Influenza viruses represent a serious threat to human health. Although our research group has previously demonstrated the antiviral and anti-inflammatory activities of eleutheroside B1, a detailed explanation of the mechanism by which it is effective against the influenza virus remains to be elucidated. In the present study, the transcriptomic responses of influenza A virus-infected lung epithelial cells (A549) treated with eleutheroside B1 were investigated using high-throughput RNA sequencing, and potential targets were identified using a molecular docking technique, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay, and DNA methylation analysis. The transcriptomic data revealed that there are 1,871 differentially expressed genes (DEGs) between the cells infected with the influenza virus strain variant PR8, and the cells infected with PR8 and treated with eleutheroside B1. Among the DEGs, RNA polymerase II subunit A (POLR2A; encoding the largest subunit of RNA polymerase II) and mannosidase α class II member 1 (MAN2A1) were selected from the molecular docking analysis with eleutheroside B1. The docking score of
Influenza A viruses cause worldwide outbreaks of influenza and seasonal pandemics, and pose serious risks to public health (
Currently available anti-influenza virus drugs target the viral life cycle, including amantadine, rimantadine, oseltamivir, zanamivir and peramivir. However, prolonged treatment and the resulting immuno-compromised status of patients lead to increases in drug-resistant mutations among influenza viruses worldwide (
Coumarin is a fragrant organic chemical compound of the benzopyrone chemical class that is a natural substance found in many plant species, which exhibits a variety of potent pharmacological activities, including antioxidant, antibacterial, anti-inflammatory, antitumor and antiviral activities (
Over the past few decades, computational chemistry, molecular biology, pharmacognosy and biotechnology have become major scientific areas for the research of natural products. Some modern technologies, including RNA sequencing and molecular docking, have also been used to identify novel molecules for the effective treatment of diseases, and to investigate the underlying mechanisms of action and the specific targets, as well as DNA, RNA, protein and enzyme interactions, associated with natural products (
Eleutheroside B1 was purified from
The A549 cells were grown in a monolayer up to 80% confluency and detached from the flask using 10 mM EDTA (pH 7.4) and 0.25% trypsin. The cells were harvested, and 6×105 A549 cells were seeded in 6-well tissue culture plates. On the following day, the cells were washed twice with PBS and infected with A/PR/8/34 [H1N1; 0.1 multiplicity of infection (MOI)] using serum-free medium for 2 h at 37°C. The inoculum was removed, and the cells were treated with or without eleutheroside B1 at a concentration of 100
Total RNA extracts from each sample were obtained with TRIzol reagent, according to the manufacturer's instructions (Thermo Fisher Scientific, Inc.). The total RNA quality was analyzed using agarose electrophoresis (1% gels). The A260/A280 ratio was determined using a NanoDrop spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). RNA integrity was assessed by Agilent 2100 TapeStation analysis (Agilent Technologies, Santa Clara, CA, USA). An A260/A280 ratio between 1.8 and 2.0 and an RNA integrity number >7 were considered acceptable parameters for RNA integrity. RNA sequencing was performed on an Illumina X-ten RNA-Seq sequence production system (Illumina, Inc., San Diego, CA, USA).
