Contributed equally
Circular RNAs (circRNAs) are a novel class of RNAs that may be used as biomarkers in clinical blood samples. However, the role of circRNAs in rheumatoid arthritis (RA) has not been extensively investigated. In the present study, six circRNAs, including hsa_circ_0082689, hsa_circ_0087798, hsa_circ_0000175, hsa_circ_0008410, hsa_circ_0049356 and hsa_circ_0032959 levels were determined in peripheral blood mononuclear cells (PBMCs) collected from 24 patients with RA and 24 healthy controls (HC) by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. Hsa_circ_0000175 and hsa_circ_0008410 were selected for further evaluation in an independent cohort consisting of 63 patients with RA, 50 with systemic lupus erythematosus (SLE), 24 with ankylosing spondylitis (AS) and 21 HC. Spearman's rank correlation coefficient was used to analyze the correlation between these two circRNAs and the clinical characteristics of RA, and receiver operating characteristic (ROC) curves were constructed to evaluate their value in RA diagnosis. Multivariate analysis (logistic regression) was used to analyze the risk factors. Of the six selected circRNAs, the expression of hsa_circ_0000175 was found to be significantly reduced and the expression of hsa_circ_0008410 was significantly elevated in PBMCs from patients with RA compared with their levels in HC. The expression of hsa_circ_0000175 in patients with RA was correlated with anti-citrullinated protein antibodies, white blood cell count, lymphocyte count, lymphocyte percentage, neutrophil count, neutrophil percentage and neutrophil-to-lymphocyte ratio. Furthermore, the expression of hsa_circ_0008410 was correlated with tender joint count, disease duration, platelet count and plateletcrit, indicating the activity and severity of RA. ROC curve analysis suggested that hsa_circ_0000175, hsa_circ_0008410, and the combination of hsa_circ_0000175 and hsa_circ_0008410 have significant value in the diagnosis of RA. Hsa_circ_0000175 and hsa_circ_0008410 also differed significantly between patients with RA, and those with SLE and AS. Moreover, logistic regression analysis revealed that the expression of PBMC hsa_circ_0000175 and hsa_circ_0008410 were risk factors for RA. Therefore, PBMC hsa_circ_0000175, hsa_circ_0008410, and the combination of PBMC hsa_circ_0000175 and hsa_circ_0008410 may improve the diagnostic accuracy for RA. In addition, the expression levels of PBMC hsa_circ_0000175 and hsa_circ_0008410 were associated with disease activity and severity of RA.
Rheumatoid arthritis (RA) is a chronic debilitating systemic autoimmune disease that affects 1% of the population and may lead to permanent joint destruction resulting insignificant morbidity (
Novel diagnostic methods, such as linear RNAs, including microRNAs (miRNAs) and long non-coding RNAs, have been demonstrated to be useful as biomarkers for the diagnosis of RA (
Patients (n=87) who fulfilled the revised ACR 2010 criteria for RA (
Blood samples (2 ml) were collected from all subjects in K2-EDTA tubes, and PBMCs were isolated by density-gradient centrifugation using Ficoll-Paque Plus (GE Healthcare Life Sciences) at 25°C. TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was added to the PBMCs and stored at −80°C. Total RNA extraction from PBMC specimens was carried out according to the manufacturer's instructions. The concentration and integrity of the RNA was assessed by a NanoDrop ND-1000 spectrophotometer (Agilent Technologies, Inc.).
RT and qPCR were performed with PrimeScript™ RT kit (Takara Bio Inc.) and SYBR Premix Ex Taq™ II (Takara Bio Inc.), respectively. RT-qPCR was performed on an ABI 7500 Real Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following PCR thermocycler protocol: Initial denaturation step at 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec (denaturation), 60°C for 1 min (annealing and elongation) and 72°C for 2 min (final extension). The selected circRNAs for RT-qPCR analysis are shown in
Statistical analysis and graphic presentation were carried out with GraphPad Prism 5.0 (GraphPad Software, Inc.) and SPSS version 17.0 (SPSS Inc.). The equation n=Z2×б2d2=1.282×0.52/0.12=40.96 was used to calculate minimal sample size. A Student's t-test was used between two groups where the samples passed the normality test; otherwise, the non-parametric Mann-Whitney test was used to analyze the data. The paired t-test was performed for evaluation of changes in treatment. Kruskal-Wallis test was used for statistical analysis between three or more groups followed by a Dunn's post-hoc test for subsequent analyses between individual groups. Spearman's rho method was used for correlation analysis. Multivariate analysis (logistic regression) was used to analyze the risk factors. ROC curves were constructed to evaluate the diagnostic value of circRNAs that were dysregulated in the PBMCs of patients with RA compared with HC, SLE and AS. P<0.05 was considered to indicate statistically significant differences.
