All animal experiments conformed to the regulations drafted by the Association for Assessment and Accreditation of Laboratory Animal Care in Shanghai and were approved by the East China Normal University Center for Animal Research.

For the model of IBD, a total of 35 male (n=5/group) C57BL/6 mice (8 weeks old, weighing approximately 20 g) were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China) and maintained under SPF experimental animal conditions (temperature, 23±2°C; humidity, 65±5%) in a 12-h light/dark cycle and fed a standard laboratory diet and water in East China Normal University Center for Animal Research. Acute colitis was induced at day 0 by the administration of 2.5% (w/v) DSS (molecular weight, 36-50 kDa; MP Biomedicals, Santa Ana, CA, USA) in their drinking water and this was then changed to normal drinking water at day 5. The mice were sacrificed at different time points as indicated (days 0, 2, 4, 6, 8, 10 and 12) and intestinal samples were collected for RNA extraction or histological analysis.

For in vivo regeneration assay, a total of 20 male (n=5/group) C57BL/6 mice (8 weeks old, weighing approximately 20 g) were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. and kept under SPF experimental animal conditions (temperature, 23±2°C; humidity, 65±5%) in a 12-h light/dark cycle and fed a standard laboratory diet and water in East China Normal University Center for Animal Research. The mice were irradiated by 9.0 Gy X-ray using a Biological X-ray irradiator (RS 2000 series; Rad Source Technologies, Inc., Suwanee, GA, USA) operated at 250 kVp, 15 mA. The mice were sacrificed every other day after irradiation by cervical dislocation.

Small intestinal crypt isolation and culture were performed as previously described (21,22). Briefly, the small intestine was washed in cold PBS. The tissue was then chopped into approximately 3-5-mm-thick sections, washed with cold PBS and incubated in 5 mM EDTA in PBS for 30 min on ice. The tissue fragments were suspended vigorously, and the supernatants, including most of the villi were discarded. The sediment was further resuspended with cold PBS; the yielded supernatants enriched in crypts were collected and filter through a 70 μm cell mesh (BD Biosciences, San Jose, CA, USA). The crypts were then pelleted by centrifugation (132 × g, 5 min), suspended in ADF medium (advanced DMEM F12) (Thermo Fisher Scientific, Waltham, MA, USA) containing 1% GlutaMAX (Thermo Fisher Scientific). The crypts were centrifuged at low speed (33 × g, 3 min) for 2-3 times to remove single cells. The final crypts were resuspended with growth factor reduced to Matrigel (356231; BD Biosciences) at 5-10 crypts per μl, followed by seeding on a 96-well plate (5 μl per well) or 48-well plate (30 μl per well). Culture medium was made by ADF supplemented with penicillin/streptomycin, 10 mM HEPES, 1X GlutaMAX, 1X N2, 1X B27 (all from Thermo Fisher Scientific) and 1 μM N-acetylcysteine (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) containing 50 ng/ml Murine EGF, 100 ng/ml Murine Noggin and 1 μg/ml Human R-spondin-1 (all from PeproTech, Rocky Hill, NJ, USA). The medium was changed every other day.

For single cell culture, 4-6-day cultured organoids were dissociated with TrypLE express (Thermo Fisher Scientific) including 2,000 U/ml DNase (Roche Diagnostics, Indianapolis, IN, USA) for 10 min at 37°C. Dissociated cells were passed through a 20 μm cell mesh (BD Biosciences) and embedded in Martrigel containing 1 μM jag1 (AnaSpec, Fremont, CA, USA) at up to 5,000-10,000 cells per 30-50 μl. The culture medium was regular organoid culture medium supplemented with 10 μM ROCK inhibitor Y27632 (Sigma-Aldrich; Merck KGaA).