In order to obtain a list of DEGs, Gene Ontology (GO) and pathway enrichment analyses were performed. In addition, GO terms, Interpro (protein sequence analysis and classification) terms, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways that were significantly enriched on our list of genes with altered expression (P<0.05) were identified. Additionally, the integrated pathways with statistical values were computed from our list of DEGs using a reactome pathway analysis (
Two-dimensional [2D(a)] and three-dimensional [3D(b)] structural information of the compound were obtained from the National Centre for Biotechnology Information (NCBI; (
Through the PTS, select proteins were identified that were potentially matched with eleutheroside B1. Given our goal of attempting to find a potential target of eleutheroside B1 that would be effective against the influenza virus, and considering our previous results, Golgi mannosidase α class II member 1 (MAN2A1) and RNA polymerase II subunit A (POLR2A) were selected as candidate targets. The four-letter PDB code (3BVT) of
A549 cells were seeded in 6-well plates at 37°C in an atmosphere of 5% CO2, then infected with influenza virus (strain A/PR/8/34; 0.1 MOI) and subsequently treated with eleutheroside B1 at a diluted concentration. At 24 h post-infection, the cells were collected for mRNA expression analysis of the host genes (MAN2A2, POLR2A) and the viral genes [polymerase acid (PA), polymerase basic (PB) 1 and 2 and hemagglutinin (HA)] by RT-qPCR. Total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Total RNA (1
A Hidden Markov Model (HMM)-based CGI prediction for the MAN2A1 and POLR2A gene loci was obtained from the browser (
Genomic DNA was extracted from eleutheroside B1-treated and non-treated A549 cells following an influenza virus infection using a DNA Extraction of Cell and Tissue kit (cat. no. GK0122; Generay Biotech Co., Ltd., Shanghai, China). The bisulfite conversion was performed with 1
All data are expressed as the mean ± standard deviation of at least three separate experiments. Differences between two groups were analyzed using Student's t-test, whereas differences between multiple groups were analyzed using one-way analysis of variance followed by Fisher's Least Significant Difference post-hoc test. Statistical analyses were performed using SPSS 18.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.
To investigate the molecular mechanism of eleutheroside B1 action against influenza A virus infection, RNA sequencing of influenza A virus-infected human lung epithelial A549 cells, in the presence or absence of eleutheroside B1 treatment, was performed using an Illumina X-ten RNA-seq sequence production system. The RNA sequences were subsequently aligned against the human gene sequences. Three different experimental groups were established: Lung epithelial A549 cells without infection (A549 group), A549 cells infected with influenza strain A/PR8/34/(H1N1) alone (PR8 group), and A549 cells both infected with A/PR8/34/(H1N1) and treated with 100
The gene lists generated for influenza A virus-infected human lung epithelial A549 cells in the absence or presence of eleutheroside B1 treatment revealed large differences in the number and the type of genes that were transcriptionally activated. To gain an improved understanding of the host cell response to influenza virus infection at 24 h, the 1,871 DEGs (958 upregulated and 913 downregulated genes) between the PR8 and the PR8 + eleu groups were characterized by performing an enrichment analysis according to biological process, cellular composition and molecular function. GO enrichment analysis indicated that numerous DEGs were involved in molecular function and biological processes, and these results are presented in
Influenza A virus infection in the lung is associated with a robust host inflammatory response and sustained elevated levels of inflammatory immune mediators (
RNA synthesis is a fundamental process in gene expression, and POLR2A, a housekeeping gene coding for the large subunit of RNA polymerase II (RNAPII) in RNA biosynthesis (
Over the course of the last three decades, specific inhibitors of certain enzymes associated with the N-glycan biosynthesis pathway have demonstrated their potential for antiviral and tumor therapy (
Small molecules were docked to these selected proteins, and the docking scores were analyzed. In general, a compound that has a high docking score with the protein (Total Score and CScore) indicates that the compound may have potential activities against the targeted receptor (
To determine its potency, the best-docked conformation of eleutheroside B1 was analyzed, and this molecular compound was found to bind to the inside of
MAN2A1(3BVT) in this docking assay belongs to
Even in the molecular docking assay, human MAN2A1 did not match precisely with eleutheroside B1; however, the possibility of their biological interaction could not be excluded. Therefore, MAN2A1 and POLR2A were selected to examine the CpG methylation levels modified by eleutheroside B1. CpG islands were identified on the POLR2A and MAN2A1 promoters by sequence analysis (