A total of 223 subjects were enrolled in the present study, including 87 patients with RA, 50 patients with SLE, 45 HC and 41 patients with AS. RA patients were classified into screening and validation cohorts. The screening cohort included 24 RA patients and 24 HC. An independent cohort consisting of 63 RA patients and 21 HC were enrolled in the validation set for evaluation of abnormal circRNAs. The characteristics of the study subjects are summarized in
The expression of hsa_circ_0082689, hsa_circ_0087798, hsa_circ_0000175, hsa_circ_0008410, hsa_circ_0049356 and hsa_circ_0032959 in PBMCs was first detected in the screening cohort including 24 RA patients and 24 HC using RT-PCR. Compared with HC, the expression of hsa_circ_0000175 and hsa_circ_0008410 was significantly different in the PBMCs from patients with RA (all P<0.05,
Subsequently, the expression of hsa_circ_0000175 and hsa_circ_0008410 in PBMCs was verified in an independent cohort, including 63 RA patients and 21 HC. In accordance with the screening results, the expression of hsa_circ_0000175 in PBMCs from 63 RA patients was significantly decreased compared with that in 21 HC (P<0.0001,
To investigate whether the expressions of PBMC hsa_circ_0000175 and hsa_circ_0008410 in RA patients could be considered as biomarkers for the activity and severity of the disease, Spearman's rho method was used to assess the association between the expression of PBMC hsa_circ_0000175 and hsa_circ_0008410 in RA patients with clinical characteristics, including DAS28, TJC, TJC, VAS, disease duration, ACPA, RF, ESR, CRP, WBC, RBC, HGB, HCT, PLT, MPV, PCT, PDW, L, L%, M, M%, N, N%, NLR and PLR. As shown in
Subsequently, the expression of PBMC hsa_circ_0000175 and hsa_circ_0008410 was detected in 9 new-onset RA cases pre- and post-treatment; however, there was no difference between pre- and post-treatment levels (data not shown).
Next, ROC curves were produced to investigate the diagnostic value of PBMC hsa_circ_0000175 and hsa_circ_0008410 expression in RA. The data indicated that PBMC hsa_circ_0000175 expression had a moderate ability to distinguish RA patients from HC, with an AUC of 0.835, a cut-off of <0.936, a sensitivity of 86.21% and a specificity of 73.33% (
As shown in
Next, ROC curves based on PBMC hsa_circ_0000175 and hsa_circ_0008410 were further analyzed in RA and SLE patients. The AUC for PBMC hsa_circ_0000175 in RA and SLE patients was 0.642, with a sensitivity of 60.92% and a specificity of 66.00% (
The aforementioned results demonstrated that the expression levels of PBMC hsa_circ_0000175 and hsa_circ_0008410 in RA were different from HC, SLE and AS, and were associated with the activity and severity of RA. Thus, to investigate whether the expression labels of PBMC hsa_circ_0000175 and hsa_circ_0008410 were risk factors for RA, the 'enter method' of logistic regression was used. As shown in
To confirm the function of hsa_circ_0000175 and hsa_circ_0008410, potential miRNA targets of the circRNAs were predicted by aligning with the miRNA response elements (MREs) using Arraystar's home-made miRNA target prediction software based on TargetScan (
It has been previously reported that PBMC circRNAs may be associated with RA. In 2017, Ouyang
As shown in
Recent evidence has indicated that circRNAs may serve as novel biomarkers in the diagnosis of RA (
It is well-known that circRNAs may act as miRNA sponges and regulate target genes to alter the course of disease development. Li
However, several limitations of the present study should be acknowledged. Firstly, six circRNAs that were differentially expressed in both PBMC from SLE patients in our previous study and T cells from SLE patients in previous literature were selected, and the possibility of using them as biomarkers for diagnosis of RA was explored. Although RA and SLE exhibit different pathogenies, these two diseases have similar pathological and immunological abnormalities. Furthermore, there were significant differences in the levels of PBMC hsa_circ_0000175 and hsa_circ_0008410 between RA and SLE patients. Thus, the possibility of hsa_circ_0000175 and hsa_circ_0008410 being used as biomarkers for diagnosis of RA require further exploration. Secondly, the sample size of the patients with new-onset RA, SLE, AS and HC was relatively small, and the samples were sourced from only one hospital, which may limit the universality of the results. Therefore, the current findings require confirmation in larger and more diverse samples.