For rescue experiments, 100 ng/ml IL-22 (R&D Systems, Minneapolis, MN, USA), 200 ng/ml Wnt3a (R&D Systems), 1 μM Jag1 (AnaSpec), 5 μM WP1066 (Stat3 inhibitor; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), 3 μM Stattic (Stat3 inhibitor; Santa Cruz Biotechnology, Inc.,) were used at different combinations in oranoid culture medium: Vehicle (without IL22), Stattic, WP1066, Wnt3a, Jag1, IL-22, IL-22 plus Stattic, IL-22 plus WP1066, IL-22 plus Wnt3a, IL-22 plus Jag1.

RNA from the organoids, intestines (IECs) and immune cells [macrophages, monocytes, CD4⁺ T cells and dendritic cells (DCs) were sorted from mouse peripheral blood by corresponding magnetic beads; Miltenyi Biotec, Bergisch Gladbach, Germany] was obtained by tissue homogenization using TRIzol reagent (Takara Bio, Inc., Otsu, Japan), followed by RNA precipitation in isopropanol, resuspension in DEPC-treated water and verification as DNA free by PCR. cDNA was synthesized with the Superscript RNase H2 Reverse Transcriptase kit (Takara Bio, Inc.) using 2.5 mM random hexamers (Takara Bio, Inc.). Quantitative (real-time) PCR (qPCR) was performed using the SYBR-Green PCR kit (Takara Bio, Inc.) on a Mx3005P thermal cycler (Stratagene, San Diego, CA, USA). The amplification conditions included 3 processes, namely hold stage (1 cycle): 95°C for 1 min; PCR stage (40 cycles): 95°C for 5 sec, 55°C for 30 sec; melt curve stage (1 cycle): 95°C for 5 sec, 55°C for 30 sec and 95°C for 30 sec. The sequences of the main primers were as follows: β-actin sense, CAGCCTTCCTTCTTGGGTAT and antisense, TGATCTTGATCTTCATGGTGC; Il-22 sense, ACATCGTCAACCGCACCTTT and antisense, CAGCCTTCTGACATTCTTCTGGAT; Il-22ra1 sense, CTACGTGTGCCGAGTGAAGA and antisense, GGTAGGTTGCAGGATGGAGA; Il-10rb sense, TTCGGAGTGGGTCAATGTCA and antisense, GACCTCAGAGTCGTACGGAG; Lgr5 sense, CCTACTCGAAGACTTACCCAG T and antisense, GCATTGGGGTGAATGATAGCA; olfactomedin 4 (Olfm4) sense, TCTTGGGCAGAAGGTGGGACT and antisense, GGACCGTCAGGTTCAGGAGC; achaete-scute family bHLH transcription factor 2 (Ascl2) sense, AAGCACACCTTGACTGGTACG; and anti-sense, AAGTGGACGTTTGCACCTTCA; zinc and ring finger 3 (Znrf3) sense, CCAGTGGTGTATGTGAAGGGT G and antisense, AATTCTGACTACGACGTTGCT; WD repeat domain 43 (Wdr43) sense, GCATACAGTGGCATCAAGAC and antisense, GTGAACCTAAGCGACGAAA; Prominin 1 (Prom1) sense, CTGAAGATTGCCCTCTATGA and anti-sense, AGTTTCTGGGTCCCTTTGAT; Axin2 