To identify genes involved in novel pathways, such as various types of N-glycan biosynthesis and RNA polymerase function, the expression levels of host genes (MAN2A2, POLR2A) were detected. In glycan biosynthesis and metabolism, MAN2A1, MAN2A2, and MAN2C1 were identified as the important targets. MAN2A1 did not display a potential interaction with eleutheroside B1; MAN2A2, however, was involved in the various types of N-glycan biosynthesis pathways, whereas MAN2C1 was involved in other glycan degradation pathways. POLR2A demonstrated a marked potential interaction with eleutheroside B1 in the present study, and significant levels of expression were observed following influenza infection in A549 cells treated with eleutheroside B1, and influenza infection of the A549 cells in the RNA sequencing studies. Therefore, MAN2A2 and POLR2A were selected for determination of their expression levels. In addition, virus genes (PA, PB1, PB2, HA) in A/PR/8 (0.1 MOI)-infected A549 cells were also subjected to mRNA expression studies. The results demonstrated that the expression of host genes (MAN2A2, POLR2A) and virus genes (PA, PB1, PB2, HA) were decreased following eleutheroside B1 treatment at a concentration of 100
Since a comprehensive analysis of the mechanisms underlying specific agents of TCM acting against influenza virus at the molecular level is difficult, RNA sequencing approaches may compensate for such draw-backs, and provide a systematic analysis for the study of TCM pharmacology in order to identify the key molecular events that are linked with their efficacy (
In the RNA sequencing experiments of the present study, the 1,871 DEGs identified between the PR8 and PR8 + eleu groups were characterized by performing an enrichment analysis according to biological processes, cellular composition, and molecular function. These DEGs were involved in various types of N-glycan biosynthesis, the chemokine signaling pathway, cytokine-cytokine receptor interaction, and RNA polymerase function, which are host responses to influenza viral infection. The biosynthesis of N-glycans is very complex in mammals, as is the glycosylation-mediated quality control of protein folding by N-glycans (
Cytokines are soluble extracellular proteins or glycoproteins that are crucial intercellular regulators and are involved in innate, as well as adaptive, inflammation of host defenses, cell growth, differentiation, cell death, angiogenesis, development and repair processes (
Chemokines are small soluble molecules that regulate cellular homing through molecular gradients (
The influenza virus polymerase performs numerous functions during the virus' life cycle, suggesting that many cellular factors interact with this complex and are required for the viral genome's transcription and replication. POLR2A is one of the influenza virus polymerase-interacting proteins, and is required for viral replication and transcriptional activity of the viral polymerase (
Molecular docking methodology explores the behavior of small molecules in the binding pocket of a target protein, and calculates the ability of the compounds to act against a particular target (and their specificity). In modern drug discovery, molecular docking methodology serves an important role in predicting the orientation of the ligand, and provides potential leads for researchers to identify potential drugs and drug targets (
MAN2A2 is an important enzyme in the N-glycan biosynthesis pathway, and its proper functioning is required for the glycosyltransferases of influenza virus hemagglutinins (
Through recruiting proteins involved in gene repression or inhibiting the binding of transcription factors to DNA, DNA methylation is involved in the regulation of gene expression, mRNA splicing, and genomic stability (
In conclusion, using RNA sequencing technology, the present study demonstrated that eleutheroside B1 may inhibit influenza virus via the chemokine signaling pathway, cytokine-cytokine receptor interactions, N-glycan biosynthesis, and RNA polymerase, and that several DEGs involved in these pathways are interconnected as a part of a network, as illustrated in
This work was supported by the National Natural Science Foundation of China (grant no. U1502226), the Engineering Technology Research Center (Development) of Guangdong general universities (grant no. GCZX-A1408), and a grant from Guangzhou Municipal Science and Technology Program-Technology Benefiting Special (grant no. 2014Y2-00031).
The analyzed datasets generated during the study are available from the corresponding author on reasonable request.
WY, CZ, JH and YW performed the experiments, analyzed the data, prepared figures and tables; WZ, XH and XL contributed to analyze data and prepare figures. WY and YW were involved in the drafting of the manuscript. YW and XW designed the study and reviewed drafts. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
We would like to thank Dr Richard H. Finnell for his help at language editing.
KEGG pathways enriched in response to eleutheroside B1 treatment. Enrichment analysis results of DEGs between the eleutheroside B1 treatment group (PR8 + eleu) and the virus-infected alone group (PR8). DEG, differentially expressed gene; KEGG, Kyoto Encyclopedia of Genes and Genomes.
Enrichment analysis results of DEGs regulated by eleutheroside B1 treatment in cytokine-cytokine receptor interactions pathway. The heat-map shows the 12 DEGs that were regulated by eleutheroside B1 treatment among three samples in the cytokine-cytokine receptor interaction pathway (high levels of expression, red; low expression, blue). DEG, differentially expressed gene.
