Liver fibrosis is a serious threat to human health, and there is currently no effective clinical drug for treatment of the disease. Although Galectin-1 is effective, its role in liver function, inflammation, matrix metalloproteinases and the activation of hepatic stellate cells (HSCs) remains to be elucidated. The aim of the present study was to elucidate the effect of Galectin-1 on the activation, proliferation and apoptosis of HSCs in a mouse model of liver fibrosis. Following successful model establishment and tissue collection, mouse HSCs (mHSCs) were identified and an mHSC line was constructed. Subsequently, to determine the role of Galectin-1 in liver fibrosis, the expression levels of transforming growth factor (TGF)-β1, connective tissue growth factor (CTGF) and α-smooth muscle actin (α-SMA) pre- and post-transfection were evaluated by reverse transcription-quantitative polymerase chain reaction and western blot analyses. In addition, the effects of Galectin-1 on the biological behavior and mitochondrial function of mHSCs were determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, flow cytometry and a scratch test. It was first observed that the expression levels of Galectin-1, TGF-β1, CTGF and α-SMA were downregulated by silencing the gene expression of Galectin-1. Additionally, silencing the gene expression of Galectin-1 inhibited cell cycle progression, proliferation and migration but induced the apoptosis of mHSCs from mice with liver fibrosis. Furthermore, the
Liver fibrosis is a prolonged injury that occurs in combination with superfluous scar deposition inside the hepatic parenchyma, which is caused by an excessive wound healing response triggered by activated myofibroblasts (
As a multivalent carbohydrate binding protein, Galectin-1 mediates malignant cellular activities by regulating the cross-linking of glycoproteins in the tumor microenvironment (
The present study was performed in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital, Zhejiang University School of Medicine (Zhejiang, China). Significant efforts were made to minimize the number of animals used and their respective suffering.
A total of 32 male C57BL/6J mice (age: 8 weeks; weight: 25-30 g) were purchased from Laboratory Animal Center of Zhejiang University (Zhejiang, China). The mice were housed at 22°C and 55% humidity, and had normal circadian rhythm light exposure and free access to water and food. A total of 22 mice were selected for liver fibrosis model establishment using the following method: 20 ml of carbon tetrachloride (CCl4) liquid was mixed with 30 ml of olive oil, which was stirred with a magnetic stirrer for 8-12 h to prepare a 40% CCl4 olive oil suspension. The liver fibrosis model was established via an intraperitoneal injection of the 40% CCl4 olive oil suspension (2; 0.8 ml/kg CCl4) twice per week. None of the animals died during the model establishment process. The model establishment lasted for 6 weeks, following which time the mice were sacrificed, and their livers were removed. The edge of liver became blunt according to the observation by naked eyes. The liver presented with a white color and greasy surface. Liver tissues of mice in each group were fixed in formaldehyde (cat. no. 30525-89-4; Shanghai Aladdin Bio-Chem Technology Co., Ltd., Shanghai, China) for 6 h at room temperature, paraffin-embedded, and sliced into 5-
The mice selected from the two groups were anaesthetized intraperitoneally with 2% sodium pentobarbital (cat. no. WS20051129; Sinopharm Group Chemical Reagent Co., Ltd., Shanghai, China), and 0.5 ml of blood was collected from the abdominal aorta via a tube. The blood was incubated at room temperature for 30 min and was then centrifuged (2,192 × g) for 15 min at room temperature to separate the serum. The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBil) and albumin (ALB) were measured using an ALT ELISA kit (cat. no. YS01266B, Y-J Biological Company, Shanghai, China), an AST ELISA kit (cat. no. SBJ-M0078; Nanjing SenBeiJia Biological Technology Co., Ltd., Jiangsu, China), a TBil ELISA kit (cat. no. YS05110B; Shanghai Caiyou Industrial Co., Ltd., Shanghai, China) and an ALB ELISA kit (cat. no. ab108792; Abcam, Cambridge, MA, USA), respectively. The ELISA kits were placed at the room temperature for 20 min, and the washing liquid was prepared. Following dissolving of the standard samples, 100
