The incidence and recurrence rates of ovarian cancer are still high, and once the disease metastasizes, it is nearly always fatal. Cullin 4A (CUL4A) serves a significant role in tumourigenesis and tumour progression; however, the effect and mechanisms underlying CUL4A overexpression are still unknown. The role of microRNAs (miRs) in the regulation of metastatic capability in ovarian cancer cell lines was investigated. The interaction between miR-377 and CUL4A was investigated using bioinformatics analyses and dual-luciferase reporter assays. Furthermore, miR-377 mRNA and protein levels were detected using reverse transcription-quantitative polymerase chain reaction and western blotting, respectively and cell migration and invasion were detected using a Transwell assay. Results revealed that CUL4A expression was negatively associated with miR-377 levels in ovarian cancer tissues and cell lines. Through
According to a previous study, ovarian cancer still remains the fifth-leading cause of mortality in women, with approximately 22,280 newly diagnosed cases and 14,240 mortalities reported in 2016 worldwide (
Previously, the use of miRNAs as a novel effective target in cancer therapy has been extensively reported (
Cullin (CUL) 4A, which was demonstrated to be one of the target genes of miR-377 in the present study, belongs to the family of Cullin-Ring E3-ligases (CRLs) and serves a key role in tumorigenesis and tumor progression (
A total of 44 ovarian cancer patients in the Third Affiliated Hospital of Wenzhou Medical University were included in the present study. During the period from February 2015 to March 2016, all cancer specimens were obtained from surgical tumor resections, and their adjacent normal ovarian tissue specimens were collected at the same time, as negative controls. The normal and cancer tissues represented matched pairs from each patient. Basic clinical and pathological data of these patients at the average age of 51.12±16.35 were collected with their written informed consent forms. The present study was approved by the ethics committee of the Third Affiliated Hospital of Wenzhou Medical University (Wenzhou, China).
Normal ovary cell line (IOSE80) and seven ovarian cancer cells lines including CAOV3, SKOV3, A2780, OVCAR3, HO-8901, 3AO and TC-1 were all obtained from Shanghai Bogoo Biotechnology Co. Ltd. (Shanghai, China). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (Thermo Fisher Scientific Inc, Waltham, MA, USA) at 37°C in 5% CO2 incubator. Medium was replaced once every two days. Cell passage cultivation was performed when cells grew to 90% confluency.
One cell line from six ovarian cancer cell lines was selected based on the expression of the miR-377 and CUL4A levels for the primary
To analyze the role of miRNA-377 in ovarian cancer, prediction of its target genes was carried out using the prediction software miRanda (
CUL4A 3′-UTR and mutated CUL4A 3′-UTR were prepared by GeneCopoeia Inc. (Rockville, MD, USA). The 3′-UTR fragment of CUL4A with the binding site for miR-377 mimic and inhibitor was amplified via polymerase chain reaction (PCR) with the primer sequences presented in
Cell viability in control, mock, and mimic groups was measured using the CCK-8 assay (Beyotime Institute of Biotechnology, Shanghai, China). Cells were seeded into a 96-well plate (100
SKOV3 cells (5×105 cells/ml) were seeded in the upper well of a Transwell migration system on ThinCerts™ inserts with 8-
Quantification of miR-377 was carried out using TaqMan miRNAs assay (Thermo Fisher Scientific Inc). The PCR conditions included activating the DNA polymerase at 95°C for 15 min, followed by 40 cycles of three-step PCR (94°C for 15 sec, 55°C for 30 sec, and 70°C for 30 sec). Reverse transcription of 10 ng template RNA was performed with a TaqMan MicroRNA Reverse Transcription kit and miRNA-specific stem-loop primers (