Enrichment analysis results of DEGs regulated by eleutheroside B1 treatment in the chemokine signaling pathway. The heat-map shows the 24 DEGs that were regulated by eleutheroside B1 treatment among three samples in the chemokine signaling pathway (high levels of expression, red; low expression, blue). DEG, differentially expressed gene.
Enrichment analysis results of DEGs regulated by eleutheroside B1 treatment in various N-glycan biosynthesis pathways. The heat-map shows the 9 DEGs that were regulated by eleutheroside B1 treatment among three samples in various types of N-glycan biosynthesis pathway (high levels of expression, red; low expression, blue). DEG, differentially expressed gene.
Docking results of eleutheroside B1 and MAN2A1. (A) The predicted three-dimensional structure of eleutheroside B1 (rendered by sticks) binding to MAN2A1. (B) The binding interaction of MAN2A1 and the surrounding residues, in which hydrogen donors are shown in pink and hydrogen acceptors are shown in green. The rest of the surface is white. (C) Details of the interaction between eleutheroside B1 and MAN2A1, as well as the hydrophobicity, which is shown in a different color, from the highest lipophilic area (brown) to the highest hydrophilic area (blue). MAN2A1, mannosidase α class II member 1.
Docking results of eleutheroside B1 and POLR2A. (A) The predicted three-dimensional structure of eleutheroside B1 (rendered in sticks) binding to POLR2A. (B) The interaction between eleutheroside B1 and POLR2A, as well as the hydrophobicity, which is shown in a different color, from the highest lipophilic area (brown) to the highest hydrophilic area (blue). (C) The binding interaction of POLR2A and the surrounding residues, in which hydrogen donors are shown in pink and hydrogen acceptors are shown in green. The rest of the surface is white. POLR2A, RNA polymerase II subunit A.
Prediction of CpG islands and effects of eleutheroside B1 on DNA methylation of POLR2A in virus-infected A549 cells. POLR2A, RNA polymerase II subunit A. The white circles are unmethylated sites and the black circles are methylated sites. *P<0.05 compared with the PR8 group.
Effect of eleutheroside B1 on host and viral gene expression. (A and B) mRNA expression levels of the host genes (MAN2A2, POLR2A) and (C-F) the viral genes (HA, PB2, PB1, PA) was examined in the virus-infected A549 cells, with or without eleutheroside B1 treatment. *P<0.05 compared with the PR8 group. MAN2A1, mannosidase α class II member 1; POLR2A, RNA polymerase II subunit A.
Protein interaction map for differentially expressed genes in target pathways. The map was constructed using the String website (
Primer sequences.
Gene | Primer | Sequence (5′-3′) |
---|---|---|
PA | Forward | ACACTACAGGGGCTGAGAAA |
Reverse | TGAACGAGAAAATGTGGATG | |
PB1 | Forward | AGTTTTGGTGTGTCTGGGA |
Reverse | TTCGGGTTTGTATTTGTGTG | |
PB2 | Forward | ACCCAGATGAAGGCACAG |
Reverse | TAGAGTCCCGTTTTCGTTTC | |
POLR2A | Forward | GATGAACTGAAGCGAATGTCT |
Reverse | GTCGTCTCTGGGTATTTGATG | |
HA | Forward | TGAACAGGGAAAAGGTAGATG |
Reverse C | AGGGAGACCAAAAGCAC | |
MAN2A2 | Forward | GCCCTCATTTTCTGTTTATTG |
Reverse C | TGCCCTATTTACCCATCAC | |
GAPDH | Forward | GCTGAGTATGTTGTGGAGTC |
Reverse | GCAGAAGGAGCAGAGATGA |
POLR2A, RNA polymerase II subunit A; HA, hemagglutinin; MAN2A1, mannosidase α class II member 1.
RNA-seq overview: Reads mapping quality summary.
