Contributed equally
Intestinal ischemia and reperfusion (II/R) injury often triggers severe injury in remote organs, with the lungs being considered the main target. Excessive elevation of proinflammatory cytokines is a major contributor in the occurrence and development of II/R-induced acute lung injury (ALI). Therefore, the present study aimed to investigate whether blocking tumor necrosis factor-α (TNF-α) expression could protect the lungs from injury following II/R, and to explore the possible underlying mechanism involving interleukin-10 (IL-10). Briefly, II/R was induced in rats by 40 min occlusion of the superior mesenteric artery and celiac artery, followed by 8, 16 or 24 h of reperfusion. Subsequently, lentiviral vectors containing TNF-α short hairpin (sh)RNA were injected into the right lung tissues, in order to induce TNF-α knockdown. The severity of ALI was determined according to lung injury scores and lung edema (lung wet/dry weight ratio). The expression levels of TNF-α were analyzed by quantitative polymerase chain reaction (qPCR), western blotting and immunofluorescence (IF) staining. IL-10 expression, in response to TNF-α knockdown, was detected in lung tissues by qPCR and IF. The results detected marked inflammatory responses, and increased levels of lung wet/dry weight ratio and TNF-α expression, in the lungs of II/R rats. Conversely, treatment with TNF-α shRNA significantly alleviated the severity of ALI and upregulated the expression levels of IL-10 in lung tissues. These findings suggested that TNF-α RNA interference may exert a protective effect on II/R-induced ALI via the upregulation of IL-10. Therefore, TNF-α knockdown may be considered a potential strategy for the prevention or treatment of ALI induced by II/R in future clinical trials.
Intestinal ischemia and reperfusion (II/R) is encountered under various clinical conditions, and contributes to multi-organ failure and high levels of mortality (60–80%) (
Among the numerous proinflammatory cytokines, tumor necrosis factor-α (TNF-α) has a critical role in the occurrence and development of ALI caused by II/R (
Downregulation of mRNA transcripts by RNA interference (RNAi) and small interfering (si)RNA (
It has been hypothesized that blocking expression of the proinflammatory cytokine TNF-α may protect the lungs from remote organ injury following II/R. Therefore, the present study employed a rat model of II/R injury and used short hairpin (sh)RNA technology to examine the efficacy of TNF-α knockdown on II/R-induced ALI, and to investigate its association with interleukin-10 (IL-10) expression in lung tissues.
Adult male Sprague-Dawley rats (8–12 weeks old), weighing 230–280 g, were obtained from the Experimental Animal Center of Sichuan University (Chengdu, China). Guide lines for Laboratory Animal Care and Safety from the National Institutes of Health (Bethesda, MD, USA) were followed. The rats were maintained in plastic cages (2 rats/cage) with soft bedding, and were given free access to food and water. Rats were maintained under the following conditions: Controlled room temperature, 22–25°C humidity, 45–50%; 12-h light/dark cycle. Animal care and all experimental protocols were approved by the Institutional Medical Experimental Animal Care Committee of Kunming Medical University (Kunming, China).
A total of 152 rats were randomly divided into the following two groups, as described in
To investigate the function of TNF-α in rat lungs following II/R, human immunodeficiency virus (HIV)-based vectors were used. TNF-α gene information was gathered from the National Center for Biotechnology Information (
In order to screen the efficiency of the potential TNF-α shRNA sequence, PC12 cells, purchased from the Animal Research Institute of the Chinese Academy of Medical Sciences (Beijing, China), were seeded in 6-well plates and incubated at 37°C in an atmosphere containing 5% CO2, prior to transfection with shRNA sequences. Brie fly, cultured PC12 cells (1×105/ml), were transfected at 4°C with a mixture including 1
Lentiviral vector production was conducted according to the manufacturer's protocol of the Lenti-Pac™ HIV Expression Packaging kit (GeneCopoeia, Inc.). Briefly, 293Tα lentiviral packaging cells (GeneCopoeia, Inc.) were cultured in DMEM supplemented with 10% heat-inactivated FBS at 37°C in an atmosphere containing 5% CO2. Cell confluence between 70 and 80% was optimal for transfection. Lentiviral expression plasmid (1.25
Rats were fasted with no restriction of water access for 24 h prior to surgery. II/R was induced by SMA and CA occlusion, as described previously (
For TNF-α interference, the previously described lentiviruses were injected through the diaphragm into the right lung tissue (5
At the end of reperfusion (8, 16 and 24 h), experimental and sham rats were anaesthetized with ketamine-xylazine (100 and 20 mg/kg i.p., respectively) and euthanized with pentobarbital sodium (200mg/kg i.p.). Subsequently, lung tissues from rats in each group were collected and analyzed.