In conclusion, the PBMC hsa_circ_0000175, hsa_circ_0008410, and combination of hsa_circ_0000175 and hsa_circ_0008410, may improve the diagnostic accuracy for RA. In addition, the expression levels of PBMC hsa_circ_0000175 and hsa_circ_0008410 were found to be associated with the activity and severity of RA.
The present was supported by the Key Research and Development Plan Project of Jiangxi Province (grant no. 20181BBG70013), the Science and Technology Plan Project of the Education Department of Jiangxi Province (grant no. 170008), the National Natural Science Foundation of China (grant nos. 81360459 and 81660277), the Jiangxi Provincial Natural Science Foundation of China (grant nos. 20151BAB215031 and 20171BAB205113), the Science and Technology Project of Health and Family Planning Commission of Jiangxi Province of China (grant no. 20165094) and the Foundation for Distinguished Young Scientists of Jiangxi Province of China (grant no. 20171BCB23087).
The data used and/or analyzed during the current study are available from the corresponding author on reasonable request.
QL, LLZ and LBZ performed the experiments. JYR, LZ, YG, ZKH and JML analyzed and interpreted the data. QL and JML made substantial contributions to the design and supervision of the present study, and wrote the manuscript. All authors have reviewed the results and approved the final version of the manuscript.
The present study was approved by the Ethics Committee of the First Affiliated Hospital of Nanchang University. All participants provided informed consent prior to inclusion in the study.
Not applicable.
The sauthors declare that they have no competing interests.
The authors would like to acknowledge Dr Rui Wu (Department of Rheumatology, the First Affiliated Hospital of Nanchang University, Jiangxi, China) for their help in screening patients and collecting specimens.
Screening of abnormally expressed circRNAs in PBMCs from 24 RA patients and 24 HC. (A) The expression of hsa_circ_0082689 exhibited no differences between the two groups (Student's t-test). (B) The expression of hsa_circ_0087798 exhibited no differences between the two groups (Student's t-test). (C) The expression of hsa_circ_0000175 in patients with RA was significantly lower compared with that in HC (Mann-Whitney U test). (D) The expression of hsa_circ_0008410 in patients with RA was significantly higher compared with that in HC (Mann-Whitney U test). (E) The expression of hsa_circ_0049356 exhibited no differences between the two groups (Student's t-test). (F) The expression of hsa_circ_0032959 exhibited no differences between the two groups (Mann-Whitney test). CircRNAs, circular RNAs; HC, healthy controls; PBMC, peripheral blood mononuclear cells; RA, rheumatoid arthritis.
Validation the expression of PBMC hsa_circ_0000175 and hsa_circ_0008410 in the second stage. (A) The expression of hsa_circ_0000175 in PBMCs from 63 RA patients was significantly decreased compared with that in 21 HC (Mann-Whitney test). (B) The expression of hsa_circ_0008410 in PBMCs from 63 RA patients was significantly increased compared with that in 21 HC (Mann-Whitney test). (C) The expression of hsa_circ_0000175 in PBMC from all 87 RA patients was significantly decreased compared with that in all 45 HC (Student's t-test). (D) The expression of hsa_circ_0008410 in PBMC from all 87 RA patients was significantly increased compared with that in all 45 HC (Mann-Whitney test). HC, healthy controls; PBMC, peripheral blood mononuclear cells; RA, rheumatoid arthritis.
