The prognosis for patients with metastatic bladder cancer (BCa) is poor, and has not been improved by current treatment methods. Long noncoding RNAs (lncRNAs) are involved in the pathology of various tumors, including bladder cancer. However, the role of zinc finger E-box-binding homeobox 1-antisense 1 (ZEB1-AS1) in BCa progression and metastasis remains unclear. The present study determined the expression level of ZEB1-AS1 in BCa and additionally investigated the functional role of ZEB1-AS1 in BCa metastasis. Reverse transcription quantitative polymerase chain reaction analysis showed that ZEB1-AS1 was upregulated in BCa cells compared with normal epithelial cells. Functionally, knockdown of ZEB1-AS1 suppressed BCa cell migration and invasion
Bladder cancer (BCa) is the most common malignancy of the urinary system in China (
Long non-coding RNAs (lncRNAs) are a class of poorly conserved endogenous RNAs >200 nucleotides that do not encode proteins but regulate gene expression (
The lncRNA zinc finger E-box-binding homeobox 1 antisense 1 (ZEB1-AS1) derives from the promoter region of ZEB1, a transcriptional factor that serves important roles in physiology and tumorigenesis. As a well-known epithelial-mesenchymal transition (EMT) promoter, ZEB1 serves important roles in cancer metastasis, including BCa. Previously, Lin
The present study identified that lncRNA ZEB1-AS1 was significantly upregulated in BCa and closely associated with poor prognosis. Through gain or loss of function, it was demonstrated that ZEB1-AS1 promoted migration and invasion of BCa cells
A total of 60 snap-frozen fresh BCa tissues [30 MIBC and 30 non-MIBC (NMIBC)] and 60 normal adjacent tissues were obtained with the written consent of patients who underwent surgery at Peking Union Medical College Hospital (Beijing, China) between January 2014 and January 2016. The diagnosis of recruited patients was pathologically confirmed, and primary cancer tissues (no biopsy samples) were collected prior to radiotherapy or chemotherapy. The obtained tissue samples were immediately snap-frozen in liquid nitrogen upon resection and then stored at -80°C until further use. The present study was approved by Research Scientific Ethics Committee of Peking Union Medical College Hospital. All participants signed informed consent prior to use of the tissues for scientific purposes.
The human BCa T24 and UM-UC-3 cell lines and normal bladder epithelial SV-HUC-1 cell line were purchased from American Tissue Culture Collection. UM-UC-3 and T24 cells were cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.) with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.). Normal bladder epithelial SV-HUC-1 cells were grown in F-12K medium (HyClone; GE Healthcare Life Sciences) containing 10% FBS and 1% antibiotics. The cultures were incubated at 37°C in 5% CO2. Cycloheximide (CHX) was purchased from Sigma-Aldrich; Merck KGaA and used at the concentration of 20
Short interfering RNA (siRNA) oligonucleotides targeting ZEB1-AS1, AUF1, ZEB1 and negative control siRNAs were purchased from Shanghai GenePharma Co., Ltd. The siRNA sequences are listed in
Total RNA was extracted from BCa tissues or cells using the Qiagen RNeasy Mini kit according to the manufacturer's protocol (Qiagen GbmH). RT and qPCR kits were used to evaluate the expression of target RNAs. RT reactions (20
Cell migration ability was evaluated by performing wound-healing assay. Cells were seeded onto 6-well plates at a density of 5×105 cells/well. A total of 12 h after transfection with the respective vectors, the cell layer was scratched to form wounds using a sterile 20-
A total of 12 male BALB/c nude mice (19-22 g; 6 weeks old) were obtained from the Shanghai Laboratory Animal Center, Chinese Academy of Science. They were randomly divided into two groups of 6 mice in each, and housed with 3 mice/cage in a suitable pathogen-free sterile environment at 28°C and 50% humidity with a 12-12 h light-dark cycle, and were fed
IHC staining and score calculation were conducted as described previously (
The cellular fraction was isolated to locate the sublocation of ZEB1-AS1. Briefly, 1×107 cells were harvested, resuspended in 1 ml ice-cold RNase-free PBS, 1 ml C1 buffer (1.28 M Sucrose, 40 mM Tris-HCl, pH 7.5, 20 mM MgCl2 and 4% Triton X-100) and 3 ml RNase-free water, and incubated for 15 min on ice. The cells were then centrifuged for 15 min at 3,000 × g at 4°C, and the supernatant containing the cytoplasmic constituents and the nuclear pellet were retained for RNA extraction.
