OPC (purity ≥98%) was purchased from Zelang Biological Technology Co., Ltd. (Nanjing, China). H₂O₂ was obtained from Sigma-Aldrich (St. Louis, MO, USA). RPMI-1640 medium and fetal bovine serum (FBS) were obtained from Gibco Industries, Inc. (Grand Island, NY, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), trypsin, L-glutamate, MK-801 and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich. The DCFH-DA ROS assay kit was purchased from the Beyotime Institute of Biotechnology (Jiangsu, China). GSH-Px, CAT and SOD assay kits were procured from Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). The bicinchoninic acid (BCA) protein reagent was from the Beyotime Institute of Biotechnology Co. Ltd., Shanghai, China).

For this study, A549 cells were obtained from the cell bank of the Chinese Academy of Science (Shanghai, China). The A549 cells were cultured in RPMI-1640 medium supplemented with 10% FBS 2 mM L-glutamine, penicillin (100 U/ml) and streptomycin (100 mg/ml) (Wako, Osaka, Japan). The cells were cultured in a humidified incubator containing 5% CO₂ and 95% air at 37°C. The cells were divided into 3 groups based on the treatments as follows: the control group (cells treated with culture medium), H₂O₂ group (cells exposed to H₂O₂ for 12 h at a final concentration of 200 µM) and the H₂O₂ + group (cells pre-treated with 50 mg/l OPC for 5 h and then exposed to 200 µM H₂O₂ for 12 h). The cells were subjected to the different treatments and were then subjected to serial analyses, including flow cytometry (FCM), MTT, RT-qPCR and western blot analysis.

Cell viability was performed using the MTT colorimetric assay. Following cell treatment, the medium was removed, and the cells were incubated with 20 µl of 5 mg/ml MTT solution for 4 h at 37°C. The dark blue formazan was dissolved with 150 µl of DMSO, and the absorbance was measured at 570 nm using a microplate reader (Multiskan MK3, Thermo Fisher Scientific, Waltham, MA, USA). Cell viability was expressed as a percentage of the untreated controls.

The cells were lysed in RIPA buffer (150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) supplemented with a protease and phosphatase inhibitor cocktail on ice for 15 min, sonicated and centrifuged at 13,000 × g for 15 min. The protein content of the supernatants was measured by BCA reagent (Pierce, Rockford, IL, USA). For the examination of Nrf2 expression, nuclear proteins and cytoplasmic proteins were separated using a Bioepitope Nuclear and Cytoplasmic Extraction kit (Bioworld Technology, St. Louis Park, MN, USA) according to the manufacturer's instructions. Cellular proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes. The membranes were probed with the following primary antibodies (Abs): anti-TXNRD1 (ab16847; 1:1,000; Abcam, Cambridge, MA, USA); anti-Nrf2 (#12721; 1:1,000; Cell Singaling Technology, Danvers, MA, USA); anti-tubulin (ab7291; 1:5,000); anti-HO-1 (ab13248; 1:1,000); lamin B (ab8980; 1:1,000) and anti-NQO1 (ab34173; 1:1,000) (all from Abcam, Cambridge, MA, USA). This was followed by detection using HRP-conjugated secondary antibodies to rabbit IgG (GE Healthcare, Piscataway, NJ, USA).

Total RNA was extracted from the A549 cells using TRIzol reagent and then reverse transcribed into cDNA using the QuantScript reverse transcription kit (Tiangen, Beijing, China) according to the manufacturer's instructions. Amplification was conducted using a SYBR-Green I PCR kit (Roche, Indianapolis, IN, USA). The PCR reaction conditions were as follows: initial denaturation at 95°C for 10 min, followed by 35 amplification cycles of 95°C for 10 sec, 55°C for 10 sec, 72°C for 15 sec, and a final extension at 72°C for 10 min. β-actin was used as an internal reference gene. Relative values for mRNA levels were calculated using the following formula: fold change = 2^−ΔΔCq. The primers used for each gene are listed in Table I.

The cells were incubated with 300 nM dichloro-dihydro-fluorescein diacetate (DCF-DA) (Sigma-Aldrich) for 10 min at 37°C. Following 2 washes in phosphate-buffered saline (PBS)-1X, DCF-DA fluorescence was analyzed using a flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) and FlowJo software.

