultured in RPMI-1640 medium supplemented with 10% FBS 2 mM L-glutamine, penicillin (100 U/ml) and streptomycin (100 mg/ml) (Wako, Osaka, Japan). The cells were cultured in a humidified incubator containing 5% CO2 and 95% air at 37°C. The cells were divided into 3 groups based on the treatments as follows: the control group (cells treated with culture medium), H2O2 group (cells exposed to H2O2 for 12 h at a final concentration of 200
Cell viability was performed using the MTT colorimetric assay. Following cell treatment, the medium was removed, and the cells were incubated with 20
The cells were lysed in RIPA buffer (150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) supplemented with a protease and phosphatase inhibitor cocktail on ice for 15 min, sonicated and centrifuged at 13,000 × g for 15 min. The protein content of the supernatants was measured by BCA reagent (Pierce, Rockford, IL, USA). For the examination of Nrf2 expression, nuclear proteins and cytoplasmic proteins were separated using a Bioepitope Nuclear and Cytoplasmic Extraction kit (Bioworld Technology, St. Louis Park, MN, USA) according to the manufacturer's instructions. Cellular proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes. The membranes were probed with the following primary antibodies (Abs): anti-TXNRD1 (ab16847; 1:1,000; Abcam, Cambridge, MA, USA); anti-Nrf2 (#12721; 1:1,000; Cell Singaling Technology, Danvers, MA, USA); anti-tubulin (ab7291; 1:5,000); anti-HO-1 (ab13248; 1:1,000); lamin B (ab8980; 1:1,000) and anti-NQO1 (ab34173; 1:1,000) (all from Abcam, Cambridge, MA, USA). This was followed by detection using HRP-conjugated secondary antibodies to rabbit IgG (GE Healthcare, Piscataway, NJ, USA).
Total RNA was extracted from the A549 cells using TRIzol reagent and then reverse transcribed into cDNA using the QuantScript reverse transcription kit (Tiangen, Beijing, China) according to the manufacturer's instructions. Amplification was conducted using a SYBR-Green I PCR kit (Roche, Indianapolis, IN, USA). The PCR reaction conditions were as follows: initial denaturation at 95°C for 10 min, followed by 35 amplification cycles of 95°C for 10 sec, 55°C for 10 sec, 72°C for 15 sec, and a final extension at 72°C for 10 min. β-actin was used as an internal reference gene. Relative values for mRNA levels were calculated using the following formula: fold change = 2−ΔΔCq. The primers used for each gene are listed in
The cells were incubated with 300 nM dichloro-dihydro-fluorescein diacetate (DCF-DA) (Sigma-Aldrich) for 10 min at 37°C. Following 2 washes in phosphate-buffered saline (PBS)-1X, DCF-DA fluorescence was analyzed using a flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) and FlowJo software.
The A549 cells were plated in 6-well plates at a density of 10×104 cells/ml in 2.5 ml of culture medium. After the cells were treated in accordance with the experimental design, the cells were then harvested, disrupted ultrasonically on ice and centrifuged at 2,500 × g for 10 min at 4°C. The supernatants were collected and stored −20°C for subsequent analysis. The levels of SOD, GSH-Px and CAT were detected using a Wallac 1420 microplate spectrophotometer (Perkin Elmer, Waltham, MA, USA) using commercially available assay kits (Jiancheng Bioengineering Institute) following the manufacturers' instructions.
A reaction mixture containing 0.2 ml cell lysate and 4.2 ml reaction buffer was treated by ultrasound for a certain time using a 22 kHz ultrasound generator (HN-1000Y; Shanghai Hanno Instrument Corp., Shanghai, China) equipped with a tapered horn tip (10-mm end diameter) and boiled for 10 min in water bath, then cooled down and centrifuged at 4,000 rpm for 10 min. the supernatants were measured using a kit purchased from the Nanjing Jiancheng Bioengineering Institute according to the thiobarbituric acid method, which is based on the fact that MDA reacts with thiobarbituric acid to form thiobarbituric acid reactive substances (TBARS) with a maximum absorbance at 530 nm. The experiments were performed in triplicate.
Target sequences for CRISPR interference (
First, the cells were spinned down in the PCR plate, and the supernatant was discard, leaving 10
The NQO1-ARE promoter was cloned into pGL3-Basic (Promega, Madison, WI, USA) vector by standard methods. For the luciferase assay, the A549 cells were transiently transfected with the luciferase construct and β-galactosidase (as an internal control). The cells were transfected using PolyJet reagent (Invitrogen) according to the manufacturer's instructions. Luciferase activity was determined using a luminometer. The medium was removed from the cells, and the cells were then lysed in 100
All data are presented as the means ± standard deviation (SD). Statistical analysis was carried out using one-way ANOVA followed by the Scheffe test using SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Statistical significance was set at p<0.05.