Correlation of PBMC hsa_circ_0000175 and hsa_circ_0008410 expression with clinical characteristics of RA. (A) The expression of PBMC hsa_circ_0000175 in RA patients was negatively correlated with ACPA (Spearman's method). (B) The expression of PBMC hsa_circ_0000175 in RA patients was negatively correlated with WBC (Spearman's method). (C) The expression of PBMC hsa_circ_0000175 in RA patients was negatively correlated with N (Spearman's method). (D) The expression of PBMC hsa_circ_0000175 in RA patients was negatively correlated with N% (Spearman's method). (E) The expression of PBMC hsa_circ_0000175 in RA patients was positively correlated with L (Spearman's method). (F) The expression of PBMC hsa_circ_0000175 in RA patients was positively correlated with L% (Spearman's method). (G) The expression of PBMC hsa_circ_0000175 in RA patients was negatively correlated with NLR (Spearman's method). (H) The expression of PBMC hsa_circ_0008410 in RA patients was positively correlated with TJC (Spearman's method). (I) The expression of PBMC hsa_circ_0008410 in RA patients was positively correlated with disease duration (Spearman's method). (J) The expression of PBMC hsa_circ_0008410 in RA patients was positively correlated with PLT (Spearman's method). (K) The expression of PBMC hsa_circ_0008410 in RA patients was positively correlated with PCT (Spearman's method). ACPA, anti-citrullinated protein antibodies; L, lymphocyte count; L%, lymphocyte percentage; N, neutrophil count; N%, neutrophil percentage; NLR, neutrophil-to-lymphocyte ratio; PBMC, peripheral blood mononuclear cells; PCT, platelet-crit; PLT, platelet count; TJC, tender joint count; RA, rheumatoid arthritis; WBC, white blood cell count.
ROC curve analysis of PBMC hsa_circ_0000175 and hsa_circ_0008410 in RA patients. (A) ROC curve analysis of PBMC hsa_circ_0000175 in RA patients vs. HC. (B) ROC curve analysis of PBMC hsa_circ_0008410 in RA patients vs. HC. (C) ROC curve analysis of combined PBMC hsa_circ_0000175 and hsa_circ_0008410 in RA patients vs. HC. AUC, area under the curve; HC, healthy controls; PBMC, peripheral blood mononuclear cells; RA, rheumatoid arthritis; ROC, receiver operating characteristics.
ROC curve analysis of the risk score of PBMC hsa_circ_0000175 and hsa_circ_0008410. (A) There was a significant difference between RA, SLE, and AS patients in the expression of PBMC hsa_circ_0000175 (Kruskal-Wallis test). The expression of PBMC hsa_circ_0000175 was markedly increased in RA compared with SLE patients (Dunn's post-hoc test), while the expression of PBMC hsa_circ_0000175 was markedly decreased in RA compared with AS patients (Dunn's post-hoc test). (B) There was a significant difference between RA, SLE, and AS patients in the expression of PBMC hsa_circ_0008410 (Kruskal-Wallis test). The expression of PBMC hsa_circ_0008410 was markedly increased in RA compared with SLE (Dunn's post-hoc test) and AS patients (Dunn's post-hoc test). (C) ROC curve analysis of PBMC hsa_circ_0000175 in RA vs. SLE patients. (D) ROC curve analysis of PBMC hsa_circ_0008410 in RA vs. SLE patients. (E) ROC curve analysis of PBMC hsa_circ_0000175 in RA vs. AS patients. (F) ROC curve analysis of PBMC hsa_circ_0008410 in RA vs. AS patients. (G) ROC curve analysis of PBMC hsa_circ_0000175 in RA patients vs. controls (HC + SLE + AS). (H) ROC curve analysis of PBMC hsa_circ_0008410 in RA patients vs. controls (HC + SLE + AS). (I) ROC curve analysis of combined PBMC hsa_circ_0000175 and hsa_circ_0008410 in RA patients vs. controls (HC + SLE + AS). AUC, area under the curve; AS, ankylosing spondylitis; HC, healthy controls; K-W test, Kruskal-Wallis test; PBMC, peripheral blood mononuclear cells; RA, rheumatoid arthritis; ROC, receiver operating characteristics; SLE, systemic lupus erythematosus.