The A549 cells were plated in 6-well plates at a density of 10×10⁴ cells/ml in 2.5 ml of culture medium. After the cells were treated in accordance with the experimental design, the cells were then harvested, disrupted ultrasonically on ice and centrifuged at 2,500 × g for 10 min at 4°C. The supernatants were collected and stored −20°C for subsequent analysis. The levels of SOD, GSH-Px and CAT were detected using a Wallac 1420 microplate spectrophotometer (Perkin Elmer, Waltham, MA, USA) using commercially available assay kits (Jiancheng Bioengineering Institute) following the manufacturers' instructions.

A reaction mixture containing 0.2 ml cell lysate and 4.2 ml reaction buffer was treated by ultrasound for a certain time using a 22 kHz ultrasound generator (HN-1000Y; Shanghai Hanno Instrument Corp., Shanghai, China) equipped with a tapered horn tip (10-mm end diameter) and boiled for 10 min in water bath, then cooled down and centrifuged at 4,000 rpm for 10 min. the supernatants were measured using a kit purchased from the Nanjing Jiancheng Bioengineering Institute according to the thiobarbituric acid method, which is based on the fact that MDA reacts with thiobarbituric acid to form thiobarbituric acid reactive substances (TBARS) with a maximum absorbance at 530 nm. The experiments were performed in triplicate.

Target sequences for CRISPR interference (20) were designed at CRISPR direct (http://crispr.dbcls.jp/). The target sequences for human Nrf2 were TAGTTCATGAGCGTGA TGAT (exon 3) and TGCCATAATTGTTACACATT (exon 4). Two oligonucleotides with Bbs1 restiction sites for guide RNAs (gRNAs) were synthesized by Shenggong (Shanghai, China) and cloned into the PX330 CRISPR/Cas9 vector (Addgene, Cambridge, MA, USA). The cells were transfected the two PX330 guides and PMT-puro by using PolyJet reagent (Invitrogen, Carlsbad, CA, USA). The cells were selected with 1.5 µg/ml puromycin and stable clones were maintained in 0.5 µg/ml puromycin. The allele-specific primers were designed as follows: forward, GATTCTTGTGAAGCAGTCCAGC and reverse, ATCCAGTGACTTCTTGAATGCTT. Lastly, the potential positive clones from PCR results were selected and this was followed by electrophoresis on a 1% agrose gel. The positive clones will loss about 1000 bp DNA fragment.

First, the cells were spinned down in the PCR plate, and the supernatant was discard, leaving 10 µl medium. The cells were then lysed using single cell lysis buffer (1 mM EDTA, 10% Tween-20) and then boiled at 65 °C for 2 h; 95 °C for 30 min. PCR was then performed with cell lysis buffer and allele-specific primers followed by electrophoresis on a 1% agrose gel. The DNA gel was scanned using a gel imaging system (Tannon 3500R; Tanon Science & Technology Co., Ltd., Shanghai, China).

The NQO1-ARE promoter was cloned into pGL3-Basic (Promega, Madison, WI, USA) vector by standard methods. For the luciferase assay, the A549 cells were transiently transfected with the luciferase construct and β-galactosidase (as an internal control). The cells were transfected using PolyJet reagent (Invitrogen) according to the manufacturer's instructions. Luciferase activity was determined using a luminometer. The medium was removed from the cells, and the cells were then lysed in 100 µl of extraction buffer (100 mM KPO₄, pH 7.4, 4.0 mM ATP, 1.5 mM MgSO₄, 1.0 mM dithiothreitol and 0.1% Triton X-100). Cell lysates (25 µl) were added to 350 µl of luciferase assay buffer (100 mM KPO₄, pH 7.4, 4.0 mM ATP, and 1.5 mM MgSO₄) and then 100 µl of 1.0 mM D-Luciferin was injected into each culture tube using a luminometer that integrated the luminescence over 10 sec. β-galactosidase activity was measured using o-nitrophenyl-β-D-galactopyranoside (ONPG; Sigma-Aldrich) as a substrate. Briefly, the cell lysates were incubated with ONPG (0.4 mg/ml) in reaction buffer (0.1 M sodium phosphate pH 7.5, 10 mM KCl, 1 mM MgCl₂) for 1 h and the absorbance was then measured at 405 nm. The data are expressed as a ratio of luciferase to β-galactosidase activity.

All data are presented as the means ± standard deviation (SD). Statistical analysis was carried out using one-way ANOVA followed by the Scheffe test using SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Statistical significance was set at p<0.05.