Lung edema was estimated by comparing the lung wet/dry weight ratio. At the end of the experiments, lungs were immediately removed and weighed to obtain the wet weight. The tissues were then dried in an oven at 90°Cfor 24 h and were weighed again to obtain the dry weight. Lung wet/dry weight ratio was calculated as previously described (
Histological analysis of the lungs was performed by hematoxylin and eosin (H&E) staining. Briefly, tissue samples were fixed in 10% (v/v) formalin in neutral-buffered solution for 72 h at room temprature, and the fixed tissues were embedded in paraffin. Subsequently, tissue blocks were cut into 5-
The mRNA expression levels of TNF-α and IL-10 were detected using RT-qPCR. Briefly, total RNA was isolated from the lung tissues using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. RNA was reverse transcribed to cDNA using the RevertAid™ First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. qPCR was then performed to determine the expression levels of target genes. The primers and TaqMan probes were designed with Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA). The primer sequences were as follows (5′-3′): TNF-α, forward GCCCACGTCGTAGCAA, reverse, GTCTTTGAGATCCATGCCAT (annealing temperature, 52°C); IL-10, forward CAGAAATCAAGGAGCATTTG, reverse CTGCTCCACTGCCTTGCTTT (annealing temperature, 50°C); and β-actin, forward GAAGATCAAGATCATTGCTCCT and reverse TACTCCTGCTTGCTGATCCA (annealing temperature, 52°C). The rat β-actin housekeeping gene was used as an internal control. The qPCR reactive system was established as follows: 2X PCR, Master Mix (12.5
A total of 8, 16 and 24 h following reperfusion, paraffin-embedded lung sections underwent IF staining of TNF-α and IL-10. Following routine de-paraffinization and rehydration, tissue sections were incubated with PBS containing 3% goat serum (Sigma, St. Louis, MO, USA) for 30 min at 37°C, and were then incubated overnight at 4°C with TNF-α (1:500, rabbit) and IL-10 (1:100, rabbit; catalog no. Ab9969) primary antibodies (both from Abcam, Cambridge, UK) which were diluted in PBS containing 2% normal goat serum. A negative control was performed by adding PBS instead of the primary antibody. Subsequently, sections were washed three times with PBS and were incubated with Cy3 fluorescence-labeled secondary antibody (1:200, anti-rabbit; catalog no. 111-165-003; Jackson Laboratory, Bar Harbor, ME, USA), in the dark for 30 min at 37°C. Sections were then washed three times with PBS, mounted onto gelatin-coated glass microscope slides, air dried and cover-slipped in a glycerol-based mounting medium. Cell nuclei were visualized by DAPI-Fluoromount (Beyotime Institute of Biotechnology, Shanghai, China). Photomicrographs were captured under a fluorescence microscope (Leica Microsystems GmbH, Wetzlar, Germany).
Tissue samples were lysed and homogenized in 50 ml radioimmunoprecipitation acid lysis buffer (Beyotime Institute of Biotechnology) containing a 2% protease inhibitor cocktail tablet (Roche Diagnostics GmbH, Mannheim, Germany). Subsequently, a Bicinchoninic Acid protein assay kit (Beyotime Institute of Biotechnology) was used to detect the protein concentration and, 100
Statistical analysis was conducted using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA) and the experiments were repeated 3 times. Data are presented as the means ± standard deviation and were subjected to statistical analysis using one-way analysis of variance (ANOVA) or Student's t-test. For multiple group comparisons, ANOVA with Tukey's post hoc multiple comparisons test was applied. P<0.05 was considered to indicate a statistically significant difference.
