All animals were treated in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and the experimental protocols were approved by the Ethics Committee of the Chinese PLA General Hospital. Twenty-week-old male db/db mice (weighing 45-50 g), which were used as a model of type 2 diabetes, and their lean age-matched littermates db/m mice (weighing 25-30 g), which were used as non-diabetic controls, were purchased from Cavens Laboratory Animal Co., Ltd. (Changzhou, China). All animals were housed under a light-dark cycle of 12 h, and were allowed free access to standard food and water. A total of 30 db/db mice were randomly assigned into three groups: The dimethyl sulfoxide (DMSO) group (n=10), which received an intraperitoneal injection of 2% DMSO (Amresco, Washington, DC, USA); the DZX group (n=10), which received an intraperitoneal injection of DZX (5 mg/kg, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) dissolved in 2% DMSO; and the DZX plus 5-hydroxydecanoate (5-HD) group (n=10), which received an intraperitoneal injection of DZX (5 mg/kg) plus 5-HD (5 mg/kg, Sigma-Aldrich; Merck KGaA) dissolved in 2% DMSO, according to a previous study (25). A total of 10 db/m mice were used as the control group, and received an intraperitoneal injection of 2% DMSO. All animals were injected daily for 4 weeks, and the dosage of vehicle was 10 ml/kg (26).

Transthoracic echocardiography was performed to evaluate cardiac function by high-resolution imaging (Vevo 770; Visual Sonics Inc., Toronto, ON, Canada) at the animal center of Capital Medical University (Beijing, China). Hemodynamic parameters were obtained at baseline and after 4 weeks of drug intervention. The left ventricular ejection fraction (EF), fractional shortening (FS), left ventricular internal dimension in systole (LVDs), left ventricular internal dimension in diastole (LVDd), cardiac output (CO) and left ventricular weight (LVW) were measured. The body surface area was calculated based on the Meeh-Rubner equation [A=k'(W^2/3)/10,000(k'=9.1)] (27).

Primary cultures of neonatal rat ventricular myocytes were prepared from Sprague-Dawley rats (1-2 days), which were purchased from Vital River Laboratories (Beijing, China). The hearts were quickly extracted and immediately washed with D-Hank's solution (Solarbo, Beijing, China). Straight scissors were used to mince the hearts into small pieces (1-2 mm³), and cardiomyocytes were digested with 0.08% trypsin (Amresco) at 37°C for 6-10 min. The initial cell suspensions were discarded, and the remaining tissue was digested with 0.08% type II collagenase (Gibco; Thermo Fisher Scientific Inc., Waltham, MA USA) at 37°C for 6-10 min, and then neutralized with Dulbecco's minimal Essential medium (HyClone; GE Healthcare, Logan, UT, USA) containing 10% fetal bovine serum (HyClone; GE Healthcare), until the tissue had dissolved. All cell suspensions were pelleted by centrifugation at 300 × g for 10 min, and the resulting cardiomyocyte pellet was resuspended. The cell suspensions were plated into 100-mm cell culture dishes and incubated for 90 min in an incubator (95% O₂/5% CO₂). The cell suspensions were then collected and plated in 60-mm cell culture dishes at a density of 2-5×10⁵ cells/ml, and 5-bromo-2-deoxyuridine (0.1 mmol/l, Sigma-Aldrich; Merck KGaA) was added into the culture medium for the first 48 h (28,29). After 48 h, the cultured cardiomyocytes were divided into five groups for different drug treatments: Insulin (100 nmol/l, Sigma-Aldrich; Merck KGaA) for 24 h (19), DZX (100 µmol/l) plus insulin (100 nmol/l) for 24 h, 5-HD (100 µmol/l) plus DZX (100 µmol/l) plus insulin (100 nmol/l) for 24 h, MK-2206 (5 µmol/l, Selleck Chemicals, Houston, TX, USA) plus DZX (100 µmol/l) plus insulin (100 nmol/l) for 24 h. DZX, 5-HD and MK-2206 were applied 30 min in advance according to a previously published study (30). The control group received only 2% DMSO.

All mice were fasted for 8 h prior to blood biochemistry measurements. Blood glucose was detected with a standard glucometer (Roche Diagnostics GmbH, Mannheim, Germany) in blood samples obtained from mice tails. NT-proBNP levels in the serum and culture supernatant were measured by ELISA kit (Elabscience, Wuhan, China) in blood samples collected from the eyeballs, according to the manufacturer's instructions. The optical density of NT-proBNP was measured at a wavelength of 450 nm using an enzyme-labeled instrument (Epoch; BioTek Instruments, Inc., Winooski, VT, USA). CurveExpert 3.1 software (CurveExpert Software, Chattanooga, TN, USA) was used to establish a standard curve, and the NT-proBNP concentration of each sample was calculated using the standard curve. The amount of NT-proBNP in the culture supernatant was calculated relative to the total protein concentration.