The mice were sacrificed in the 6th week following model establishment, and their hepatic tissues were removed, fixed with 4% formaldehyde (cat. no. 30525-89-4; Shanghai Aladdin Biochemical Technology Co., Ltd., Shanghai, China) for 6 h, soaked in wax, embedded, and cut into sections (5-
The mouse liver tissues selected from each group were fixed with 4% paraformaldehyde (cat. no. 30525-89-4; Shanghai Aladdin Biochemical Technology Co., Ltd.), conventionally dehydrated, cleaned, soaked in wax, embedded, sectioned (thickness, 5
The paraffin tissue sections were routinely dewaxed and dehydrated with gradient alcohol. Subsequently, 0.02 mol/l citrate buffer (pH 6.0) was used for antigen retrieval for 15 min. The sections were then washed with phosphate-buffered saline (PBS) three times (5 min/wash), sealed with 3% peroxidase for 10 min, washed again with PBS three times (5 min/wash), and sealed with 10% goat serum (cat. no. C-0005; Shanghai Haoran Biotechnology Co., Ltd., Shanghai, China) for 30 min. The rabbit anti-α-SMA primary antibody (cat. no. ab32575; 1:200) and rabbit anti-Desmin primary antibody (cat. no. ab32362, 1:2,000) (both from Abcam) were then added, and the samples were incubated overnight at 4°C. Following three PBS washes (5 min/wash), the sections were incubated with the goat anti-rabbit secondary antibody (cat. no. ab205718, 1:2,000; Abcam) for 1 h at room temperature in the dark, rinsed three times with PBS (5 min/wash), treated with diluted 4′,6-diamidino-2-phenylindole (1:100), incubated at room temperature for 20-30 min in the dark, washed with PBS three times (5 min/wash) and sealed with 60% glycerol. The samples were observed under a fluorescence microscope (GFM: 600; Shanghai Optical Instrument Co., Ltd., Shanghai, China), and cells with a visible yellow-stained cytoplasm or cell membrane were considered positive. A total of four fields in each section were randomly selected (magnification, ×200), with 200 cells per field. The percentage of positive cells=positive liver cells/total liver cells. When the percentage was >10%, it was regarded as positive (+); otherwise, it was negative (−) (
Total RNA from the liver sample tissues was extracted using the TRIzol one-step method according to the manufacturer’s protocol of the TRIzol kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The RNA was dissolved in ultrapure water treated with diethyl-pyrocarbonate (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd., Shanghai, China), and the absorbance was measured using an ND-1000 ultraviolet/visible spectrophotometer (Thermo Fisher Scientific Inc.) at wavelengths of 260 and 280 nm. The quality and concentration of the total RNA were determined. The extracted RNA was used for RT by the two-step method according to the manufacturer’s protocol of the kit (cat. no. RR037Q; Takara Biotechnology Co., Ltd., Dalian, Liaoning, China). The RT reaction was as follows: 2
Proteins from liver sample tissues from the groups were extracted using 3 ml of lysis buffer comprising well-mixed solution containing 7 mol/l urea, 2 mol/l thiourea, 5 ml/l isocratic pH gradient buffer (pH 3-10), 65 mmol/l dithiothreitol, 40 g/l 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate, 5 mg/l protease inhibitor and 10 ml/l trypsin inhibitor, and homogenized on ice. The samples were then centrifuged (120,000 g) for 30 min at 4°C to obtain the liquid supernatant, and the protein concentration was measured using the BCA method. The proteins were then mixed with 5X sodium dodecyl sulfate (cat. no. P0013G, Beyotime Institute of Biotechnology, Shanghai, China) at 100°C for 5 min to inactivate the protein. Subsequently, 20
The mice in the normal and model groups were randomly selected for isolating the HSCs (