For RNA FISH, BCa cells were seeded into a 6-well plate (1x105 cells/well) and fixed with 4% paraformaldehyde for 15 min at 4°C and treated with 0.5% Triton in PBS, followed by pre-hybridization. They were then hybridized with the ZEB1-AS1 probe (5
The RNA pulldown assay was performed using a Magnetic RNA-Protein Pull-down kit (Thermo Fisher Scientific, Inc.) according to manufacturer's protocol. BCa cells (2x107) were cross-linked for each hybridization reaction. The cell lysates were hybridized with a mixture of biotinylated DNA probes for 4 h at 37°C. The binding proteins were separated by electrophoresis. A total of 25
The RIP assay was performed using the EZ-Magna RIP kit (EMD Millipore) according to the manufacturer's protocol. Briefly, 1×107 cells were lysed with RIP lysis buffer using 1 freeze-thaw cycle. Cell extracts were coimmunoprecipitated with anti-AUF1 (1:200; cat. no. ab61193; Abcam) antibody, and the retrieved RNA was subjected to the aforementioned RT-qPCR analysis. Normal IgG was used as a negative control. For RT-qPCR analysis, GAPDH was used as the non-specific control.
Radioimmunoprecipitation assay lysis buffer (Sigma-Aldrich; Merck KGaA) was used to lyse the cells to obtain total protein lysates. Protein concentration was measured using the bicinchoninic acid assay (Sigma-Aldrich; Merck KGaA). The quantified protein (25
The correlation between ZEB1-AS1 and ZEB1 mRNA levels was analyzed by using The Cancer Genome Atlas BCa dataset with the online database StarBase (
The Kolmogorov-Smirnov test was applied to analyze the distribution of data in each group. Data were presented as median (interquartile range). Mann-Whitney U tests were performed to compare the data between the two groups. The Kruskal-Wallis test followed by Bonferroni correction post-hoc test was used for evaluating the difference among multiple groups. Receiver operation characteristic (ROC) analysis was performed to evaluate the diagnostic performance of ZEB1-AS1. Spearman's correlation analysis was performed to determine the correlation between variables. A two-sided P<0.05 was considered to indicate a statistically significant difference. Statistical analysis was performed using GraphPad Prism 5 software (GraphPad Software, Inc.).
We measured the expression level of lncRNA ZEB1-AS1 in BCa cells via RT-qPCR and it was identified that ZEB1-AS1 was significantly increased in BCa cells when compared with normal SV-HUC-1 cells (
To additionally confirm the effects of ZEB1-AS1 in BCa metastasis, an experimental lung metastases model was induced by injections of single-cell suspension (2x106 UM-UC-3 cells in 100
The subcellular localization of a lncRNA is associated closely with its biological mechanism. Cellular fractionation and RNA-FISH assays demonstrated that ZEB1-AS1 was primarily distributed in the cytoplasm in BCa cells (
To examine the potential mechanism by which ZEB1-AS1 regulates the protein levels of ZEB1, RNA-pulldown experiments were performed followed by mass spectrometry to identify ZEB1-AS1-interacting proteins. The data identified a number of potential ZEB1-AS1-interacting proteins (
Based on the above results, we hypothesized that ZEB1-AS1 promoted ZEB1 mRNA translation by binding with AUF1. To examine this hypothesis, a RIP assay was performed, and it was identified that ZEB1 was enriched in AUF1 precipitates (
A preliminary study was performed to identify the clinical role of ZEB1-AS1 using 60 BCa tissues (30 MIBC and 30 NMIBC) and paired non-cancer tissues from patients with primary BCa. RT-qPCR analysis showed that ZEB1-AS1 was upregulated in BCa tissues in contrast to non-cancer tissues (
Numerous previous studies have assisted in gaining an improved understanding of the molecular mechanisms during cancer progression and chemoresistance. However, the specific regulatory model remains largely unknown in cancer, including BCa. Therefore, it is of importance to identify new molecular signatures which may be useful for cancer prevention and therapy. In the present study, it was demonstrated that over-expression of ZEB1-AS1 in BCa promoted the migration and metastasis of BCa cells
lncRNAs have been demonstrated to regulate biological functions via diverse mechanisms: Guider; decoy; scaffold effect on DNA, RNA or protein; and post-transcriptional effects (
The subcellular localization of a lncRNA is closely associated with its biological mechanism. The results from the present study showed that ZEB1-AS1 was primarily distributed in the cytoplasm in BCa cells, indicating it may regulate cancer progression at the post-transcriptional level. ZEB1-AS1 is a noncoding antisense transcript generated from ZEB1 promoters and located in physical contiguity with ZEB1. It is well known that ZEB1 is a transcription factor that promotes tumor invasion and metastasis by inducing EMT in carcinoma cells. Emerging studies have indicated that overexpression of ZEB1-AS1 increased ZEB1 levels and promoted tumor progression in different kinds of malignancies (
