The present study aimed to explore the underlying mechanisms of bone morphogenetic protein 2 (BMP2) in alleviating intervertebral disc degeneration (IDD). A rat puncture IDD model was constructed, and the rats were randomly divided into six groups: Control; IDD (model); IDD+PBS [containing 1010 adeno-associated virus serotype 2 (AAV)]; and IDD + AAV2-BMP2 (106, 108 and 1010). IL-1β was used to treat primary nucleus pulposus (NP) cells to mimic IDD
Intervertebral discs are the primary component of the human spine, which provides mechanical support and spinal motion for daily activities (
The extracellular matrix (ECM) primarily consists of proteoglycans, aggrecan, collagens and matrix metalloproteinases (MMPs) in NP. Degradation of the ECM, particularly collagen II and aggrecan, is considered to be an important cause of IDD (
Bone morphogenetic proteins (BMPs) belong to the transforming growth factor β (TGF-β) family, and are commonly known to function as underlying regulators of bone and cartilage formation (
In light of the aforementioned data, the present study aimed to explore the underlying mechanisms of BMP2 in alleviating IDD in a rat model and NP cells
The 293T cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), and maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) in a humidity incubator at 37°C with 5% CO2. Subsequently, 1
The experimental procedures of the present study were approved by the Second Xiangya Hospital, Central South University (Changsha, China). All the procedures involving animals and their care were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of the Second Xiangya Hospital, Central South University. A total of 48 male Lewis rats aged 13-14 weeks were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China), and housed in a 12-h light/dark cycle sterile room at ~23°C with access to food and water
A total of 2 months after surgery, rats were anesthetized as aforementioned to limit movement during the MRI examination. Images were obtained using a 3.0 T MRI machine (Philips Healthcare, Amsterdam, The Netherlands) with a dedicated coil for small animals. Following this, the tails of the rats were immersed in 0.1 M CuSO4 solution in a tube, to increase the contrast of image. Subsequently, a 2-D spin echo-dual echo sequence was performed with the following parameters: Repetition time=9,000 ms, flip angle=90°, echo times=16 and 80 ms, slice thickness=0.6, number of averages=2, field of view=40×40 mm2, and in-plane resolution=0.1 mm with 30 sagittal slices. The disc signal intensity was calculated by using the T2-weighted image (echo time=80 ms) to monitor the disc hydration. Then, the mean signal intensity (brightness) in the control disc was used as reference for the signal intensity of the injured discs in each group. Therefore, the value of normalized intensity for the injured discs ranged from 0-1, as described previously (
Following MRI examination, rats were sacrificed and the whole discs with the vertebrae adjacent to the punctured C6-C7 and C8-C9, and non-punctured C7-C8 were isolated, fixed with 4% paraformaldehyde at 4°C for 24 h, decalcified in 10% EDTA for 30 days, embedded in paraffin and cut into 5-
NP cells were isolated as described previously (
For treatment, NP cells were first treated with different concentrations of recombinant human BMP2 (rhBMP2; 0, 25, 50, 100, 200, 400 and 800 ng/ml) to assess the effects of rhBMP2 on cell proliferation, and for the selection of appropriate concentrations for subsequent experimentation. NP cells were treated with 10 ng/ml interleukin 1β (IL-1β; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) to imitate the IDD model
NP cells were seeded in 96-well plates at a density of 1.0×103/well and cultured with complete DMEM medium containing different concentrations of rhBMP2 (0, 25, 50, 10 0, 200, 400 and 800 ng/ml). Then, cells were cultured for 24 and 48 h. Subsequently, 20
The apoptosis of cells was determined by flow cytometry with Kaluza 2017 Analysis Software 1.3 (Beckman Coulter, Inc., Brea, CA, USA) following staining with fluorescein isothiocyanate (FITC)-conjugated Annexin V and propidium iodide (PI; Beyotime Institute of Biotechnology, Haimen, China). Briefly, 1×106 cells were seeded in 6-well plates with DMEM containing 10% FBS overnight at 37°C. Then, cells were treated with rhBMP2 and IL-1β as aforementioned for 48 h. Following this, the cells were stained using the FITC Annexin V/PI apoptosis Detection kit I (BD Pharmingen; BD Biosciences, Franklin Lakes, NJ, USA) for 20 min at room temperature according to the manufacturer’s protocol. Subsequently, the levels of apoptosis of the cells were detected using flow cytometry. Annexin V+ cells were considered early apoptotic cells, Annexin V+/PI+ cells were considered end-stage apoptotic cells and PI+ cells were considered necrotic cells.