Compared with in the sham group, the lung wet/dry weight ratio of the II/R group was significantly increased 8, 16 and 24 h after reperfusion; the results indicated that pulmonary edema was aggravated as the time interval lengthened (P<0.05;
Between 8 and 24 h post-reperfusion, the mRNA and protein expression levels of TNF-α in the II/R group exhibited an increasing trend compared with in the sham group (P<0.05;
Lentivirus-mediated TNF-α interference was used to knockdown the expression of TNF-α. The lentivirus-carried TNF-α shRNA sequence is presented in
Following TNF-α inhibition, western blotting confirmed that the protein expression levels of TNF-α were significantly decreased in lung tissues (P<0.05;
To determine the effects of TNF-α interference on the production of IL-10, the expression levels of IL-10 were detected in lung tissues. qPCR demonstrated that the mRNA expression levels of IL-10 were significantly increased in the TNF-α shRNA group compared with in the negative control group (P<0.05;
The present study demonstrated that TNF-α knockdown may alleviate the inflammatory response associated with II/R-induced ALI by interfering with TNF-α expression and upregulating IL-10 in the lung tissues. These findings suggested that TNF-α RNA interference may be used as a strategy for the prevention or treatment of II/R-induced ALI in future clinical trials.
The present results indicated that II/R induced an acute inflammatory response in the lungs, in which adherence and infiltration of neutrophils was increased, and interstitial edema occurred; these observations were associated with worsened lung injury scores. These observations may significantly contribute to II/R-induced lung injury. Previous studies have reported that activated neutrophils are an important factor in tissue injury and serve a significant role in the progression of ALI (
The present study suggested that TNF-α, either locally produced at the site of ischemia or generated directly from the lung tissue affected by II/R, had important effects on the lungs. The results indicated that TNF-α expression was upregulated in lung tissues, alongside ultrastructural alterations and lung injuries. In addition, the alterations in TNF-α expression levels differed with the time post-reperfusion. In the present study, the expression levels of TNF-α were increased in the lung tissues of the II/R group after 8 h reperfusion and peaked 24 h post-reperfusion. A previous study provided evidence to suggest that in I/R injury, excessive elevation of proinflammatory cytokines is a major contributor in remote organ injury (
The present study demonstrated that TNF-α lentiviral interference decreased the acute inflammatory response, lung injury and lung edema induced by II/R in rats, and it was indicated that its protective role may involve upregulation of IL-10. Until recently, siRNAs have been considered particularly specific (
In previous studies, blockade of TNF-α has been reported to improve or prevent inflammation in animal models and in humans for the treatment of disease (
The treatment for II/R-induced ALI is currently limited. It has previously been reported that remote intestinal ischemic preconditioning may confer cytoprotection in critical organs, including the lungs, by attenuating the release of the proinflammatory cytokines TNF-α and IL-1 (
In conclusion, the present study demonstrated that TNF-α may be a major contributor in II/R-induced ALI, and TNF-α RNAi may alleviate the severity of ALI. Notably, TNF-α RNAi exerted a protective effect on II/R-induced ALI via upregulation of the anti-inflammatory cytokine IL-10. Based on these findings, TNF-α knockdown may be considered a novel therapeutic strategy for the treatment of II/R-induced ALI.
The authors would like to thank Dr Qing-Jie Xia (West China Hospital, Sichuan University, Chengdu, China) for suggestions on this study.
The present study was supported by a grant from the Key Natural Science Foundation of Yunnan (grant no. 2013FZ264).
All data generated or analyzed during this study are included in this published article.
ZY, XRZ, THW and YHZ designed the project and were major contributors in writing and revising the manuscript. QZ and SLW participated in the production of recombinant lentiviral vector. LLX and PZ carried out the II/R model and lentivirus injection. QZ, BY and ZBZ carried out the histological analysis. QZ, SYF, ZY and XRZ carried out the qPCR, IF staining, and western blot analysis. ZY, XRZ, THW and ZYH analyzed the data. All authors read and approved the final manuscript.
Animal care and all experimental protocols were approved by the Institutional Medical Experimental Animal Care Committee of Kunming Medical University (Kunming, China).
Not applicable.
The authors declare that they have no competing interests.