sense, TGACTCTCCTTCCAGATCCCA and antisense, TGCCCACACTAGGCTGACA; and EPH receptor B3 (Ephb3) sense, GACCTTGCTGCCCGAAACAT and antisense, CCCACATGACAATCCCATAGCT; Mus musculus mucin 2 (Muc2) sense, ATGACGTCTGGTGGAATGGT and antisense, TGTTCTGACAGTTGCACGTG; Mus musculus SAM pointed domain containing ets transcription factor (Spdef) sense, TGAACATCACAGCAGACCCT and antisense, ACTTCCAGATGTCCAGGTGG; Chga chromogranin A (Chga) sense, ACTTCAAGACCTGGCTCT CC and antisense, CCTAGGTCCCTCTGTGGTTG; Mus musculus neurogenin 3 (Nuero3) sense, ACACAACAACCTTTTCCCGG and antisense, CCCGATCATTGGCCTTCTTG; Mus musculus caudal type homeobox 1 (Cdx1) sense, AAGGTTCCAGAGTGAGGTG and anti-sense, TAGGGCAGGTGAAAGTGAGG; Mus musculus caudal type homeobox 2 (Cdx2) sense, CTCTCCTCCTACCCACGAAC and antisense, TGGGGCAAAAGAGGCTGATA; Mus musculus lysozyme 1 (Lyz1) sense, GCTTCTACTGCAGCCCATTC and antisense, GCTGACTGACAAGGGAGACT; Mus musculus SRY (sex determining region Y)-box 9 (Sox9) sense, CAAGAACAAGCCACACGT CA and antisense, GTGGTCTTTCTTGTGCTGCA; Mus musculus defensin, alpha, 29 (Defa29 or Crs1c) sense, AAAGAAGGTTTCCGTGGTGC and antisense, TGAGGCTAAGCACAATGGGA; Mus musculus defensin, alpha, 5 (Defa5) sense, ATTTGTCCTCCTCTCTGCCC and antisense, ACGCGTTCTCTTCTTTTGCA; Axin2 sense, TGACTCTCCTTCCAGATCCCA and antisense, TGCCCACACTAGGCTGACA; cyclin D1 (Ccnd1) sense, AGTTCATTTCCAACCCACCC and antisense, AGACCAGCCTCTTCCTCCAC; transcriptional regulator Myc-like (C-myc) sense, CCCTACCCGCTCAACGACAG and antisense, TTGCCTCTTCTCCACAGACACC; Eph receptor B3 (Ephb3) sense, GACCTTGCTGCCCGAAACAT and antisense, CCCACATGACAATCCCATAGCT; Eph receptor B2 (Ephb2) sense, GGCTTTACCTCTTTC GAC G and antisense, CAATCCCCTTTTCCTTCC; wingless-type MMTV integration site family, member 3A (Wnt3a) sense, GCACCACCGTCAGCAACAGC and antisense, TCCCTGGCATCGGCAAA CTC; Notch1 sense, AATGGAGGGAGGTGCGAA GT and antisense, CAGAGGTGTCAGGCAGAGGG; hes family bHLH transcription factor 1(Hes1) sense, GGAGAAGAGGCGAAGGGCAAG A and antisense, CGTGGACAGGAAGCGGGTCA; jagged 1 (Jag1) sense, AATGGTTATCGCTGTATCTGTCC and antisense, AGTTCTTGCCCTCATAGTCCTC; delta like canonical Notch ligand 1 (Dll-1) sense, CCGATGACCTCGCAACAGAA and antisense, CCAGGGTCGCACATCTTCTC. β-actin served as the control gene, all reactions were performed in triplicate. The relative expression was calculated using the 2^-ΔΔCq method (27).