We first examined the potential effects of OPC in A549 cells. The resutls of MTT assay for cell survival shown in Fig. 1A demonstrated that the viability of the A549 cells was not significantly decreased when the cells were treated with OPC at the concentration of ≤50 mg/l. However, at the concentration of ≥100 mg/l OPC, A549 cell viability was slightly, but significantly decreased (Fig. 1A). Subsequently, H₂O₂-induced oxidative damage was investigated in the A549 cells by MTT assay. The viability of the A549 cells decreased following exposure to H₂O₂ in a dose-dependent manner. Following 12 h of exposure to 100 µM H₂O₂, cell viability decreased to 70% of the control, whereas 200 µM decreased cell viability to 50% and this concentration was utilized for further experiments (Fig. 1B). Significantly, treatment with OPC at 1–50 mg/l (non-cytotoxic concentrations) markedly attenuated the H₂O₂-induced decrease in A549 cell viability (Fig. 1C). We then examined the effects of OPC on the activities of a series of phase II metabolizing enzymes and antioxidants. The results demonstrated that the enzyme activities of SOD, CAT and GSH-Px were significantly decreased in the H₂O₂-treated A549 cells, and that OPC at 50 mg/l enhanced their activities (Fig. 1D–F). We also determined the contents of ROS and MDA within the A549 cells. We found that the levels of ROS and MDA were significantly elevated in the H₂O₂-exposed cells. Similarly, OPC at 50 mg/l significantly decreased the contents of ROS and MDA (Fig. 1G and H). These results indicated that OPC exerted potent antioxidant effects on H₂O₂-exposed A549 cells.

In order to elucidate the potential mechanisms responsible for the protective effects of OPC against H₂O₂-induced oxidative stress, the A549 cells were exposed to H₂O₂ for 12 h following treatment or not with OPC. We then examined the mRNA and protein expression of Nrf2 and Nrf2 target genes. We found that H₂O₂ increased the mRNA expression of Nrf2 and Nrf2 target genes and this increase was further enhanced by OPC (Fig. 2A). Furthermore, the results of western blot analyses revealed that the nuclear protein expression of Nrf2 was significantly increased by H₂O₂ and OPC; however, the cytoplasmic protein expression of Nrf2 was not altered by H₂O₂ and OPC (Fig. 2B). As regards HO-1, NQO1 and TXNRD1, their protein expression was significantly increased by OPC (Fig. 2C). Subsequently, to investigate the effects of OPC on Nrf2 transcriptional activity under conditions of H₂O₂- induced oxidative stress, the enzymatic activity of NQO1 was also examined. As observed with the mRNA expression of NQO1, which increased following treatment with OPC in the A549 cells, the enzymatic activity of NQO1 was also increased in the A549 cells following treatment with OPC (Fig. 2D). Taken together, these results indicate that OPC promotes the nuclear translocation of Nrf2, leading to the enhanced expression of its target genes implicated in the protective effects of OPC against H₂O₂-induced oxidative stress in A549 cells.

As Nrf2 was above shown to participate in the protective effects of OPC against oxidative stress, we knocked out Nrf2 in the A549 cells in order to further explore the overall influence of the process. We used the CRISPR/Cas9 system that has been reported to efficiently disrupt genes in cells (21). As a result, we obtained 2 Nrf2 knockout A549 clones, 4# and 5#. The DNA sequences of the 2 clones revealed a deletion of the 1173 and 1162 bases in both alleles (Fig. 3A and B). DNA gel-image indicated that Nrf2 deletion >1,000 bases between exon 3 and exon 4 (Fig. 3C). Western blot analysis revealed that Nrf2 was completely knocked out in the 2 clone cells by the absence of Nrf2 expression (Fig. 3D).

We then characterized the function of OPC in A549 cells in which Nrf2 had been knocked out. Note that in the A549 cells in which Nrf2 was knocked out, H₂O₂-induced cell death was exacerbated (Fig. 4A), indicating that OPC exerts its protective effects via basal Nrf2. The results shown in Fig. 2A and C demonstrated that the mRNA and protein expression levels of HO-1, NQO1 and TXNRD1 were significantly increased following treatment with OPC. However, the antioxidant activity was almost abolished with Nrf2 knockout (Fig. 4D–F). OPC was almost ineffective against H₂O₂-mediated SOD, CAT and GSH-Px activity when Nrf2 was knocked out (Fig. 4D–F). This finding suggested that OPC protected the A549 cells against H₂O₂-induced oxidative stress via the Nrf2-ARE pathway.