As ZEB1-AS1 affects ZEB1 protein level but not mRNA level, we hypothesized that this regulatory model may occur at the post-transcriptional level. To uncover the underlying mechanism by which ZEB1-AS1 regulates ZEB1 protein level, the ZEB1-AS1-interacting proteins were verified. It was identified that AUF1 was associated with ZEB1-AS1 and may serve as an adaptor protein that cooperates with ZEB1-AS1 to bind to ZEB1 mRNA. AUF1 an RNA-binding protein that produces 4 transcript variants following alternative pre-messenger RNA (pre-mRNA) splicing, with canonical roles in controlling the stability or translation of mRNA targets based on recognition of AU-rich sequences within 3'-UTR of target mRNA (
Take a step further, the present study also investigated the clinical role of ZEB1-AS1 expression in patients with BCa. It was observed that ZEB1-AS1 was upregulated in BCa tissues, and expressed at significantly increased levels in MIBC tissues. ROC curve analysis clearly demonstrated a high predictive value of ZEB1-AS1 in differentiating patients with MIBC from patients with NMIBC, indicating a high predictive value for BCa metastasis. These data validated the experimental conclusion derived from the
In summary, the present study demonstrated that ZEB1-AS1 functionally and clinically participated in the metastasis and progression of BCa, based on an AUF1-mediated translation activation of ZEB1 mRNA. Identification of the precise role of ZEB1-AS1 in the progression of BCa will not only improve the understanding of lncRNA-induced tumorigenesis and metastasis, but also enable the development of novel therapeutic strategies to treat BCa.
No funding was received.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
XZ and ZJ acquired the data and created a draft of the manuscript; YD and JZ collected clinical samples and performed the experimental assays; DW and GL analyzed and interpreted the data, and performed statistical analysis; XZ, DW and ZJ reviewed the manuscript, figures and tables. All authors have read and approved the final manuscript.
The study protocol was approved by the Clinical Research Ethics Committee of Peking Union Medical College Hospital, and the experimental protocols for the animal model was approved by the Committee on the Ethics of Animal Experiments of Peking Union Medical College Hospital. Written informed consent was obtained from each participant prior to tissue collection.
Written informed consent was obtained from each participant prior to tissue collection.
The authors declare that they have no competing interests.
Not applicable.
Knockdown of ZEB1-AS1 impairs migration and metastasis of BCa cells. (A) The expression levels of ZEB1-AS1 in BCa cells and normal epithelial bladder cells were measured via RT-qPCR. *P<0.05. (B) RT-qPCR determination of the silencing effect of ZEB1-AS1 following infection with respective silencing oligonucleotides. *P<0.05 and **P<0.01 vs. si-NC group. (C) A wound healing assay was performed to identify the effect of ZEB1-AS1 knockdown on BCa cell migration ability. *P<0.05 and **P<0.01 vs. si-NC group. (D) A Matrigel Transwell analysis was performed to determine the effect of ZEB1-AS1 on BCa cell invasion. *P<0.05 and **P<0.01. (E) Lung metastases were quantified using bioluminescence imaging 5 weeks after initial implantation. Representative
ZEB1 is a functional target of ZEB1-AS1 in BCa. (A) The relative expression level of ZEB1-AS1 in the nucleus and cytoplasm of BCa cells was measured by RT-qPCR. U1 (retained in the nucleus) and GAPDH (exported to cytoplasm) were used as controls. (B) The subcellular distribution of ZEB1-AS1 was visualized by RNA fluorescence
ZEB1-AS1 interacts with AUF1 to serve key roles in BCa. (A) Immunofluorescence analysis of AUF1 protein in UM-UC-3 cells. Scale bars, 10
ZEB1-AS1 activates the translation of ZEB1 mRNA via binding with AUF1. (A) RNA immunoprecipitation assays were performed using anti-AUF1 and control IgG antibodies, followed by RT-qPCR to examine the enrichment of ZEB1-AS1 and U6. U6 served as a negative control. **P<0.01. (B) The effects of AUF1 knockdown on ZEB1 mRNA expression were determined via RT-qPCR. (C) Western blot analysis was performed to detect the expression level of ZEB1 protein in bladder cancer cells with ZEB1-AS1 overexpression and/or AUF1 silencing. (D) The endogenous binding of AUF1 to ZEB1 mRNA was modified by ZEB1-AS1 overexpression. (E) Control siRNA- or si-ZEB1-AS1-transfected UM-UC-3 cells were cultured with 20
ZEB1-AS1 expression is associated with metastasis in patients with BCa. (A) ZEB1-AS1 expression level was detected by RT-qPCR in 60 BCa tissues and paired non-tumor tissues. (B) ZEB1-AS1 expression level was measured by RT-qPCR in 30 patients with MIBC and 30 patients with NMIBC. (C and D) ROC analysis was performed to investigate the diagnostic value of ZEB1-AS1 expression in differentiating between (C) patients with BCa and patients without cancer, and between (D) patients with MIBC from patients with NMIBC. (E) Correlation between RNA expression of ZEB1-AS1 and ZEB1 was analyzed from the Cancer Genome Atlas BLCA dataset using the online database StarBase. (F) The associations between the RNA expression of ZEB1-AS1 and ZEB1 in 60 BCa tissues were analyzed using Spearman's correlation analysis. ZEB1-AS1, zinc finger E-box-binding homeobox 1-anti-sense 1; BCa, bladder carcinoma; RT-qPCR, reverse transcription quantitative polymerase chain reaction; MIBC, muscle-invasive BCa; NMIBC, non-MIBC; AUC, area under the curve; BLCA, Bladder Urothelial Carcinoma.