The intestines were dissected and flushed gently with cold PBS. They were then immediately fixed by 4% PFA in PBS or snap-frozen on dry ice. Frozen samples were stored at -80°C until cut into frozen slices using a cryostat microtome. Fixed intestines were dehydrated by gradient alcohols, embedded in paraffin, and cut into 4-μm-thick sections which were then subjected to H&E staining or immunohistochemistry (IHC).

Organoid histological staining was carried out with the sections or whole-mount sections. For the sections, organoids were collected after Matrigel was melted by Cell Recovery Solution (BD Biosciences). The organoids were then dehydrated and embedded in paraffin. The sections were deparaffinized in xylene and rehydrated in gradient alcohols. Endogenous peroxidase activity was quenched with 3% H₂O₂ in methanol for 20 min and washed in PBS. Antigen retrieval was performed by boiling the slides in 10 mM sodium citrate buffer, pH 6.0 or 10 mM Tris-base, 1 mM EDTA solution, pH 9.0. The sections were blocked with 1% BSA and incubated with the primary antibodies as listed below overnight at 4°C. For IHC staining, following incubation with secondary antibody (HRP labeled polymer, GK500710; Shanghai Genetech Co., Shanghai, China) for 30 min, the sections were developed with DAB and counterstained with hematoxylin, then dehydrated and mounted in neutral resins. For BrdU staining, before fixture, the organoids were treated with 3 μg/ml BrdU for 2 h. A similar procedure was performed with the addition of a 30-min treatment with 2 N HCl after antigen retrieval. For immunofluorescence (IF), the sections, following primary antibody as listed below incubation overnight at 4°C were washed and incubated with secondary Alexa Fluor 488 (1:500 dilution; cat. no. ab150077; Abcam, Cambridge, MA, USA) or 647 antibodies (1:500 dilution; cat. no. ab150115; Abcam) for 2 h at room temperature with DAPI (1:10,000 dilution; cat. no. ab104139; Abcam) counterstaining for 5 min at room temperature (Thermo Fisher Scientific) and subjected to immunofluorescence microscopy (BX53; Olympus Corporation, Tokyo, Japan).

For the whole-mount sections, the organoids were fixed with 4% PFA in a plate without melting the Matrigel, then permeabilized with 0.2% Triton in PBS and incubated overnight with primary antibodies as listed below. Fluorescence was detected as mentioned above.

The primary antibodies were as follows: Cleaved caspase-3 (1:200; cat. no. 9661; Cell Signaling Technology, Danvers, MA, USA), Ki67 (1:2,000; cat. no. ab873; Abcam), Lysozyme (Paneth cell marker; 1:2,000; cat. no. ab108508; Abcam), Chromogranin A (endocrine cell marker; 1:2,000; cat. no. 20085; ImmunoStar, Hudson, WI, USA), Muc2 (goblet cell marker; 1:100; cat. no. sc-59859; Santa Cruz Biotechnology, Inc.,), phosphor-Stat3 at Tyr705 (1:200; cat. no. 4113; Cell Signaling Technology), BrdU (1:500; cat. no. B8434; Sigma-Aldrich; Merck KGaA) and IL-22RA1 (1:400; cat. no. ab211675; Abcam).

Lgr5-EGFP-IRES-creERT2 mice (Stock no. 008875) were obtained from The Jackson Laboratory (Bar Harbor, ME, USA) and a total of 5 male, Lgr5-EGFP-IRES-creERT2 mice (8 weeks old, weighing approximately 20 g) were kept under SPF experiment animal conditions (temperature,23±2°C; humidity, 65±5%) in a 12-h light/dark cycle and fed a standard laboratory diet and water in East China Normal University Center for Animal Research. Endogenous GFP (green) driven by Lgr5 promoter indicates crypt base columnar stem cells in the small intestine. Crypts from the Lgr5-EGFP-IRES- CreERT2 mice were isolated as described above after the mice were sacrificed and organoid culture was performed. Following treatment with 100 ng/ml recombinant mouse IL-22 (R&D Systems, Inc., Minneapolis, MN, USA), organoids were collected and dissociated with TypLE and 2,000 U/ml DNase for 15 min at 37°C. The dead cells were then excluded by scatter characteristics and propidium iodide. Lgr5⁺ISCs were identified by their endogenous GFP expression.