Total RNA was extracted from rat NP tissues and cells using TRIzol® reagent (Life Technologies; Thermo Fisher Scientific, Inc.) according to manufacturer’s protocol. Following this, the mRNA was reverse transcribed into cDNA using a PrimeScript RT reagent kit (Takara Biotechnology Co., Ltd., Dalian, China) according to manufacturer’s protocol. Then, the cDNA was used as the template to perform qPCR (BeyoFast™ SYBR Green qPCR Mix; Beyotime Institute of Biotechnology) with the following thermocycler conditions: 95°C for 5 sec, then 45 cycles comprising denaturing at 95°C for 30 sec, annealing at 60°C for 20 sec and extending at 72°C for 30 sec on an ABI 7500 Real-time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primers used are listed in
The level of CTX-II in rat serum and culture supernatant following 1,000 × g centrifugation at room temperature for 5 min was detected using CTX ELISA kit (cat. no. E-EL-M0368c; Ela bscience, Wuhan, China) according to the manufacturer’s protocols.
Total proteins in NP tissues and cells were isolated by using the radioimmunoprecipitation assay lysis buffer (Beyotime, Nanjing, China) containing 1X protease inhibitor cocktail and 1X PhosStop (both, Roche Diagnostics, Indianapolis, IN, USA). The concentration of protein was determined by using a BCA protein assay kit (Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocol. Then, the protein extracts were boiled with equal volumes of loading buffer (Beyotime Institute of Biotechnology) for 10 min. Following this, 15
In the present study, all data are presented as mean ± standard deviation. Statistical analyses were performed using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). Statistical evaluation was performed using Student’s t-test (two-tailed) between two groups, or one-way analysis of variance followed by Tukey’s post hoc test for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.
The pathogenic symptoms of IDD in each group were determined using MRI. Compared with the control group, the interval between punctured discs was significantly decreased in the IDD rat model, as indicated by the blue arrows, while AAV2-BMP2 treatment markedly inhibited the decrease in intervals between punctured discs in the IDD model in a dose-dependent manner (
Following sacrifice, the levels of collagen II, aggrecan, SOX9, MMP-13 and CTX-II in NP tissues of each group were determined by RT-qPCR. As a result, the levels of collagen II, aggrecan and SOX9 were significantly downregulated in the IDD group compared with the control group, while BMP2 overexpression significantly attenuated these changes in IDD in a dose-dependent manner (
To explore the underlying effects of BMP2 on the alleviation of IDD
The levels of collagen II, aggrecan, SOX9 and MMP-13 in cells, and levels of CTX-II in the supernatant were also determined
To additionally reveal the mechanisms of extracellular matrix degradation and apoptosis of NP cells during IDD, the proteins involved in the PI3K/Akt signaling pathway were examined. It was identified that the levels of total PI3K and Akt protein were not changed following treatment of NP cells with IL-1β and rhBMP2. However, the levels of phosphorylation of PI3K and Akt in NP cells were significantly decreased following IL-1β treatment. Additionally, rhBMP2 pretreatment significantly upregulated the levels of phosphorylation of PI3K and Akt in a dose-dependent manner (
IDD is a common chronic disease contributing to lower back pain, and is considered to be one of the most important public health problems worldwide (
To explore the pathogenesis of IDD, a needle puncture model in rats was constructed. The results demonstrated that AAV2-BMP2 injection significantly alleviated the fibrous ring rupture and glycoproteins degradation of IDD in a dose-dependent manner, as determined by MRI and histological analyses. Leckie
To additionally reveal the underlying mechanism of BMP2 in alleviating IDD (
In conclusion, inhibition of ECM degradation and NP cells apoptosis, which are two primary characteristics of IDD, may delay the process of IDD. Therefore, BMP2 may provide a potential strategy for IDD treatment by increasing the production of collagen II, aggrecan and SOX9, decreasing the levels of CTX-II and MMP-13 in the PI3K/Akt signaling pathway and increasing the survival of NP cells. The data of the present study indicate that BMP2 may serve as a promising therapeutic method in treating IDD. However, the safety of BMP2 in clinical applications requires additional examination.
