Ashwagandha roots were a kind gift from Dr Reiji Nishio (Toray Industries, Inc., Tokyo, Japan). Lipopolysaccharide (LPS) and MTT were purchased from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). Primary antibodies for p38 (cat. no. 9212S), phosphorylated (P)-p38 (cat. no. 9211S), c-Jun N-terminal kinase (JNK) (cat. no. 9252S), P-JNK (cat. no. 9251S), extracellular signal-regulated kinase (ERK) (cat. no. 9102S), P-ERK (cat. no. 9101S), nuclear factor (NF)-κB, p65 (cat. no. 4764S), histone H3 (cat. no. 9715) and β-actin (cat. no. 4967S) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). TNF-α polyclonal antibody (bs-2081R) was purchased from Bioss Antibodies, Inc. (Woburn, MA, USA). TGF-β1 polyclonal antibody (cat. no. 5559-100) was purchased from BioVision, Inc. (Milpitas, CA, USA). Horseradish peroxidase-conjugated goat anti-rabbit IgG (cat. no. 7074) (Cell Signaling Technology, Inc.) was used as a secondary antibody. Medatomidine hydrochloride and atipamezole hydrochloride were purchased from Wako Pure Chemical Industries, Ltd. Vetorphale was purchased from Meiji Seika Kaisha, Ltd. (Tokyo, Japan) and midazolam was purchased from Sandoz (Tokyo, Japan).

Several root pieces from different Ashwagandha roots were cut and powdered with ceramic mortar, and then added to Milli Q water (5 g powder in 50 ml water). After 2 h of heating with an electric heater (Tokyo Technological Laboratories, Tokyo, Japan) at 100°C, the extract was passed through a paper filter (GE Healthcare Life Sciences, Little Chalfont, UK). Following centrifugation at 180 × g for 5 min, the supernatants were filtered with a 0.2 μm filter (Sartorius AG, Goettinggen, Germany) and stored at −80°C until use. The final concentration of ASH-WEX was 100 mg/ml. ASH-WEX was diluted with Dulbecco's modified Eagle medium (DMEM; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) or Milli Q prior to its use in the treatment of HaCaT cells or mouse skin, respectively.

The human keratinocyte cell line HaCaT was provided by Professor P. Boukamp and Dr N. Fusenig (German Cancer Research Center, Heidelberg, Germany) (14) and cultured in DMEM supplemented with 10% fetal bovine serum (FBS; Biofill, Victoria, Australia), 100 U/ml penicillin and 100 μg/ml streptomycin at 37°C in a humidified chamber under an atmosphere of 95% air and 5% CO₂.

A total of 18 six-week-old male C57BL/6J mice (weight, ~20 g) were purchased from Tokyo Laboratory Animals Science Co., Ltd. (Tokyo, Japan). The mice were given ad libitum access to standard chow and water, and housed in our departmental animal room under specific pathogen-free conditions. All animals were kept in a controlled environment for 1 week prior to experiments and all experimental procedures were approved by the Tokyo Denki University Animal Care and Use Committee in accordance with their Ethical and Animal Experiment Regulations.

Cell viability was evaluated by MTT assay. HaCaT cells (1×10⁴ cells/well) were cultured in 96-well plates for 24 h (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and then treated with different concentrations of ASH-WEX for 24 h. Cells were then incubated with 10 μl of 5 mg/ml MTT for 1 h at 37°C. Finally, the supernatants were discarded and DMSO (100 μl/well) was added to dissolve MTT formation. The absorbance was measured with a microplate reader (Awareness Technology, Palm City, FL, USA) at 570 nm.