Organoids were collected after Matrigel melting. The cells were then lysed with 0.5% NP-40 lysis buffer [50 mM Tris-base (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS and Complete Mini Protease Inhibitor mixture (Roche Diagnostics)] for western blot analysis. The protein concentration was determined using a BCA Protein Assay kit (cat. no. p0011; Beyotime, Shanghai, China). The proteins (30 μg each sample) were resolved on 12% SDS-PAGE gels, transferred onto PVDF membranes (EMD Millipore, Billerica, MA, USA). Following blocking with PBS containing 3% skim milk, the membranes were incubated overnight at 4°C with primary antibodies as follows: Anti-cleaved caspase-3 (1:1,000; cat. no. 9661), anti-Bax (1:1,000; cat. no. 2772), anti-Bcl2 (1:1,000; cat. no. 3498), anti-Bcl-xL (1:1,000; cat. no. 2762), anti-Stat3 (1:1,000; cat. no. 9139), anti-phospho-Stat3 (Tyr705; 1:1,000; cat. no. 9145) (all from Cell Signaling Technology) and anti-β-actin (1:1,000; cat. no. A1978; Sigma-Aldrich; Merck KGaA). Following incubation with peroxidase AffiniPure secondary antibodies (goat anti-mouse IgG, cat. no. 115-035-003; goat anti-rabbit IgG, cat. no. 111-035-003; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) for 1 h at room temperature, the blots were then analyzed using the ECL detection system or scanned with an Odyssey Infrared Imager (LI-COR Biosciences, Lincoln, NE, USA).

The colons from mice with DSS-induced colitis were obtained and completely homogenized in PBS containing proteinase inhibitors. Following centrifugation at 825 × g/min for 20 min, the supernatant was collected. The level of secreted IL-22 from IECs was measured using a mouse IL-22 ELISA kit (Abcam) following the manufacturer’s instructions. The experiment was repeated 3 times.

Data were statistically analyzed by one-way ANOVA or the Student’s t-test. A value of P<0.05 considered to indicate a statistically significant difference. Results are presented as the means ± standard error of the means (SEM).

We first detected the gene transcription of IL-22RA1 and IL-10RB, heterodimeric receptors of IL-22, in both immune cells and IECs by RT-qPCR. While IL-22RA1 was specifically expressed in epithelial cells, IL-10RB expression was found in both immune and IECs (Fig. 1A). The results of immunohistochemistry revealed that IL-22RA1 was expressed in the epithelium of the colon and intestine (Fig. 1B). These data suggest IL-22 signaling functions in the intestinal epithelium.

We then examined IL-22 expression in the colon in a mouse model of DSS-induced colitis. Histological analysis revealed that damage to the intestinal epithelium gradually increased, being most severe on day 6 (1 day after DSS administration), and were recovered from day 8 to day 12 (3rd day to the 7th day after DSS administration) (Fig. 1C). Notably, IL-22 expression was consistently altered with the development of colitis. It reached maximum levels on day 6 following DSS administration and decreased during the regeneration of the intestinal epithelium (Fig. 1D and E). In another mouse model of irradiation, we observed similar results (Fig. 1F and G). Taken together, our results reveal that IL-22 expression is associated with the state of intestinal damage.

As it is well known that IL-22 promotes cell proliferation during tissue repair, we wished to explore the direct function of IL-22 in IECs. In an extra in vitro organoid culture system, we found that IL-22 treatment led the organoids acquiring a rounded shape and they began to degenerate after 3 days (Fig. 2A). On day 4, the buds of the organoids were significantly decreased and almost all organoids were disrupted in the IL-22-treated group (Fig. 2B-D).

Subsequently, to determine the mechanisms through which IL-22 regulates organoid formation, we assessed the proliferation and apoptosis of IECs following IL-22 treatment. IHC staining for BrdU and Ki67 revealed that the majority of the cells were in a proliferative state (Fig. 2E). By contrast, we failed to detect a marked difference in cell apoptosis between the vehicle (the organoid cultured without IL-22) and the IL-22-treated samples, as determined by measuring the levels of apoptosis-related markers (Fig. 2E and F).

We then wished determine whether IL-22 affects the differentiation of IECs. The results of IF staining revealed that the numbers of different differentiated cell types, including Paneth cells, goblet cells and enteroendocrine cells were significantly decreased following IL-22 treatment (Fig. 2G and H). In addition, the expression of specific markers of differentiated cells was suppressed by IL-22, as shown by RT-qPCR (Fig. 2I). Collectively, these results indicated that IL-22 regulates organoid formation through activation of cell proliferation and inhibition of IECs differentiation.