Not applicable.
The present study was supported by National Natural Science Foundation of China (grant no. 81401842).
All data generated or analyzed during this study are included in this published article.
YT is the guarantor of integrity of the entire study, and was responsible for the study concept, design and manuscript preparation. XY was responsible for study conception and literature research. ZD performed experiments and data acquisition. YW conducted data analysis and statistical analysis. GL performed manuscript drafting and conducted analysis and interpretation of data. All authors read and approved the final manuscript.
The experimental procedures were approved by the Second Xiangya Hospital, Central South University (Changsha, China). All the procedures in the present study involving animals and their care were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of the Second Xiangya Hospital, Central South University.
Not applicable.
The authors declare that they have no competing interests.
BMP2 alleviates IDD in rats. (A) IDD in rats determined using magnetic resonance imaging. (B) Histological analysis of intervertebral disc tissues determined by using H&E and Alcian Blue staining. Blue arrows indicate the decreased interval between punctured discs. Red arrows indicate the unbroken annulus fibrosus. IDD, intervertebral disc degeneration; H&E, hematoxylin and eosin; AAV2-BMP2, adeno-associated virus serotype 2-bone morphogenic protein 2.
BMP2 treatment regulates the levels of IDD-associated biomarkers and inflammatory cytokines in NP tissues. (A) Relative mRNA levels of collagen II, aggrecan, SOX9 and MMP-13 in NP tissues determined using RT-qPCR. (B) Level of CTX-II in the serum of rats determined using ELISA. (C) Relative mRNA levels of IL-6, TNF-α and IL-10 determined using RT-qPCR. **P<0.01 and ***P<0.001 vs. control group. #P<0.05, ##P<0.01 and ###P<0.001 vs. IDD group. IDD, intervertebral disc degeneration; AAV2-BMP2, adeno-associated virus serotype 2-bone morphogenic protein 2; SOX9, transcription factor SOX9; MMP-13, matrix metalloproteinase 13; CTX-II, C-telopeptide of type II collagen; IL, interleukin; TNF-α, tumor necrosis factor α; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NP, nucleus pulposus.
rhBMP2 treatment inhibits the apoptosis of NP cells during IDD. (A) Proliferation of NP cells following treatment with different concentrations of rhBMP2 determined by MTT assay. (B) Apoptosis of NP cells determined by flow cytometry. (C) Quantification of cell apoptosis. (D) Levels of cleaved caspase-3 and uncleaved PARP determined by western blot analysis. (E) Quantification of western blot analysis. ***P<0.001 vs. control group. ##P<0.01 and ###P<0.001 vs. IDD group. NP, nucleus pulposus. IDD, intervertebral disc degeneration; rhBMP2, recombinant human bone morphogenic protein 2; IL, interleukin; PI, propidium iodide; Con, control; PARP, poly (adenosine 5′-diphosphate-ribose) polymerase; NP, nucleus pulposus.
rhBMP2 attenuates the IDD-associated proteins and inflammatory response induced by IL-1β in NP cells. (A) Relative mRNA levels of collagen II, aggrecan, SOX9 and MMP-13 in NP cells determined by using RT-qPCR. (B) Levels of collagen II, aggrecan, SOX9 and MMP-13 in NP cells determined by western blot analysis. (C) Quantification of western blot analysis results of collagen II, aggrecan, SOX9 and MMP-13 in NP cells. (D) Level of CTX-II in the supernatant of NP cells determined by ELISA. (E) Relative mRNA levels of IL-6, TNF-α and IL-10 in NP cells determined by RT-qPCR. ***P<0.001 vs. control group. #P<0.05, ##P<0.01 and ###P<0.001 vs. the IL-1β treated group. SOX9, transcription factor SOX9; MMP-13, matrix metalloproteinase 13; CTX-II, C-telopeptide of type II collagen; IL, interleukin; TNF-α, tumor necrosis factor α; RT-qPCR, reverse transcription quantitative polymerase chain reaction; rhBMP2, recombinant human bone morphogenic protein 2; NP, nucleus pulposus.