HaCaT cells (1×10⁶ cells/dish) were incubated in a dish (diameter, 100 mm) for 24 h and then treated with ASH-WEX (0.25 or 1,5 mg/ml) for 24 h, and total RNA was isolated by TRIzol (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. PrimeScript Reverse Transcriptase (Takara Bio, Inc., Kusatsu, Japan) was used for the reverse transcription reaction. In brief, 2.5 μl of Milli Q, 2 μl of 5X PrimeScript buffer, 2 μl of 2.5 mM dNTP, 2 μl of 2.5 μM Oligo dT (Sigma-Aldrich; Merck KGaA), 0.25 μl of PrimeScript, 0.25 μl of recombinant RNase inhibitor and 1 μl of isolated RNA (1 μg/μl) were combined as a single sample, incubated at 42°C for 30 min and 70°C for 15 min, and placed in short-term storage at 4°C in a thermal cycler (ASTEC, Shime, Japan). Reverse transcriptase-generated complementary DNA encoding IL-1β, IL-6, IL-8, IL-12, TNF-α, and transforming growth factor (TGF)-β1 genes were amplified by PCR using the following specific primers: IL-1β forward, GCTGAGGAAGATGCTGGTTCand reverse, TCCATATCCTGTCCCTGGAG; IL-6 forward, CCTGAACCTTCCAAAGATGGC and reverse, TTCACCAGGCAAGTCTCCTCA; IL-8 forward, GTCCTTGTTCCACTGTGCCTand reverse, GCTTCCACATGTCCTCACAA; IL-12 forward, GATGGCCCTGTGCCTTAGTAand reverse, TCCATATCCTGTCCCTGGAG; TNF-α forward, TCCTTCAGACACCCTCAACC and reverse, TCCTTCAGACACCCTCAACC; TGF-β forward, CCCTGGACACCAACTATTGC and reverse, GTCCAGGCTCCAAATGTAGG; and GAPDH forward, ATCATCAGCAATGCCTCCTG and reverse, GTGCTTCACCACCTTCTTGA. In brief, a reaction solution [12.5 μl of 2X GeneAce SYBR qPCR Mix α (Wako Pure Chemical Industries, Ltd.), 0.5 μl of each primer, Milli Q, and 2.5 μl of cDNA sample] was dispensed into optical 96-well reaction plates (Applied Biosystems; Thermo Fisher Scientific, Inc.), and set in an ABI PRISM 7000 (Applied Biosystems; Thermo Fisher Scientific, Inc.). Then, amplification consisted of 1 cycle at 95°C for 10 min, followed by 45 cycles at 95°C for 30 sec and 60°C for 1 min, with a final dissociation stage at 95°C for 15 sec, 60°C for 20 min, and 95°C for 15 sec. Relative fold changes in mRNA expression were calculated using the 2^−ΔΔCq method, according to Livak and Schmittgen (15).

HaCaT cells (1×10⁶ cells/dish) were incubated in a dish (diameter, 100 mm) for 24 h and then pretreated with ASH-WEX (5 mg/ml) for 20 h, followed by 4 h incubation with LPS (1 μg/ml). To examine the mitogen-activated protein kinase (MAPK) pathway, total proteins were extracted with lysis buffer (50 mM HEPES, 150 mM NaCl, 10% glycerol, 1% Triton-X 100, 1.5 mM MgCl₂, 1 mM EGTA, 1 mM sodium orthovanadate, 1% protease inhibitor cocktail; pH 7.5) and western blot was performed as previously described (16). To investigate the NF-κB translocation to the nucleus, the nuclear fractions were prepared as previously described (17) with slight modifications. HaCaT cells (1×10⁶ cells/dish) were incubated a dish (diameter, 100 mm) for 24 h and then pretreated with ASH-WEX for 20 h, followed by 4 h incubation with LPS (1 μg/ml). After the cells were collected and washed with PBS, the pellets were resuspended in 100 μl of buffer A [10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.4% (v/v) NP-40, 1% protease inhibitor; pH 7.9] and incubated on ice for 10 min. Following centrifugation at 15,000 × g for 3 min, the supernatant was collected as a cytosolic fraction. The remaining pellets were washed with buffer A, resuspended in 60 μl of buffer B (20 mM HEPES, 0.4 M NaCl, 1 mM EDTA, 10% glycerin, 1% protease inhibitor; pH 7.9) and stirred at 4°C for 2 h. The supernatants were collected as a nucleic fraction following centrifugation at 15,000 × g at 4°C for 3 min. Protein concentrations were determined using a BCA protein assay kit (Thermo Fisher Scientific, Inc.). For each sample, 20 μg of protein was subjected to 12% polyacrylamide gel electrophoresis, and then transferred to a polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were incubated in blocking solution (3% non-fat skimmed milk) for 1 h, and then probed with primary antibodies (1:1,000) at 4°C overnight. After washing with 0.1% Tween 20-PBS, the membrane was incubated with secondary antibody (1:2,000) for 1 h at room temperature. Finally, the membranes were visualized with enhanced chemiluminescence reagents (Pierce ECL Western Blotting Substrate; Thermo Fisher Scientific, Inc.) following exposure for 1 min, and observed with an Image Quant LAS-4000 system (GE Healthcare Life Sciences). The relative density of bands was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