Paneth cells provide EGF, Notch and Wnt ligands to maintain ISC self-renewal ability, which is essential for organoid formation. Since IL-22 was found to inhibit the differentiation of Paneth cells, we wished to determine whether it also affects ISCs self-renewal. By isolating the organoids from Lgr5-EGFP-IRES-creERT2 mice, we found that the number of ISCs, positive for Lgr5-EGFP, was markedly decreased by IL-22 (Fig. 3A and B). Consistently, the results of RT-qPCR revealed that the expression of stem cell markers, including Ascl2, Olfm4 and Lgr5 was significantly lower in the group treated with IL-22 (Fig. 3C). Moreover, the expression of Wdr43 and Prom1, the transit-amplifying (TA) cells markers, was slightly upregulated by IL-22. This suggested that IL-22 promotes the differentiation into TA cells from Lgr5⁺ISCs (Fig. 3D).

To further validate the effects of IL-22 on the maintenance of ISC self-renewal, we disassociated the organoids into single cells and assessed the growth ability. We observed that the single cells could individually grow to a cyst-like structure and finally formed an organoid structure (Fig. 3E, arrowheads). On the contrary, these cells could not survive following culture for 3-4 days with the addition of IL-22 (Fig. 3E, bottom panels). Taken together, these data suggest that IL-22 counteracts the self-renewal ability of ISCs.

It has been reported that IL-22 modulates the phosphorylation of Stat3 (18,28). In this regard, we assessed the changes in the levels of phosphorylated Stat3 following treatment of the organoids with IL-22. In the assay of immunofluorescence, we observed that the addition of IL-22 increased the level of phosphorylated Stat3 in the nucleus of the organoids (Fig. 4A and C). Consistently, similar results were got by immunoblotting (Fig. 4B). Moreover, in the organoids of Lgr5-EGFP-IRES-creERT2 mice, increased levels of nuclear phosphorylated Stat3 were observed in the Lgr5-positive ISCs following treatment with IL-22 (Fig. 4C).

We then examined the activity of the Wnt and Notch signaling pathways, which are essential for ISC self-renewal and differentiation. It was found that both the Wnt and Notch signaling pathways were markedly suppressed by IL-22 (Fig. 4D and E). In summary, these results demonstrate that IL-22 activates the Stat3, and inhibits the Wnt and Notch signaling pathways.

To understand the importance of signaling pathway changes caused by IL-22, we carried out rescue experiments. We applied WP1066 and Stattic as Stat3 specific inhibitors, and added Wnt3a and Jag1 as respective ligands for the Wnt and Notch pathways.

In the absence of IL-22, these supplements did not affect the formation and survival of organoids (Fig. 5A and B). Notably, only the addition of Wnt3a recovered the defects in the organoids induced by the addition of IL-22 (43% vs. 7%; Fig. 5A and B). Furthermore, we found that the number of Paneth cells was retrieved by Wnt3a, but not by Stattic, WP1066 and Jag1 (Fig. 5D). Notably, Stattic treatment significantly restrained IL-22-induced cell hyper-proliferation (Fig. 5C). This observation suggested that IL-22 promotes cell proliferation mainly through Stat3 activation. Consistently, the upregulation of Wnt target genes, including Axin2 and Ephb3, was confirmed by RT-qPCR following the addition of Wnt3a in IL-22-treated organoids (Fig. 5E). Moreover, the levels of ISC markers (Lgr5, Olfm4 and Znrf3) were elevated as well. Taken together, these data suggest that IL-22 caused the deficiency of organoid formation mainly by suppressing the Wnt signaling pathway.

Taken together, in this study, we observed that the IL-22 level initially increased and gradually decreased during inflammation. Elevated IL-22 levels of modulated the Stat3, Wnt and Notch pathways to accelerate the proliferation of TA cells, suppressing cell differentiation and causing the deficiency of ISC self-renewal (Fig. 6).