A recombinant vector with a Galectin-1 overexpression plasmid was constructed as follows: Total RNA was extracted using TRIzol and reverse transcribed to obtain the cDNA. The Galectin-1 target gene was amplified by PCR, and the sequences of the amplified primers were as follows: Forward, 5′-CTC GCT CGA GGT CTT CTG ACT GCT GGT GG-3′ and reverse, 5′-AGA GCG ATC CGC CTT TAT TGA GGG CTA CA-3′. Then, a total of 50
The recombinant vector containing the Galectin-1 low-expression plasmid was constructed as follows: Using Galectin-1 as the target, the sequences for the short hairpin (sh)RNAs (shRNA1, shRNA2, and shRNA3) and the negative control (NC) plasmids were designed as follows: shRNA1, 5′-CTA TGA CGA TCC CTT CGT GCA CTC-3′; shRNA2, 5′-CGG ACC TGT GCT ACA CTT CAA CTC-3′; shRNA3, 5′-AGA CGG ACA TGA ATT CAA GTT CTC-3′ and NC, 5′-AAG GTT AAG TCG CCC TCG CTC-3′. The shRNA sequences and the NC sequences were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. The shRNA and NC sequences were inserted into the pLVTHM plasmid and detached by
The Galectin-1 overexpression vector and the shRNA with the optimal interference were used to construct lentiviral vectors overexpressing Galectin-1 and Galectin-1-shRNA; these were then used for cotransfection with a lentivirus-coated plasmid into 293T cells via the following liposome method: At 12 h prior to transfection, the 293T cells were plated onto 6-well plates at a density of 5×105 cells/well in DMEM supplemented with 5% FBS. Subsequently, 20
The mHSCs were assigned into normal (mHSCs isolated from healthy mice), model (mHSCs isolated from the mouse model), NC (empty plasmid-cotransfected mHSCs from the mouse model), overexpressed Galectin-1 (Galectin-1 overexpression plasmid-cotransfected mHSCs from the mouse model), sh-Galectin-1 (Galectin-1 low-expression plasmid-cotransfected mHSCs from the mouse model) and sh-NC (Galectin-1 NC shRNA plasmid-cotransfected mHSCs from the mouse model) groups.
When the cells were infected for 24 h and the cell confluence reached 80%, the cells were washed twice with PBS, detached with 0.25% trypsin and made into a single cell suspension. Following counting, 3×103-6×103 cells were seeded per well (200
Cell apoptosis was detected by flow cytometry following 48 h of cell infection in each group. The cells were then detached with protease solution and observed under an inverted microscope (TS100; Olympus Corporation, Tokyo, Japan) for cell changes, namely, shrinking to round. Subsequently, the digestion solution was discarded and the serum solution was added to terminate the detachment. The cells were then gently scraped from the wall in the cell suspension, centrifuged (179 × g) for 5 min at room temperature and the liquid supernatant was eliminated. Following two PBS washes, the cells were fixed with precooled 70% ethanol for 30 min, collected following centrifugation (179 × g) for 5 min at room temperature and washed with PBS. Subsequently, 1% iodized ethidium containing RNA enzyme was used to stain the cells (cat. no. 40711ES10; Yeasen Biotechnology, Shanghai, China) for 30 min, and the cells were washed with PBS twice for PI elimination. PBS was then used to adjust the volume to 1 ml. The samples were analyzed on a BD-Aria FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) to detect cell apoptosis, with three samples in each group. Each experiment was repeated three times.
Horizontal lines were drawn behind a 6-well plate with a marker at a distance interval of 0.5-1 cm. Following this, 3×104 cells were seeded onto the 6-well plate and cultured overnight. When the cell confluence reached 80-90% the following day, scratches perpendicular to the horizontal scratches were made using a spearhead. Following 48 h of continuous culture, a field containing eight scratches was then randomly selected, and the cell motility conditions close to the scratches were observed and images captured. Motic Images Advanced 3.2 software was used to detect the relative width of the scratches, reflecting the cell migration ability. Each experiment was repeated at least three times.