After 4 weeks of drug treatment, H&E staining and TUNEL assays were performed to evaluate the pathological changes in myocardial tissue. Paraformaldehyde 4% (Solarbo) was used to fix mouse myocardium overnight at 4°C. Paraffin embedding, tissue sectioning and H&E staining were performed as previously described (31). Five myocardial H&E-stained sections were randomly selected from each group. Cell area measurements were performed on similar myocardial cross sections, and 50 nucleated cells were randomly selected to measure the mean cell area (32). The rate of apoptosis in cardiomyocytes was measured using a TUNEL assay kit (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's instructions. Five myocardial TUNEL stained sections were selected from each group. A similar field of vision was selected for each image, and Image Pro Plus software (Media Cybernetics, Inc., Rockville, MD, USA) was used to count the cells. A selection of 200 cells was randomly chosen to determine the ratio of TUNEL-stained cells, which was used to determine the rate of apoptosis (33,34).

Caspase 3 activity was measured using the caspase 3 activity kit (Beyotime Institute of Biotechnology, Shanghai, China). Lysis buffer was added to the cultured cardiomyocytes at 4°C for ~15 min. The suspension was centrifuged at 4°C for 15 min (16,000 × g). A 50-µl aliquot of the supernatant extract was mixed with 10 µl Ac DEVD pNA substrate and 40 µl detection buffer, and then incubated at 37°C for ~2 h. The remaining extracts were used to measure protein concentration by the Bradford protein assay kit (Beyotime Institute of Biotechnology). P-nitroaniline was measured at a wavelength of 405 nm using an enzyme-labeled instrument (35). The caspase 3 activity was calculated using the p-nitroaniline absorbance relative to the total protein concentration.

Total protein was extracted from myocardial tissues and cultured cardiomyocytes using RIPA buffer (Solarbo), and the protein concentration was measured using a bicinchoninic acid protein assay kit (Beyotime Institute of Biotechnology). The total protein of myocardial tissue samples (70 µg) and cultured cardiomyocyte samples (50 µg) were separated using 8-12% SDS-PAGE (optimized to the molecular weight of each target protein) and transferred to PVDF membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked in 5% non-fat milk or 5% BSA in 1X TBST (Solarbo) for 2 h at room temperature, then incubated overnight at 4°C with primary antibodies as follows: p-AKT (1:5,000; rabbit monoclonal, ab81283, Abcam, Cambridge, UK), t-AKT (1:10,000; rabbit monoclonal, ab179463, Abcam), p-Foxo1 (1:500; rabbit polyclonal, ab131339, Abcam), t-Foxo1 (1:500; rabbit polyclonal, ab39670, Abcam), GAPDH (1:30,000; rabbit monoclonal, ab181602, Abcam), and caspase 3 (1:1,000; rabbit polyclonal, 9662, Cell Signaling Technology Inc., Danvers, MA, USA). The membranes were washed in 1X TBST on a shaker at 10 × g for 15 min, and then incubated at room temperature with HRP-conjugated secondary antibodies for 60 min. Protein bands were detected using a chemiluminescent substrate with an imaging system (Tanon, Shanghai, China), and ImageJ software (National Institutes of Health, Bethesda, MD, USA) was used to quantify the intensity of the bands.

Total RNA was isolated from cultured cardiomyocytes using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Carlsbad, CA, USA), and then reverse-transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). RT-qPCR was performed in a 20-µl reaction volume containing 3 µl cDNA template, 1 µl primer mixture, 6 µl ddH₂O, 10 µl Power SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA) in a 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The BNP primers used were AGTCCTTCGGTCTCAAGGCA (F) and CCGATCCGGTCTATCTTGTGC (R), and the internal control (36β4) primers were CAGAGGTGCTGGACATCACAGAG (F) and GGCAACAGTCGGGTAGCCAATC (R). The thermal cycling conditions were carried out according to a previously published study (36). The relative expression of BNP was calculated relative to 36β4 by the 2^−ΔΔCq method.

ΔYm was measured using fluorescent dye JC-1 (Beyotime Institute of Biotechnology). Cultured cardiomyocytes were incubated with JC-1 stain for 20 min at 37°C, and carefully washed twice with ice-cold JC-1 staining buffer (1X). The cells were immediately visualized under a confocal microscope (FV1000, Olympus, Tokyo, Japan). JC-1 stain aggregated in the mitochondria was visible as red fluorescence, while JC-1 outside the mitochondria was detectable as green fluorescence. The resulting images were analyzed using Image Pro Plus 6.0 software (Media Cybernetics, Inc.). ΔYm was determined by calculating the ratio of red fluorescence to green fluorescence (37).

All values were analyzed using SPSS 17.0 software (SPSS Inc., Chicago, IL, USA), and presented as mean ± standard deviation. Differences among three or more groups were evaluated by one-way analysis of variance (ANOVA) followed by the least significant difference and Dunnett's tests. Differences were considered statistically significant for P-values <0.05.

Hemodynamic parameters and serum NT-ProBNP levels were measured in db/db mice after treatment with DZX. The LVEF, FS and cardiac index (CI) values were lower, while the serum NT-ProBNP level increased in db/db mice. DZX-treated mice exhibited increased LVEF, FS and CI values, and decreased serum NT-ProBNP levels (P<0.05 in the DZX group vs. the DMSO and 5-HD+DZX groups) (Table I; Fig. 1A-F). Moreover, DZX exerted no effect on body weight or blood glucose level (Table I). 5-HD completely blocked the effects of DZX. These data suggest that opening of mitoK_ATP improved cardiac function in db/db mice.