To determine mRNA levels of CUL4A, β-catenin, Wnt3a, cyclin D1, matrix metalloproteinases (MMP)-2 and -9, metastasis-associated protein (MTA)-1, and metallopeptidase inhibitor (TIMP), total RNA was firstly reverse transcribed using the Takara PrimeScript RT reagent kit (Takara Bio, Inc., Otsu, Japan). Quantification of mRNA was carried out by TaqMan Gene Expression Assay (Thermo Fisher Scientific Inc, USA). PCR was carried out by activating the DNA polymerase at 95°C for 10 min, followed by 40 cycles of two-step PCR (95°C for 15 sec and 60°C for 45 sec). Target gene expression was normalized to GAPDH expression. Primer sequences were listed as follows: CUL4A forward, 5′CAAGAACTTCCGAGACAGACC3′ and reverse, 5′TGCTTGTAGAGCATTGGGGA3′; β-catenin forward, 5′TATAAGAGCTCCTTGTGCGGC3′ and reverse, 5′CTGAAGCTGCTCCTCAGACC3′; Wnt3a forward, 5′CTGGAGCTAGTGTCTCCTCTCT3′ and reverse, 5′GGAAGAAGCCTCATCCACCA3′; cyclin D1 forward, 5′CAATGACCCCGCACGATTTC3′ and reverse, 5′AAGTTGTTGGGGCTCCTCAG3′; MMP-2 forward, 5′TGTGTTGTCCAGAGGCAATG3′ and reverse, 5′ATCACTAGGCCAGCTGGTTG3′; MMP-9 forward, 5′TTTGAGTCCGGTGGACGATG3′ and reverse, 5′GCTCCTCAAAGACCGAGTCC3′; MTA1 forward, 5′AAACTGCCCTGAGTGTGGT3′ and reverse, 5′AAATATGTTGACCCAGCTCATCT3′; TIMP1 forward, 5′GCCTGACGGTCATATGGTAGA3′ and reverse, 5′GAATGCGCCAAAAACCCCAT3′ and GAPDH forward, 5′GAATGGGCAGCCGTTAGGAA3′ and reverse, 5′AAAAGCATCACCCGGAGGAG3′. The 2−ΔΔCq method was performed for the quantification of gene expression data (
Total protein of cells in each group was extracted using the ProteoPrep® Total Extraction Sample kit (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Cell lysates were prepared with the cell lysis buffer (Beyotime Institute of Biotechnology). Following centrifugation (12,000 × g) at 4°C for 10 min, the supernatant was collected. Concentration of the protein was determined by Bradford assay (Bio-Rad Laboratories, Inc.). A total of 30 mg of each protein sample were separated on 10-15% SDS-PAGE (Merck KGaA, Darmstadt, Germany). The membranes were blocked using 5% fat-free milk in TBST at room temperature for 1 h. Membranes were incubated with primary antibodies at 4°C for 6 h and then at room temperature for 4 h. The primary specific antibodies used were anti-CUL4A (catalog no. ab72548; 1:1,000; Abcam, Cambridge, MA, USA), anti-β-catenin (catalog no. ab32572; 1:5,000; Abcam), anti-Wnt3a (catalog no. ab19925; 1:1,000; Abcam), anti-cyclin D1 (catalog no. ab134175; 1:10,000; Abcam), anti-MMP2 (catalog no. ab92536; 1:1,000; Abcam), anti-MMP9 (catalog no. ab38898; 1:1,000; Abcam), anti-MTA1 (catalog no. ab71153; 1:2,000; Abcam) and anti-GAPDH (catalog no. ab8245, 1:2,000; Abcam). The membranes were incubated with the following secondary antibodies at room temperature for 1 h: Goat anti-mouse IgG H&L (catalog no. ab6789; 1:2,000; Abcam), goat anti-rabbit IgG H&L (catalog no. ab6721; 1:2,000; Abcam) and donkey anti-goat IgG H&L (catalog no. ab6885; 1:2,000; Abcam). Blots were visualized using enhanced chemiluminescence (Thermo Fisher Scientific, Inc.). Densitometry of the bands was performed using Quantity One software, version 4.6.9 (Bio-Rad Laboratories, Inc.).
Statistical analysis was performed using SPSS software, version 22.0 (IBM Corp., Armonk, NY, USA). Each experiment was repeated three times, and data are presented as the mean ± standard deviation. Student's t-test and one-way analysis of variance, followed by Tukey and Bonferroni post-hoc tests were used in either two or multiple group comparisons, for statistical significance. Spearman's nonparametric correlation test was used to analyze the correlations between the miR-377 and CUL4A mRNA levels in tissue samples. The Chi squared test was used for analysis of the significance of CUL4A to clinicopathological characteristics. The method of survival analysis was used for testing divided phases. P<0.05 was considered to indicate a statistically significant difference.