Following 48 h of infection in each group, Rhodamine 123 was added to a final concentration of 10
A total of 12 mice with hepatic fibrosis were classified into the sh-NC group or sh-Galectin-1 group. Following 6 weeks of modeling, the mice in the sh-NC group were injected with sh-NC (0.3 mg per body weight) via their tail vein, and the mice in the sh-Galectin-1 group were injected with sh-Galectin-1 (0.3 mg per body weight) via their tail vein. After 3 days, ELISA was performed to measure the expression levels of ALT, AST, TBi1 and ALB in the serum of the mice in each group. Following sacrifice of the mice, the liver tissues were harvested for H&E staining and Masson staining. In addition, the positive rates of α-SMA and Desmin protein expression were determined by immunohistochemistry, and the level of Galectin-1 was assessed using a western blot assay.
All data were analyzed using the SPSS 21.0 statistical analysis software (IBM SPSS, Armonk, NY, USA). The data are expressed as the mean ± standard deviation. One-way analysis of variance (ANOVA) was used for comparisons among multiple groups; the Turkey post hoc test was used following ANOVA to compare two specific groups among multiple groups. Student’s t-test was used for comparisons between two groups. P<0.05 was considered to indicated a statistically significant difference.
Initially, the serum levels of ALT, AST, TBil and ALB in each group were measured by ELISA (
H&E staining (
Subsequently, the mHSCs were identified. Under a fluorescence microscope, >90% percent of the cells emitted a blue-green fluorescence (
Compared with those in the NC group, the overexpression group had elevated mRNA and protein expression levels of Galectin-1 (P<0.05), indicating that it was suitable for use to construct mHSC lines stably expressing the overexpressed Galectin-1 plasmid (
To investigate the effect of Galectin-1 on mHSCs, RT-qPCR and western blot assays were performed, and the results are presented in
Subsequently, the impact of Galectin-1 on mHSC proliferation was determined using the MTT and western blot assays. The MTT results (
To examine how the cell cycle and apoptosis of mHSCs were affected by Galectin-1, flow cytometry and western blot assays were performed. The flow cytometry results (
Rhodamine 123 staining and flow cytometry were utilized to assess the cell mitochondrial membrane potential. Compared with the normal group, the mitochondrial MFI in the other five groups exhibited a significant increase (all P<0.05). Compared with the model group, no notable change in the MFI was observed in the sh-NC and NC groups (P>0.05), however, the MFI in the overexpressed Galectin-1 group was significantly increased and that in the sh-Galectin-1 group was significantly decreased (P<0.05) (
In addition, a scratch test was used to determine changes in the migration abilities of the mHSCs. The scratch test results (
Finally, H&E staining, Masson staining, immunohistochemistry and ELISA were performed to observe the effect of Galectin-1 on liver fibrosis. As shown in
Liver fibrosis is a chronic progressive liver disease that results from one or more etiologies, including autoimmune reactions, alcohol, viruses, long-term drug damage, parasites, and the repeated impact of liver damage (
The present study found that mice with liver fibrosis had increased expression levels of ALT, AST and Tbil, but showed reduced expression of ALB. ALT is a liver enzyme commonly used to screen for hepatic disease and liver injury in humans (
In the present study, Galectin-1 silencing decreased the mRNA and protein expression levels of TGF-β1, CTGF and α-SMA, but increased that of ALB. The expression of Galectin-1, carbohydrate-binding protein, which has an affinity for β-galactoside, is high among isolated activated pancreatic stellate cells (
Furthermore, the silencing of Galectin-1 inhibited the proliferation and migration and induced the apoptosis of mHSCs. High serum levels of Galectin-1 correlate with tumor aggression (
Not applicable.
This study was supported by the National Natural Science Foundation of China (grant no. 81471581) and Research on Public Welfare Technology and the Social Development Project of Zhejiang Provincial Bureau of Science and Technology (grant no. 2015C33151).
The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.
ZJJ, QHS, HYC and ZY participated in the design and funding applications. MQS and SSZ performed analysis and interpretation of data. ZJJ, QHS and HYC obtained and validated the results. ZY, MQS and SSZ wrote revised the manuscript. All authors read and approved the final manuscript.