Sample name | Total reads | Total bases | Mapped reads | Mapped rate (%) | Proper paired mapped | Singletons | MAPQ≥5 rate (%) | Discordantly mapped |
---|---|---|---|---|---|---|---|---|
A549 | 34753376 | 5.21E+09 | 33748010 | 97.11 | 33748010 | 0 | 95.26 | 0 |
PR8 | 33971006 | 5.1E+09 | 32589740 | 95.93 | 32589740 | 0 | 94.10 | 0 |
PR8+eleu | 34797038 | 5.22E+09 | 33215018 | 95.45 | 33215018 | 0 | 93.40 | 0 |
Significantly enriched GO terms in response to eleutheroside B1.
GO description | P-value | Number of genes |
---|---|---|
Oxidoreductase activity, acting on the CH-NH group of donors, NAD or NADP as acceptor | 0.001378 | 6 |
Heterocycle biosynthetic process | 0.001468 | 119 |
Aromatic compound biosynthetic process | 0.001584 | 118 |
Organic cyclic compound biosynthetic process | 0.001615 | 119 |
Oxidoreductase activity, acting on the CH-NH group of donors | 0.002303 | 6 |
DNA ligase activity | 0.002306 | 4 |
DNA ligation | 0.002306 | 4 |
DNA ligase (ATP) activity | 0.002306 | 4 |
Binding | 0.002597 | 754 |
Molecular function | 0.002715 | 952 |
Intra-Golgi vesicle-mediated transport | 0.003632 | 6 |
Establishment of protein localization to Golgi | 0.003993 | 5 |
Protein targeting to Golgi | 0.003993 | 5 |
Retrograde transport, vesicle recycling within Golgi | 0.003993 | 5 |
Protein localization to Golgi apparatus | 0.003993 | 5 |
Double-stranded RNA-specific ribonuclease activity | 0.004917 | 4 |
Ribonuclease III activity | 0.004917 | 4 |
Methylenetetrahydrofolate dehydrogenase (NADP+) activity | 0.004917 | 4 |
Negative regulation of transcription, DNA-templated | 0.005146 | 5 |
Negative regulation of gene expression | 0.005146 | 5 |
Negative regulation of nucleic acid-templated transcription | 0.006515 | 5 |
Negative regulation of RNA metabolic process | 0.006515 | 5 |
Negative regulation of RNA biosynthetic process | 0.006515 | 5 |
Ligase activity, forming phosphoric ester bonds | 0.006757 | 4 |
Nucleobase-containing compound biosynthetic process | 0.007534 | 110 |
RNA phosphodiester bond hydrolysis, endonucleolytic | 0.00998 | 5 |
Endoribonuclease activity | 0.00998 | 5 |
NADP biosynthetic process | 0.010598 | 3 |
NAD+ kinase activity | 0.010598 | 3 |
Formate-tetrahydrofolate ligase activity | 0.010598 | 3 |
Regulation of neurotransmitter levels | 0.011107 | 2 |
Argininosuccinate synthase activity | 0.011107 | 2 |
Methylenetetrahydrofolate reductase (NAD(P)H) activity | 0.011107 | 2 |
Gamma-tubulin binding | 0.011107 | 2 |
Pteridine-containing compound biosynthetic process | 0.011677 | 4 |
Folic acid-containing compound biosynthetic process | 0.011677 | 4 |
Folic acid-containing compound metabolic process | 0.011677 | 4 |
DNA topoisomerase type I activity | 0.015169 | 3 |
Ligase activity, forming carbon-nitrogen bonds | 0.015411 | 9 |
Regulation of Ras protein signal transduction | 0.016281 | 16 |
Ras protein signal transduction | 0.016281 | 16 |
regulation of cellular process | 0.016648 | 193 |
Ion binding | 0.016903 | 192 |
Regulation of small GTPase mediated signal transduction | 0.017061 | 18 |
Regative regulation of cellular macromolecule biosynthetic process | 0.017259 | 5 |
Regulation of developmental process | 0.017259 | 5 |
Metal ion binding | 0.017719 | 188 |
Endoribonuclease activity, producing 5′-phosphomonoesters | 0.018441 | 4 |
NADP metabolic process | 0.018441 | 4 |
Cation binding | 0.019467 | 188 |
Regulation of biological process | 0.019795 | 193 |