To further explore the effects of DZX treatment on the pathological changes in myocardial tissue, H&E staining and TUNEL assays were performed to detect cardiomyocyte hypertrophy and apoptosis, respectively. The cardiomyocytes of db/db mice were significantly hypertrophic compared with the control group (P<0.05). However, hypertrophy was significantly attenuated following treatment with DZX (P<0.05 in the DZX group vs. the DMSO and 5-HD+DZX groups) (Fig. 2A and B). Furthermore, this effect was blocked by treatment with 5-HD.

Similarly, the rate of apoptosis of cardiomyocytes in db/db mice was significantly higher compared with that in the control group (P<0.05). DZX decreased the rate of cardiomyocyte apoptosis (P<0.05 in the DZX group vs. the DMSO and 5-HD+DZX groups), and its effect was blocked by 5-HD (Fig. 2CA and D). These findings suggest that opening of mitoK_ATP attenuated hypertrophic degeneration and inhibited apoptosis of cardiomyocytes in db/db mice.

To further investigate the effect of mitoK_ATP channel opening by DZX on cardiomyocyte apoptosis in db/db mice, the expression of cleaved caspase 3 was measured by western blotting in each group. The expression of cleaved caspase 3 was increased in the DMSO group compared with that in the control group (P<0.05). DZX treatment decreased the expression of cleaved caspase 3 (P<0.05 in the DZX group vs. the DMSO and 5-HD+DZX groups) (Fig. 3A and B). The regulatory effect of DZX on the expression of cleaved caspase 3 was blocked by treatment with 5-HD. This suggests that opening of mitoK_ATP prevented the progression of cardiomyocyte apoptosis in db/db mice.

In order to determine the effect of mitoK_ATP channel opening by DZX on the AKT-Foxo1 signaling pathway, the protein expression of t-AKT, t-Foxo1, p-AKT and p-Foxo1 was detected by western blotting in each group. The expression of p-AKT and p-Foxo1 was decreased in the DMSO group compared with that in the control group (P<0.05). However, DZX treatment increased the expression of p-AKT and p-Foxo1 (P<0.05 in the DZX group vs. the DMSO and 5-HD+DZX groups), and this effect was blocked by 5-HD (Fig. 4A and B). These results suggest that opening of mitoK_ATP regulated the AKT-Foxo1 signaling pathway in db/db mice.

To further characterize the protective effect of mitoK_ATP channel opening by DZX in vitro, the level of NT-ProBNP was detected in the culture supernatant and the relative expression of BNP mRNA in cultured cardiomyocytes simulating chronic insulin resistance. The NT-ProBNP level and relative expression of BNP mRNA were increased in cells mimicking insulin resistance compared with that in the control group (P<0.05). DZX treatment decreased the NT-ProBNP level and the relative expression of BNP mRNA (Fig. 5A and B), whereas its effect was blocked by 5-HD. These data indicate that opening of mitoK_ATP decreased the expression of heart failure markers during insulin resistance.

To further explore the role of mitoK_ATP channel opening on energy metabolism, ΔYm was measured in each group, and was found to be decreased in cells mimicking insulin resistance compared with that in the control group (P<0.05). DZX treatment resulted in increased ΔYm, and its effects were blocked by 5-HD (Fig. 6A and B).

Similarly, the expression of cleaved caspase 3 and the activity of caspase 3 were increased in cells mimicking insulin resistance. DZX treatment significantly decreased the expression of cleaved caspase 3 and reduced caspase 3 activity (Fig. 6C-E). The effect of DZX was blocked by 5-HD. These results suggest that opening of mitoK_ATP not only improved the energy metabolism of cardiomyocytes, but also attenuated the apoptosis of cardiomyocytes during insulin resistance.

Opening mitoK_ATP channels with DZX treatment similarly increased the expression of p-AKT and p-Foxo1 in cultured cardiomyocytes (P<0.05 in the DZX group vs. the DMSO and 5-HD+DZX groups) during induced insulin resistance, and this effect was blocked by 5-HD (Fig. 7A and B).

To determine whether the protective effects and inhibition of apoptosis observed following DZX treatment were a result of the regulation of the AKT-Foxo1 signaling pathway, the effects of DZX treatment on heart failure marker expression, ΔYm and apoptosis were evaluated after treatment with MK-2206. Treatment with MK-2206 prior to treatment with DZX inhibited the increase of p-AKT and p-Foxo1 expression, the increase in ΔYm, the inhibition of apoptosis, including decreased cleaved caspase 3 expression and activity, and the decrease of culture supernatant NT-ProBNP and BNP mRNA expression that were induced by mitoK_ATP channel opening (Figs. 5–7). This indicates that the opening of mitoK_ATP exerts protective effects and inhibits apoptosis via regulating the AKT-Foxo1 signaling pathway during insulin resistance.