The present study was performed in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital, Zhejiang University School of Medicine.
Not applicable.
The authors declare that they have no competing interests.
Successful establishment of the mouse model of liver fibrosis. (A) Hematoxylin and eosin staining results confirmed that the mice in the normal group had no obvious inflammatory cell infiltration, whereas mice in the model group had inflammatory cell infiltration (magnification, ×200). (B) Masson staining results suggested that mice in the normal group had normal liver tissue with a low degree of fibrosis, whereas mice in the model group had significantly increased liver fibrosis (magnification, ×200). (C) Immunohistochemistry results verified that mice in the normal group had a relatively small number of cells with α-SMA- and Desmin-positive expression, whereas mice in the model group had increased positive expression of α-SMA and Desmin (magnification, ×200);*P<0.05 vs. normal group. α-SMA, α-smooth muscle actin.
Purity and viability of mouse HSCs. (A) Expression of Desmin in the isolated HSCs under a fluorescence microscope in the normal group (magnification, ×200). (B) Expression of desmin in the isolated HSCs under a fluorescence microscope in the model group (magnification, ×200); HSCs, hepatic stellate cells.
Establishment of mouse hepatic stellate cell lines stably expressing Galectin-1 at low or high levels. (A) RT-qPCR results show that the mRNA expression level of Galectin-1 was higher in the overexpressed Galectin-1 groups. (B) A western blot assay and (C) quantification of results confirmed that the protein expression level of Galectin-1 was higher in the overexpressed Galectin-1 groups; *P<0.05 vs. control group. (D) RT-qPCR results that the mRNA expression level of Galectin-1 was highest for shRNA1 among the shRNA groups. (E) A western blot assay and (F) quantification confirmed that the protein expression level of Galectin-1 was highest for shRNA1 among the shRNA groups;*P<0.05 vs. sh-NC group; #P<0.05 vs. shRNA1 group; &P<0.05 vs. shRNA2 group. sh, short hairpin RNA; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
Downregulation of Galectin-1 inhibits expression of Galectin-1, TGF-β1, CTGF and α-SMA in mHSCs. (A) Reverse transcription-quantitative polymerase chain reaction analysis confirmed that silencing Galectin-1 downregulated the mRNA expression levels of Galectin-1, TGF-β1, CTGF and α-SMA in mHSCs. (B) A western blot assay and (C) quantification confirmed that silencing Galectin-1 downregulated the protein expression levels of Galectin-1, TGF-β1, CTGF and α-SMA in mHSCs. *P<0.05 vs. normal group; #P<0.05 vs. model group. mHSCs, mouse hepatic stellate cells; TGF-β1, transforming growth factor-β1; CTGF, connective tissue growth factor; α-SMA, α-smooth muscle actin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; sh, short hairpin RNA; NC, negative control.
Galectin-1 silencing is a negative factor for mouse hepatic stellate cell proliferation. (A) An MTT assay confirmed that proliferation was inhibited by a low expression of Galectin-1; (B) Results of the western blot assay and (C) quantification confirmed that the protein expression level of PCNA was downregulated by the low expression of Galectin-1. *P<0.05 vs. normal group; #P<0.05 vs. model group. PCNA, proliferating cell nuclear antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; sh, short hairpin RNA; NC, negative control; OD, optical density.
Silencing the expression of Galectin-1 increases cell apoptosis and delays cell cycle progression in mouse hepatic stellate cells. (A) Flow cytometric analysis and (B) quantification showed that a low the expression of Galectin-1 suppressed cell cycle progression. (C) Flow cytometric analysis confirmed that a low expression of Galectin-1 accelerated cell apoptosis; (D) apoptotic rate in each group; (E) Bcl-2, cleaved caspase-3 and caspase-3 protein bands in each group; (F) levels of Bcl-2 and cleaved caspase-3/caspase-3 in each group; *P<0.05 vs. normal group; #P<0.05 vs. model group. sh, short hairpin RNA; NC, negative control; Bcl-2, B-cell lymphoma-2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Silencing the expression of Galectin-1 inhibits mitochondrial function in mouse hepatic stellate cells. *P<0.05 vs. normal group; #P<0.05 vs. model group. sh, short hairpin RNA; NC, negative control; MFI, mean fluorescence intensity.