Negative regulation of biosynthetic process | 0.020303 | 5 |
Negative regulation of cellular biosynthetic process | 0.020303 | 5 |
Negative regulation of nitrogen compound metabolic process | 0.020303 | 5 |
Negative regulation of nucleobase-containing compound metabolic process | 0.020303 | 5 |
Negative regulation of macromolecule biosynthetic process | 0.020303 | 5 |
DNA-directed RNA polymerase II, core complex | 0.021299 | 2 |
Pteridine-containing compound metabolic process | 0.022568 | 4 |
Exonuclease activity | 0.023676 | 5 |
Biological regulation | 0.02412 | 201 |
Heterocycle metabolic process | 0.024922 | 168 |
Cellular aromatic compound metabolic process | 0.025948 | 168 |
Quanyl-nucleotide exchange factor activity | 0.02599 | 18 |
Sulfur compound transmembrane transporter activity | 0.027145 | 3 |
Organic cyclic compound metabolic process | 0.028103 | 168 |
Cellular nitrogen compound biosynthetic process | 0.028363 | 129 |
ARF guanyl-nucleotide exchange factor activity | 0.031456 | 5 |
Regulation of ARF protein signal transduction | 0.031456 | 5 |
ARF protein signal transduction | 0.031456 | 5 |
GDP binding | 0.031599 | 18 |
Hydrolase activity, acting on ester bonds | 0.031838 | 40 |
Regulation of intracellular signal transduction | 0.031966 | 19 |
Transmembrane receptor protein serine/threonine kinase activity | 0.032389 | 4 |
Regulation of multicellular organismal development | 0.032389 | 4 |
Taurine transmembrane transporter activity | 0.034046 | 2 |
Negative regulation of blood vessel morphogenesis | 0.034046 | 2 |
Calcium-dependent protein binding | 0.034046 | 2 |
Taurine:sodium symporter activity | 0.034046 | 2 |
Negative regulation of angiogenesis | 0.034046 | 2 |
Histamine receptor activity | 0.034046 | 2 |
Negative regulation of vasculature development | 0.034046 | 2 |
Neurotransmitter transporter activity | 0.034554 | 3 |
Neurotransmitter:sodium symporter activity | 0.034554 | 3 |
Mannose metabolic process | 0.034554 | 3 |
Organic acid:sodium symporter activity | 0.034554 | 3 |
Hormone receptor binding | 0.0381 | 4 |
Wnt signaling pathway | 0.0381 | 4 |
Nuclear hormone receptor binding | 0.0381 | 4 |
Molecular function regulator | 0.038432 | 32 |
DNA biosynthetic process | 0.039752 | 6 |
Phosphatase regulator activity | 0.040667 | 5 |
Intrinsic component of plasma membrane | 0.040951 | 7 |
Integral component of plasma membrane | 0.040951 | 7 |
DNA topological change | 0.042894 | 3 |
Aspartate family amino acid metabolic process | 0.042894 | 3 |
Signal transduction | 0.042957 | 97 |
Coenzyme biosynthetic process | 0.044016 | 8 |
Pyridine nucleotide biosynthetic process | 0.044349 | 4 |
Pyridine-containing compound biosynthetic process | 0.044349 | 4 |
Nicotinamide nucleotide biosynthetic process | 0.044349 | 4 |
Anatomical structure morphogenesis | 0.044349 | 4 |
Single organism signaling | 0.044355 | 97 |
Cellular response to stimulus | 0.045164 | 111 |
Signaling | 0.046516 | 97 |
Transcription, DNA-templated | 0.048815 | 90 |
IMP dehydrogenase activity | 0.048989 | 2 |
Negative regulation of developmental process | 0.048989 | 2 |
Nucleoside phosphate biosynthetic process | 0.049767 | 13 |
Nucleotide biosynthetic process | 0.049767 | 13 |
GO, Gene Ontology.
Score of molecular docking.
Protein | Total_Score | CSCORE | UNIFIED-CECORER |
---|---|---|---|
MAN2A1 | 11.3029 | 5 | 3 |
POLR2A | 9.0133 | 5 | 2 |
MAN2A1, mannosidase α class II member 1; POLR2A, RNA polymerase II subunit A.