We first examined the potential effects of OPC in A549 cells. The resutls of MTT assay for cell survival shown in
In order to elucidate the potential mechanisms responsible for the protective effects of OPC against H2O2-induced oxidative stress, the A549 cells were exposed to H2O2 for 12 h following treatment or not with OPC. We then examined the mRNA and protein expression of Nrf2 and Nrf2 target genes. We found that H2O2 increased the mRNA expression of Nrf2 and Nrf2 target genes and this increase was further enhanced by OPC (
As Nrf2 was above shown to participate in the protective effects of OPC against oxidative stress, we knocked out Nrf2 in the A549 cells in order to further explore the overall influence of the process. We used the CRISPR/Cas9 system that has been reported to efficiently disrupt genes in cells (
We then characterized the function of OPC in A549 cells in which Nrf2 had been knocked out. Note that in the A549 cells in which Nrf2 was knocked out, H2O2-induced cell death was exacerbated (
The increased production of ROS (
Nrf2 is a transcription factor that is activated by increased ROS production, which induces the transcription of several antioxidant and detoxification enzymes, including HO-1, NQO1 and TXNRD1 (
In conclusion, the results obtained in this study demonstrate that the protective effects of OPC against H2O2-induced oxidative stress are dependent on the enhanced activity of Nrf2, which facilitates cells viability even in a highly oxidative environment.
Oligomeric proanthocyanidins (OPCs) alleviate H2O2-induced oxidative stress in A549 cells. A549 cells (A and C) were treated with the indicated concentrations of OPC for 5 h and/or H2O2 for 12 h, and cell survival was examined by MTT assay. (B) Cells were exosed to various concentrations of H2O2 and cell viability was examined. Experiments were repeated 3 times with similar results obtained (same for all figures). For each assay, n=6 (same for all figures). Bars indicate the means ± SD (same for all figures). Effects of OPC on superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px) and malondialdehyde (MDA) levels in H2O2-exposed A549 cells. Cells were pre-treated with 50 mg/l OPC for 5 h and then exposed to 200
Oligomeric proanthocyanidins (OPCs) increase the transcriptional activity of NF-E2-related factor 2 (Nrf2) and the Nrf2-dependent antioxidant response. A549 cells were pre-treated with 50 mg/l OPC for 5 h and then exposed to 200
Generation of NF-E2-related factor 2 (Nrf2) knockout A549 cells using the CRISPR/Cas9 system. (A) The sgRNA (blue) was designed to aim at 20 pairs of bases in exon 3 and exon 4 of Nrf2. (B) Sequences of the wild-type (WT) Nrf2 locus and DSBs induced by Cas9 of Nrf2 locus in 2 established A549 cell lines (Nrf2-KO 4#) 4# and (Nrf2-KO 5#) 5#. Lnes 1, 2, 3 and 6 shown an allele of approximately 1,500 bp. The 4# and 5# cell lines had one allele with >1,100 bp deletion. The PAM sequence is indicated by red color. (C) Allele-specific PCR analysis of Nrf2 genome in A549 cells. (D) Western blot analysis of Nrf2 in A549, 4# and 5# cells.
NF-E2-related factor 2 (Nrf2) mediates oligomeric proanthocyanidins (OPC)-induced antioxidant activity. (A) Effect of OPC on cell viability in 4# and 5# cells. Cells were pre-treated with 1–50 mg/l OPC 5 h and then exposed to 200
Sequence of the primers used in RT-qPCR.
Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
---|---|---|
Nrf2 | GAGACAGGTGAATTTCTCCCAAT | GGGAATGTGGGCAACCTGGG |
HO-1 | CAGGCAGAGAATGCTGATTC | GCTCTTCTGGGAAGTAGACAGG |
NQO1 | AAGAAAGGATGGGAGGTGGT | GCTTCTTTTGTTCAGCCACA |
TXNRD1 | GGAACTAGATGGGGTCTCGG | TCTTGCAGGGCTTGTCCTAA |
β-actin | GATCATTGCTCCTCCTGAGC | ACTCCGCTTGCTGATCCAC |
Nrf2, NF-E2-related factor 2; HO-1, heme oxygenase-1; NQO1, NAD(P)H quinone dehydrogenase 1; TXNRD1, thioredoxin reductase 1.