The anti-inflammatory effect of ASH-WEX in vivo was investigated using 7-week-old male C57BL/6J mice. The back of each mouse was shaved under anesthesia (mixed anesthesia of 0.75-mg/kg bw medatomidine hydrochloride, 4-mg/kg bw midazolam, and 5-mg/kg bw vetorphale in physiological saline and antagonist of 0.75-mg/kg bw atipamezole hydrochloride in physiological saline) (18), and a 0.5-cm diameter wound area was excised on both sides of the back using a dermal punch (Nipro, Osaka, Japan), for initiation of an inflammatory response. Each mouse was topically treated with Milli Q on one side (20 μl; control side) and with ASH-WEX on the other side (20 μl; 10 mg/ml; treatment side). Following treatment, two types of tape (Tegaderm Roll 16006S, 3M Health Care, Tokyo, Japan; Dressing tape, Kyowa, Osaka, Japan) were placed at the sites, in order to avoid direct contact with the wound and to prevent evaporation. The tapes were peeled off gently and changed following topical treatment. Each mouse was housed separately, and treated every 24 h. The day when the wounds were made and treated with ASH-WEX or Milli Q was designated as day 0. The wounds were scanned and photographed prior to treatment and every day, until day 11. Wound closure was calculated as follows: wound closure of Day n=Day n wound area/Day 0 wound area. The weight of each mouse was measured every day following treatment, with a Table Top High Precision Balance (A&D Company, San Jose, CA, USA). Relative wound closure, expressed as the wound size ratio of day n/day 0, was quantified using ImageJ software.

To investigate cytokine expression, mice were sacrificed on day 5, and a 1×1 cm area of injured skin was removed and used for RNA extraction. Total RNA was isolated by TRIzol (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. Following reverse transcription, RT-qPCR was performed, as aforementioned. The following primers were used: TNF-α forward, CCACCACGCTCTTCTGTCTA and reverse, CACTTGGTGGTTTGCTACGA;TGF-β forward, TTGCTTCAGCTCCACAGAGA and reverse, TGGTTGTAGAGGGCAAGGAC; and GAPDH forward, AACTTTGGCATTGTGGAAGG and reverse, ACACATTGGGGGTAGGAACA.

Seven-week-old male C57BL/6J mice were treated with ASH-WEX or Milli Q as described above. On day 5, six mice were sacrificed and a 1×1 cm area including the entire wound and surrounding unwounded skin were collected for H&E staining. Mouse skin samples were fixed in 4% paraformaldehyde at 4°C for 72 h. The samples were dehydrated and embedded in paraffin and skin sections were cut at a thickness of 5 μm. Following deparaffinization and rehydration, the samples were stained with H&E and the epidermal and dermal thicknesses were measured by ImageJ. Digital images were captured with an Olympus BX51 microscope (Olympus Corporation, Tokyo, Japan) and DP714 digital camera (Olympus Corporation).

The Student's t-test was used to compare paired groups. One-way analysis of variance was used for multi-group analysis, followed by Bonferroni test as a post hoc test (Prism 7, ver. 7.0d, GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Cells of the human keratinocyte line HaCaT have features similar to normal human cells, and thus are widely applied in inflammatory skin-related research. In the present study, HaCaT cells were used to investigate the anti-inflammatory effects of ASH-WEX. To determine whether ASH-WEX may have a toxic effect on HaCaT cells, an MTT assay was performed. The results demonstrated that ASH-WEX was not toxic to HaCaT cells up to a dose of 10 mg/ml (Fig. 1).