qPCR primer and siRNA sequences.
A, siRNA sequences
| |
---|---|
siRNAs | Sequence (5′-3′) |
si-ZEB1-AS1#1 | GGACCAACTTTATGGAATA |
si-ZEB1-AS1#2 | GCTGAAGTCTGATGATTTA |
si-ZEB1-AS1#3 | GGAGCCATCTAGTGCATAA |
si-AUF1 | UCGACUAUCUGCUCCAAG |
si-ZEB1 | TGATCAGCCTCAATCTGCA |
si-NC | GACCTACAACTACCTATCA |
sh-ZEB1-AS1 | CUUCAAUGAGAUUGAACUUCA |
sh-NC C | AACAAGATGAAGAGCACCAA |
B, qPCR primer sequences | |
Primers | Sequence (5′-3′) |
| |
ZEB1-AS1 | F: TCCCTGCTAAGCTTCCTTCAGTGT |
ZEB1-AS1 | R: GACAGTGATCACTTTCATATCC |
ZEB1 | F: CGCAGTCTGGGTGTAATCGTAA |
ZEB1 | R: GACTGCCTGGTGATGCTGAAA |
GAPDH | F: GCACCGTCAAGGCTGAGAAC |
GAPDH | R: ATGGTGGTGAAGACGCCAGT |
U6 | F: CTCGCTTCGGCAGCACA |
U6 | R: AACGCTTCACGAATTTGCGT |
U1 | F: GGGAGATACCATGATCACGAAGGT |
U1 | R: CCACAAATTATGCAGTCGAGTTTCCC |
qPCR, quantitative polymerase chain reaction; siRNA, small interfering RNA; ZEB1, zinc finger E-box-binding homeobox 1; ZEB1-AS1, ZEB1 antisense 1; AUF1, heterogenous nuclear ribonucleoprotein D0; NC, negative control; F, forward; R, reverse.
Identification of ZEB1-AS1 binding proteins by mass spectrometry.
Protein | Beads | ZEB1-AS1 | Ratio (ZEB1-AS1/Beads) |
---|---|---|---|
AUF1 | 0 | 3 | NA |
LAS1L | 0 | 3 | NA |
STT3B | 0 | 3 | NA |
PCH2 | 1 | 3 | 3 |
MRP1 | 0 | 3 | NA |
ARF6 | 1 | 3 | 3 |
AKAP8 | 0 | 3 | NA |
GSTO1 | 0 | 3 | NA |
AP1B1 | 0 | 3 | NA |
DPM1 | 0 | 3 | NA |
PSDE | 1 | 3 | 3 |
PLST | 0 | 3 | NA |
PSAL | 0 | 3 | NA |
TTL12 | 0 | 3 | NA |
ERLN1 | 0 | 3 | NA |
NSF | 0 | 3 | NA |
KTN1 | 1 | 3 | 3 |
ZEB1-AS1, zinc finger E-box-binding homeobox 1-antisense 1; NA, not available. The 'Beads' column represents the spectral counts of proteins in the beads only group. The 'ZEB1-AS1' column represents the spectral counts of proteins in the ZEB1-AS1 group. The 'Ratio (ZEB1-AS1/Beads)' column represents the comparison of the spectral count ratio of proteins the ZEB1-AS1 group with the beads only group.