The present study included a total of 44 patients at the average age of 51.12±16.35 (
Decreased miR-377 expression along with increased CUL4A expression was also detected in seven ovarian cancer cell lines including CAOV3, SKOV3, A2780, OVCAR3, HO-8901, 3AO and TC-1, compared with in the normal cell line IOSE80, however this difference was most evident in SKOV3 cells (P<0.05;
Based on literature review, of the 52 predicted target genes, CUL4A was selected as it has been previously demonstrated to highly implicated in tumor progression and patient survival (
A luciferase reporter involving the human CUL4A-3′ UTR was applied to identify if miR-377 interacted directly with the CUL4A-3′ UTR. Luciferase activity was tested 24 h following transfection of SKOV3 cells with the reporter miR-377 overexpression and inhibition constructs. In the assay system, a reduction in luciferase expression revealed a specific miR-377-3′ UTR interaction. It was demonstrated that luciferase activity was significantly decreased in miR-377 overexpressed cells; in particular, in the miR-377 mimics + CUL4A-WT group, the luciferase expression was reduced to one fifth of the level in the control group (P<0.01;
As presented in
The effects of miR-377 mimics on biological processes in SKOV3 cells were next investigated, including cell viability, migration, and invasion (
β-catenin, Wnt3a, and cyclin D1 are three key components in the Wnt/β-catenin signaling pathway (
Subsequently, the influence of miR-377 overexpression on tumor metastasis-associated genes including MMP-2 and 9, MTA1 and TIMP2 was assessed. MMPs and TIMPs serve important roles in extracellular matrix turnover (
The expression of miR-377 is silenced in a number of human malignancies, which has been verified in previous studies (
There is a general lack of information regarding target genes of miR-377. A previous study demonstrated that miR-377 targets frizzled class receptor 4, which is required for epithelial-mesenchymal transition (EMT) and metastasis in prostate cancer cells (
It was demonstrated that EMT is an essential process for the metastasis of cancer cells (
A number of signal transduction pathways, including transforming growth factor-β, mitogen activated protein kinase, Notch and Wnt, participate in the process of EMT of tumour cells (
In the Wnt/β-catenin signaling pathway, Wnt3, a secretory protein of the pathway, is the promoter, and β-catenin, an important regulatory factor that conducts signals from the cell membrane or cytoplasm to the cell nucleus, is the executor of the regulatory function on its downstream targets. Cyclin D1, one of its targets, is a key intranuclear transcription factor that regulates the cell cycle (
MMP2, together with MMP9, is able to degrade type IV collagen, and degradation of the basement membrane allows cancer cells to migrate out of the tumour, resulting in metastasis (
In conclusion, the results of the present study suggested that miR-377 acted as a negative regulator of CUL4A, which resulted in reduced cancer cell viability and migration in an ovarian cancer cell line. It was then hypothesized that downregulation of miR-377 in ovarian cancer may promote tumorigenesis and metastasis through activation of CUL4A expression, however further
Not applicable.
No funding was received.
The analysed data sets generated during the study are available from the corresponding author on reasonable request.
RY and YC conceived and designed the study. XD analyzed and interpreted the patient data regarding the relationship of miR-377 and CUL4A expression in ovarian cancer tissues. LC and XW performed the cell experiments to investigate the role of miR-377 in metastatic capability regulation. RY was a major contributor in writing the manuscript. All authors read and approved the final manuscript.
The present study was approved by the ethics committee of the Third Affiliated Hospital of Wenzhou Medical University (Wenzhou, China). Written informed consent was obtained.
Not applicable.
The authors declare that they have no competing interests.
The expression levels of miR-377 and CUL4A in ovarian cancer tissues and cell lines (CAOV3, SKOV3, A2780, OVCAR3, HO-8901 and 3AO) were assessed. (A) miR-377 levels were decreased in cancer tissues compared with their adjacent normal tissues, whereas (B) mRNA levels of CUL4A were elevated. (C) Linear correlation of mRNA levels between miR-377 and CUL4A were assessed. Survival analysis demonstrated that ovarian cancer patients with (D) increased level of CUL4A and (E) decreased level of miR-377, lived shorter that the patients with decreased CUL4A and increased miR-377 expression level, respectively. (F) The miR-377 level was significantly lower in ovarian cancer cells compared with normal cells (IOSE80), whereas (G) mRNA levels of CUL4A were greater in ovarian cancer cells compared with normal cells (IOSE80). Data are expressed as the mean ± standard deviation from three independent experiments. **P<0.01 vs. IOSE80 normal cells. CUL4, cullin 4A; miR, microRNA.