Silencing Galectin-1 has a negative effect on mouse hepatic stellate cell migration. (A) Scratch test demonstrated that cell migration was delayed by a low expression of Galectin-1. (B) Graph showing rate of wound healing. *P<0.05 vs. normal group; #P<0.05 vs. model group. sh, short hairpin RNA; NC, negative control.
Silencing the expression of Galectin-1 ameliorates liver fibrosis. (A) Hematoxylin and eosin staining results verified that mice in the sh-Galectin-1 group had a small amount of inflammatory cell infiltration (magnification, ×200). (B) Masson staining results verified that mice in the sh-Galectin-1 group had significantly decreased liver fibrosis (magnification, ×200). (C) Immunohistochemistry results verified that mice in the sh-Galectin-1 group had decreased positive expression for α-SMA and Desmin (magnification, ×200). (D) ELISA demonstrated that the expression levels of ALT, AST and Tbil were decreased, whereas that of ALB was increased by Galectin-1 gene silencing. (E) Western blot assay results demonstrated that Galectin-1 was expressed at a low level in the sh-Galectin-1 group;*P<0.05 vs. sh-NC group. α-SMA, α-smooth muscle actin; ALT, alanine aminotransferase; AST, aspartate aminotransferase; ALB, albumin; TBil, total bilirubin; sh, short hairpin RNA; NC, negative control.
Reverse transcription-quantitative polymerase chain reaction primer sequences.
Gene | Sequence (5′-3′) |
---|---|
Galectin-1 | F: GCCAGCAACCTGAATCTC |
R: AGGCCACGCACTTAATCT | |
TGF-β1 | F: CAACAATTCCTGGCGTTACCTTGG |
R: GAAAGCCCTGTATTCCGTCTCCTT | |
CTGF | F: CTCCACCCGAGTTACCAATGACAA |
R: CCAGAAAGCTCAAACTTGACAGGC | |
α-SMA | F: ACTGGGACGACATGGAAAAG |
R: CATCTCCAGAGTCCAGCACA | |
PCNA | F: AACTTGGAATCCCAGAACA |
R: AGACAGTGGAGTGGCTTTT | |
Bcl-2 | F: GACAGAAGATCATGCCGTCC |
R: GGTACCAATGGCACTTCAAG | |
Caspase-3 | F: CTAAGCCATGGTGATGAAGGG |
R: CTGCAAAGGGACTGGATGAAC | |
β-actin | F: GCTGTCCCTGTATGCCTCT |
R: GGTCTTTACGGATGTCAACG |
TGF-β1, transforming growth factor-β1; CTGF, connective tissue growth factor; α-SMA, α-smooth muscle actin; PCNA, proliferating cell nuclear antigen; Bcl-2, B-cell lymphoma-2; ALT, alanine amino-transferase; AST, aspartate aminotransferase; TBil, total bilirubin; F, forward; R, reverse.
Mice with liver fibrosis have increased levels of ALT, AST and TBil, and decreased levels of ALB.
Factor | Normal group | Model group | P-value |
---|---|---|---|
ALT (U/l) | 47.53±4.02 | 225.43±19.02 | <0.05 |
AST (U/l) | 60.75±16.14 | 249.89±24.22 |
<0.05 |
TBil ( |
0.63±0.40 | 6.43±0.53 |
<0.05 |
ALB (g/l) | 26.16±2.21 | 17.58±1.62 | <0.05 |
P<0.05 model group, compared with the normal group. ALT, alanine aminotransferase; AST, aspartate aminotransferase; TBil, total bilirubin; ALB, albumin.