Cell lines and cell culture
An H460 human lung cancer cell line was obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were maintained in Dulbeccos modified Eagles medium (DMEM; Beyotime Institute of Biotechnology, Beijing, China), supplemented with 10% fetal bovine serum (FBS; Gibco Life Technologies, Carlsbad, CA, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (Beyotime Institute of Biotechnology), in a humidified incubator with 5% CO2 at 37°C.
Generation of the rAd5-siTrop2 RNA interference lentiviruses
Following the evaluation of the knockdown efficiencies of a number of small interfering RNA (siRNA) constructs, the following siRNA oligonucleotide (rAd5-siTrop2-siRNA) was selected to target the 21-bp interference sequence of the Trop2 gene: 5′-CTC CAA GTG TCT GCT GCT CAA-3′. The rAd5-siTrop2-siRNA sequences were as follows: Sense, 5′-ACACTTGGAGGTTTTGGCCACTGACTGACT CCAAGCTGCTGCTCAA-3′, and antisense, 3′-CCTGTT GAGCAGCAGACTTGGAGGTCAGTCAGTGGCCAAAAC CTCCAAGTGTCTGCTGCTCAAC-5′. In addition, a non-specific siRNA (rAd5-siCtrl-siRNA) was synthesized as a native control. Sequences were chemically synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). H460 cells were seeded into six-well plates at a density of 2×105 cells/well, and transfection was performed using electroporation (Gene Pulser MXcell™ Electroporation system; Bio-Rad Laboratories, Inc., Munich, Germany). Three groups were generated for the ensuing experiments, which included the Ctrl group (non-transfected group), rAd5-siCtrl group (cells infected with non-specific siRNA) and rAd5-siTrop2 group (cells infected with rAd5-siTrop2-siRNA). The cells were harvested for the subsequent experiments at 72 h post-transduction.
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
The sequences of the primers used for PCR were as follows: Trop2 forward, 5′-CCT CAT CGC CGT CAT CGT-3, and reverse, 5′-CGG TTC CTT TCT CAA CTC CC-3′; β-actin forward, 5′-CCT GGC ACC CAG CAC AAT-3′, and reverse, 5′-GCC GAT CCA CAC GGA GTA CT-3′. Primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China). The expression levels of Trop2 were quantified using fluorescence RT-qPCR. Following the termination of each experiment, the cells were collected and the total RNA was isolated using TRIzol® reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). cDNA was synthesized using a reverse transcription kit (Toyobo Co., Ltd., Osaka, Japan), according to the manufacturer's instructions. cDNA (2.5 µl) was subjected to qPCR using SYBR-Green (Wuhan Boster Biological Engineering Co., Ltd., Wuhan, China) as the fluorescent reporter and 2.5X Real Master Mix (Wuhan Boster Biological Engineering Co., Ltd.). The specific gene primers for Trop2 and β-actin were amplified in separate reaction tubes, as described previously (19). Threshold cycle numbers of triplicate reactions were determined using ABI 7500 software (Applied Biosystems Life Technologies, Foster City, CA, USA) and the average was calculated. For each reaction, β-actin was included as an internal standard and the relative quantitative gene expression level was calculated using the 2−ΔΔCt method.
Western blot analysis
Cells (1×106) were lysed on ice with 100–200 µl lysis buffer (Beyotime Institute of Biotechnology) for 5 min. Following lysis the samples were centrifuged at 400 × g for 5 min, and cell extracts from the Ctrl, rAd5-siCtrl and rAd5-siTrop2 groups were collected. Subsequently, 50 µg protein samples were electrophoresed on 12% SDS-polyacrylamide gels and transferred onto polyvinylidene fluoride membranes (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). The membranes were blocked in 5% non-fat dry milk in Tris-buffered saline (TBS) for 1 h at room temperature, followed by incubation with various primary antibodies, including mouse monoclonal anti-human Trop2 (sc-80406; 1:1,000), mouse monoclonal anti-human cyclin D1 (sc-56302; 1:1,000) and rabbit anti-human-p-ERK-1 antibodies (sc-16982; 1:1,000; Santa Cruz Biotechnology, Inc.), overnight at 4°C. Following three washes with TBS-Tween-20 (TBST), the membranes were incubated with 50 µl horseradish peroxidase-conjugated IgG secondary antibody for 2 h at room temperature. The secondary antibodies used included peroxidase-labeled goat anti-rabbit IgG (BA1055) and rabbit anti-mouse IgG (BM2002; 1:2,000; Wuhan Boster Biological Engineering Co., Ltd.). In addition, each membrane was incubated with a mouse monoclonal anti-GAPDH antibody (sc-47724; Santa Cruz Biotechnology, Inc.) as a loading control. The membranes were washed three times with TBST, and bound antibodies were detected using enhanced chemiluminescence analysis (Beyotime Institute of Biotechnology, Haimen, China). The protein expression levels were quantitated via densitometry using Quantity One software (Bio-Rad Laboratories, Inc.).
Proliferation assay
Cell proliferation was evaluated using an MTT assay on days 1, 3 and 6. Cells from the three groups were plated onto 96-well plates (2,000 cells/well) and incubated with 20 µl MTT (5 mg/ml; Sigma-Aldrich, St. Louis, MO, USA) for 4 h prior to collection. Subsequently, the culture medium was removed and 150 µl dimethyl sulfoxide was added to the wells. Following vigorous shaking for 10 min, the absorbance at 490 nm was measured using an enzyme immunoassay instrument (ETI-MAX3000; DiaSorin S.p.A, Saluggia, Italy). Six wells were analyzed for each group.
Transwell assay
Cell invasion was determined using a Transwell assay (Wuhan Boster Biological Engineering Co., Ltd.). Oligonucleotides were transfected into the cells according to the manufacturers instructions. Following incubation for 48 h, 3×104 cells were transferred onto the top of the Matrigel-coated invasion chambers (BD Biosciences, San Jose, CA, USA) in serum-free DMEM, while DMEM containing 10% FBS was added to the lower chamber. After 24 h, the non-invasive cells were removed, while the invasive cells were fixed with 95% ethanol, stained with 0.1% crystal violet (Nanjing Search Biotech, Co., Ltd., Nanjing, China) and photographed (magnification, ×100; DM3000; Leica Microsystems, Mannheim, Germany). Each test consisted of three independent experiments.
Statistical analysis
Statistical analysis was performed using SPSS software, version 13.0 (SPSS, Inc., Chicago, IL, USA). All experiments were performed at least three times, and representative results are presented as the mean± standard deviation. Statistical analyses were performed using one-way analysis of variance, and comparisons among groups were conducted using the independent samples t-test, where P<0.05 was considered to indicate a statistically significant difference.