Target genes of miR-377 identified through bioinformatic and luciferase reporter analysis. (A) A total of 52 reliable target genes of miR-377 were discovered through intersection calculation of predicted target genes from miRanda, miRDB, PicTar and TargetScan. (B) Gene ontology analysis of gene function revealed 28 annotations of miR-377-associated biological processes, genes were enriched in processes of regulation of gene expression, cell proliferation and signal transduction. (C) Cervical-loop structures of pre-miR-377. (D) Mature hsa-miR-377 (miR-377) was predicted to interact with the CUL4-3′ UTR from positions 319 to 349 via a 7-mer seed match interaction. (E) Relative luciferase activity demonstrated that miR-377 reduced luciferase reporter activity. Data are expressed as the mean ± standard deviation from three independent experiments. *P<0.05 and **P<0.01 vs. control. CUL4, cullin 4A; miR, microRNA; mut, mutant; WT, wild type; UTR, untranslated region.
miR-377 overexpression affects cell viability, migration and invasion. (A) Ectopic miR-377 expression decreased the (B) CUL4A mRNA level. (C) The expression of CUL4A protein was inhibited by miR-377 mimics. (D) miR-377 overexpression decreased the viability of SKOV3 cells. miR-377 attenuated (E) cell migration and (F) cell invasion rates in SKOV3 cells (magnification, ×100). Data are expressed as the mean ± standard deviation from three independent experiments. *P<0.05 and **P<0.01 vs. control, ^P<0.05 and ^^P<0.01 vs. mock. CUL4, cullin 4A; miR, microRNA.
miR-377 overexpression inhibits Wnt/β-catenin signaling pathway. Ectopic miR-377 expression inhibited the mRNA levels of (A) β-catenin, (B) Wnt3a and (C) cyclin D1 and (D) protein levels of β-catenin, Wnt3a and cyclin D1 were reduced in miR-377 overexpression cells. Data are expressed as the mean ± standard deviation from three independent experiments. *P<0.05 and **P<0.01 vs. control, ^P<0.05 vs. mock. CUL4, cullin 4A; miR, microRNA.
miR-377 overexpression influences the expression of MMP-2, MMP-9, MTA1 and TIMP2. Aberrant miR-377 level downregulated the expression of (A) MMP-2, (B) MMP-9 and (C) MTA1 mRNA, however upregulated (D) TIMP2 mRNA expression levels. (E) MMP-2, MMP-9 and MTA1 protein expression levels were decreased whereas TIMP2 protein expression was elevated in the miR-377 mimics group. Data are expressed as the mean ± standard deviation from three independent experiments. *P<0.05 and **P<0.01 vs. control, ^P<0.05 and ^^P<0.01 vs. mock. MTA, metastasis-associated protein; miR, microRNA.; MMP, matrix metalloproteinase; TIMP, metallopeptidase inhibitor.
Sequence of miR-377 mimics and inhibitor.
Name | Direction | Sequence (5′-3′) |
---|---|---|
miR-377 mimics | Forward | TGCTGATCACACAAAGGCAACTTTTGTGTTTTGGCCACTGACT |
GACACAAAAGTCCTTTGTGTGAT | ||
Reverse CC | TGTAGTGTGTTTCCGTTGAAAACACAAAACCGGTG | |
ACTGACTGTGTTTTCAGGAAACACACTA | ||
miR-377 inhibitor | Forward | TGCTGGGAAGTCATACAATCCTACA |
TTGTTTTGGCCACTGACTGACAATGTAGGTGTATGACTTCC | ||
Reverse CC | TGCCTTCAGTATGTTAGGATGTAACAA | |
AACCGGTGACTGACTGTTACATCCACATACTGAAGG | ||
miR-377 UTR | AUCACACAAAGGCAACUUUUGU | |
CUL4A UTR | UGGUUUGUU-CUCGUGUGUGAU |
miR, microRNA; UTR, untranslated region; CUL, cullin.
Association between CUL4A and clinical data of ovarian cancer patients.
Cancer stage | Age (<45/≥45) | CUL4A expression |
---|---|---|
TNM | ||
I | 6/8 | 9/5 |
II | 4/8 | 3/9 |
III | 7/11 | 4/14 |
P-value | 0.883 | 0.031 |
P<0.05, Chi-square test; CUL, cullin.