Cytokines released from keratinocytes have vital roles in many inflammation-related skin diseases (19). In order to examine whether ASH-WEX might regulate the cytokine expression in keratinocytes, the expression levels of several cytokines were examined in HaCaT cells treated with ASH-WEX by RT-qPCR. The results demonstrated that, when cells were treated with ASH-WEX at concentrations <5 mg/ml which were non-toxic in HaCaT cells (Fig. 1), the mRNA expression levels of the inflammatory cytokines IL-8, IL-6 and IL-12 were significantly decreased in a dose-dependent manner (Fig. 2A). The mRNA levels of TNF-α and IL-1β also appeared decreased, although this effect was less significant (Fig. 2A). By contrast, treatment with ASH-WEX at concentrations <5 mg/ml significantly increased the mRNA expression levels of the anti-inflammatory cytokine TGF-β1 in a dose-dependent manner (Fig. 2B). These results indicated that ASH-WEX might have an anti-inflammatory effect on keratinocytes.

HaCaT cells possess Toll-like receptor (TLR) 2 and TLR4 (20), and the expression of pro-inflammatory cytokines, including IL-8, IL-6, TNF-α, IL-1β and IL-12, are modulated by TLR signaling (21). Therefore the TLR4 agonist, LPS, was used as a model of inflammation and the effects of ASH-WEX cytokine production were investigated at the protein level by western blotting. The results demonstrated that treatment with 5 mg/ml ASH-WEX inhibited the LPS-induced TNF-α upregulation (Fig. 3A), but significantly increased TGF-β1 levels (Fig. 3B). These results were in accordance with the mRNA results (Fig. 2).

The present data suggested that ASH-WEX might have anti-inflammatory properties by suppressing the expression of inflammatory cytokines. It is well stablished that the NF-κB and MAPK signaling pathways are strongly associated with inflammatory cytokine expression in HaCaT cells (22,23). LPS stimulation activates NF-κB by modulating TLR4 (24). LPS can also activate the MAPK pathway in HaCaT cells (22). To determine whether ASH-WEX suppressed the LPS-induced MAPK and NF-κB pathways, a western blot analysis was performed. The results revealed that treatment with 5 mg/ml ASH-WEX inhibited the LPS-induced phosphorylation of p38 (Fig. 4A) and JNK (Fig. 4B), but upregulated the phosphorylation of ERK (Fig. 4C). Next, it was investigated whether ASH-WEX inhibited LPS-induced nuclear transduction of NF-κB, and the results demonstrated that treatment with 5 mg/ml ASH-WEX inhibited the LPS-induced nuclear translocation of p65 (Fig. 4D), which is a significant mediator of the NF-κB signaling pathway.

Finally, the anti-inflammatory effect of ASH-WEX was investigated in vivo. It is well known that external stimuli, such as wounds, initiate inflammation in the skin (25). In the present study, wounded mouse skin was employed as an in vivo inflammation model in order to investigate the anti-inflammatory effects of ASH-WEX. On each mouse, ASH-WEX was topically applied to a wound on the left side of the back skin and solvent Milli Q was topically applied to a wound at the right side of the back skin every 24 h until day 5. Thereafter, the skin was removed and used to assay the mRNA expression levels of cytokines by RT-qPCR. The results demonstrated that ASH-WEX treatment inhibited the mRNA expression of the pro-inflammatory cytokine TNF-α, while it increased the mRNA expression of the anti-inflammatory cytokine TGF-β1 (Fig. 5). These results further demonstrated that ASH-WEX may regulate the inflammatory response associated with wound closure (26).

Finally, a wound-healing assay was performed in vivo to examine the properties of ASH-WEX. The results demonstrated that, on days 1-5, the ASH-WEX treatment side exhibited a significantly decreased wound area compared with the control Milli Q- treated side (Fig. 6). These results suggest that ASH-WEX treatment accelerated the speed of wound-closure in the early stage, which is the inflammation phase of wound healing. In addition, the ASH-WEX-treated skin displayed a thinner epidermis and thinner dermis compared with the control skin (Fig. 7). Furthermore, less aggregation of immune cells was observed in the ASH-WEX-treated skin compared with the control-treated skin (Fig. 7). Of note, ASH-WEX treatment did not affect the weight of the mice (data not shown).