Lung edema and morphological damage are induced by II/R. (A) Lung edema was analyzed by lung wet/dry weight ratio in the sham and II/R groups (8, 16 and 24 h after reperfusion). Data are presented as the means ± standard deviation (n=8). *P<0.05 compared with the sham group. (B) Morphological alterations in the lung tissue of the sham and II/R groups (8, 16 and 24 h) were observed under a light microscope. Disordered alveolar structure, congestion, neutrophil invasion and interstitial edema were observed in the lungs of the II/R group (8, 16 and 24 h). Scale bar, 20
Expression levels of TNF-α in lung tissues. (A) mRNA expression levels of TNF-α were detected in lung tissues by quantitative polymerase chain reaction. Data are presented as the means ± standard deviation (n=8). *P<0.05 compared with the sham group. (B) Protein expression levels of TNF-α were assessed by western blotting. Compared with in the sham group, TNF-α protein expression was increased in the lung tissue 8, 16 and 24 h post-reperfusion in the II/R group. Data are presented as the means ± standard deviation (n=8). *P<0.05 compared with the sham group. (C) Representative photomicrographs exhibiting immunostaining of TNF-α (red fluorescence) in lung cells from the sham and II/R groups (8, 16 and 24 h post-reperfusion). Immunofluorescence intensity was increased between the two groups; the 24 h post-reperfusion group possessed the strongest red staining. Blue fluorescence represented nuclei stained by DAPI. Scale bar, 25
Generation of a recombinant lentivirus targeting TNF-α. (A) TNF-α shRNA was inserted into a lentivirus plasmid; the sequence is stated. (B) mRNA expression levels of TNF-α were measured by quantitative polymerase chain reaction. (C) Protein expression levels of TNF-α were measured by western blotting. Data are presented as the means ± standard deviation. *P<0.05 compared with the control group (non-sense shRNA). (D) 293Tα cells were transfected with TNF-α shRNA lentivirus. Virus production carrying mCherryFP was visualized as red staining under a fluorescence microscope, indicating successful transfection. Scale bar, 25
Alterations in lung injury following TNF-α interference. (A) Western blotting was used to detect TNF-α protein expression in lung tissues following TNF-α shRNA injection. Data are presented as the means ± standard deviation (n=8). *P<0.05 compared with the negative control group. (B) Hematoxylin and eosin staining of lung tissues from the negative control and TNF-α shRNA groups. The left image is the negative control group, and the right image is the TNF-α shRNA group. Scale bar, 20
Expression of IL-10 following TNF-α interference. (A) A total of 24 h post-reperfusion, quantitative polymerase chain reaction indicated that the mRNA expression levels of IL-10 were significantly increased following TNF-α knockdown. Data are presented as the means ± standard deviation (n=8). *P<0.05 compared with the negative control group. (B) Immunofluorescent staining of IL-10 in the lungs of the negative control and TNF-α shRNA groups. The left image is the negative control group, and the right image is the TNF-α shRNA group. Scale bar, 25
Diagram of the underlying mechanism by which TNF-α shRNA serves a protective role in a rat model of II/R-induced ALI. At various time points post-reperfusion, evidence of ALI was detected by hematoxylin and eosin staining. qPCR, WB and IF indicated that the expression levels of TNF-α were significantly increased in the lung tissues. TNF-α shRNA protected lungs from II/R-induced acute injury by upregulating IL-10 expression. The circles above the arrows indicate inhibition. ALI, acute lung injury; IF, immunofluorescence; II/R, intestinal ischemia and reperfusion; IL-10, interleukin-10; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; TNF-α, tumor necrosis factor-α; WB, western blotting.
Animal model and number of rats distribution.
Group | Model | Lung edema | H&E | IF | qPCR/WB |
---|---|---|---|---|---|
Sham | Sham | 8 | 6 | 6 | 8 |
8 h | II/R | 8 | 6 | 6 | 8 |
16 h | II/R | 8 | 6 | 6 | 8 |
24 h | II/R | 8 | 6 | 6 | 8 |
H&E, hematoxylin and eosin; IF, immunofluorescence; II/R, intestinal ischemia and reperfusion; qPCR, quantitative polymerase chain reaction; WB, western blotting.
Animal grouping and and number of rats distribution.
Group | Model (24 h) | H&E | qPCR/WB | IF |
---|---|---|---|---|
Control | II/R+Lv-NC vector | 6 | 8 | 6 |
TNF-α shRNA | II/R+RSH054951-5-HIVmU6 | 6 | 8 | 6 |
H&E, hematoxylin and eosin; IF, immunofluorescence; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA: TNF-α, tumor necrosis factor-α; WB, western blotting.