rhBMP2 inhibits the extracellular matrix degradation and apoptosis of NP cells via the PI3K/Akt signaling pathway. (A) Levels of phosphorylation of PI3K and Akt determined by western blot analysis. (B) Quantification of western blot analysis results from part A. (C) Levels of phosphorylated Akt and total Akt in response to IL-1β, rhBMP2 and LY294002 treatment as determined by western blot analysis. (D) Quantification of western blot analysis results from part C. (E) Effects of LY294002 treatment on the protein levels involved in the extracellular matrix as determined by western blot analysis. (F) Effects of LY29004 treatment on the level of CTX-II in the supernatant of NP cells determined by ELISA. (G) Levels of apoptosis-associated proteins as determined by western blot analysis. (H) Flow cytometry analysis of cell apoptosis following treatment with combinations of rhBMP2, IL-1β and LY294002. (I) Quantification of flow cytometry results from part H. **P<0.01; ***P<0.001 vs. control group. #P<0.05, ##P<0.01 and ###P<0.001 vs. IL-1β-treated group. rhBMP2, recombinant human bone morphogenic protein 2; PI3K, phosphoinositide 3-kinase; Akt, protein kinase B; IL, interleukin; LY, LY29004; SOX9, transcription factor SOX9; MMP-13, matrix metalloproteinase 13; CTX-II, C-telopeptide of type II collagen; p-phosphorylated; PI, propidium iodide; NP, nucleus pulposus.
Primers for reverse transcription quantitative polymerase chain reaction.
Gene | Primers | Sequences (5′-3′) |
---|---|---|
Collagen-II-h | Forward | GGCAATAGCAGGTTCACGTACA |
Reverse C | GATAACAGTCTTGCCCCACTT | |
SOX9-h | Forward | AGCGAACGCACATCAAGAC |
Reverse C | TGTAGGCGATCTGTTGGGG | |
Aggrecan-h | Forward | TCCACAAGGGAGAGAGGGTA |
Reverse | GTAGGTGGTGGCTAGGACGA | |
MMP-13-h | Forward | GGCTCCGAGAAATGCAGTCTTTCTT |
Reverse | ATCAAATGGGTAGAAGTCGCCATGC | |
IL-6-h | Forward | ATGAACTCCTTCTCCACAAGC |
Reverse C | TACATTTGCCGAAGAGCCCTCAGGCTGGACTG | |
IL-10-h | Forward | AGGGCACCCAGTCTGAGAACA |
Reverse C | GGCCTTGCTCTTGTTTTCAC | |
TNF-α-h | Forward | ATGAGCACTGAAAGCATGATC |
Reverse | TCACAGGGCAATGATCCCAAAGTAGACCTGCCC | |
GAPDH-h | Forward | AAGGTCGGAGTCAACGGATTT |
Reverse | AGATGATGACCCTTTTGGCTC | |
Collagen-II-r | Forward | ACGCTCAAGTCGCTGAACAA |
Reverse | TCAATCCAGTAGTCTCCGCTCT | |
SOX9-r | Forward | TCCAGCAAGAACAAGCCACA |
Reverse C | GAAGGGTCTCTTCTCGCTC | |
Aggrecan-r | Forward | TCCAAACCAACCCGACAAT |
Reverse | TCTCATAGCGATCTTTCTTCTGC | |
MMP-13-r | Forward | ATGCAGTCTTTCTTCGGCTTAG |
Reverse | ATGCCATCGTGAAGTCTGGT | |
IL-6-r | Forward CC | TCTGGTCTTCTGGAGTACC |
Reverse | ACTCCTTCTGTGACTCCAGC | |
IL-10-r | Forward | ATAACTGCACCCACTTCCCA |
Reverse | GGGCATCACTTCTACCAGGT | |
TNF-α-r | Forward | ATGAGCACAGAAAGCATGA |
Reverse | AGTAGACAGAAGAGCGTGGT | |
GAPDH-r | Forward | GGAAAGCTGTGGCGTGAT |
Reverse | AAGGTGGAAGAATGGGAGTT |
h, human; r, rat; SOX9, Transcription factor SOX9; MMP-13, matrix metalloproteinase; IL, interleukin; TNF-α, tumor necrosis factor α.