Snippet of the detailed annotation for circRNA/miRNA interactions. (A) hsa_circ_0000175/hsa-miR-608, hsa_circ_0000175/hsa-miR-654-3p and hsa_circ_0000175/hsa-miR-3652 interaction. (B) Hsa_circ_0008410/hsa-miR-6776-3p, hsa_circ_0008410/hsa-miR-412-3p and hsa_circ_0008410/ hsa-miR-4697-3p. CircRNA, circular RNA; miRNA, microRNA.
Details of the selected circRNAs.
circRNAs | Source | Chrom | Strand | circRNA_type | GeneSymbol |
---|---|---|---|---|---|
hsa_circ_0082689 | circBase | chr7 | − | Exonic | PARP12 |
hsa_circ_0087798 | circBase | chr9 | + | Exonic | NIPSNAP3A |
hsa_circ_0000175 | circBase | chr1 | − | Exonic | ELK4 |
hsa_circ_0008410 | circBase | chr17 | + | Intronic | PGS1 |
hsa_circ_0049356 | circBase | chr19 | + | Exonic | CARM1 |
hsa_circ_0032959 | circBase | chr14 | − | Exonic | CCDC88 |
circRNAs, circular RNAs.
Specific circRNAs primers used for RT-qPCR analysis.
circRNAs | Primer sequence (F) | Primer sequence (R) |
---|---|---|
hsa_circ_0082689 | GTCCCCAAACACTCTTAGCCA | CACACTCAGGTTGTGTTCGG |
hsa_circ_0087798 | GCAGTTCATGTTCTTTGGTGGA | CTGGGTCCCGTAGCAAAAGA |
hsa_circ_0000175 | GCCCATTTTCCCCAGACCTAC | GGAACTGCCACAGGGTGATA |
hsa_circ_0008410 C | TGCTTTTGTCCTTGAAGCCAG | CACCAGCTCCGTGAAGAAGTC |
hsa_circ_0049356 C | ACCAAGGCCAACTTCTGGTA | CGGTCCGTCAGGTTGTTACT |
hsa_circ_0032959 | ACAGCTGGACATTGAGACCC | TTTCCTCTCACACTGGACAGC |
β-actin | TACTGCCCTGGCTCCTAGCA | TGGACAGTGAGGCCAGGATAG |
circRNAs, circular RNAs; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; F, forward; R, reverse.
Clinical characteristics of the patients with RA, HC, SLE and AS.
Clinical characteristic | RA | HC | AS | SLE |
---|---|---|---|---|
Number of subjects | 87 | 45 | 41 | 50 |
Sex | ||||
Male | 16 | 10 | 29 |
4 |
Female | 71 | 35 | 12 |
46 |
Age, years | 49.89±12.86 | 45.24±13.43 | 31.02±9.96 |
35.85±15.48 |
Days since diagnosis | 1,400.01±2,268.53 | |||
DAS28-ESR | 5.99±1.51 | |||
DAS28-CRP | 5.35±1.38 | |||
SJC | 10.83±7.65 | |||
PJC | 12.53±7.54 | |||
VAS | 48.44±31.39 | |||
RF, IU/ml | 436.02±558.63 | |||
ACPA, RU/ml | 911.04±972.24 | |||
ESR, mm/h | 51.04±33.32 | 20.08±20.85 |
63.49±36.74 | |
CRP, mg/l | 27.54±32.13 | 11.08±16.04 |
17.86±33.18 | |
WBC, 109/l | 7.97±2.39 |
5.74±0.83 | 7.40±1.66 | 6.32±3.66 |
RBC, 1012/l | 4.37±0.51 |
4.56±0.37 | 4.78±0.71 |
3.75±0.82 |
HGB, g/l | 124.60±19.99 |
138.87±11.37 | 140.78±20.59 |
117.66±77.67 |
HCT, l/l | 0.38±0.05 |
0.41±0.03 | 0.43±0.06 |
0.33±0.08 |
PLT, 109/l | 329.36±121.63 |
244.20±51.96 | 319.88±69.42 | 201.50±105.79 |
MPV, fl | 10.22±1.41 |
10.91±0.89 | 9.46±1.02 |
10.63±1.27 |
PCT, % | 0.33±0.11 |
0.26±0.05 | 0.30±0.06 | 0.25±0.09 |
PDW, fl | 12.61±3.29 |
12.9±2.48 | 14.06±2.62 |
12.95±2.67 |
L, 109/l | 1.64±0.58 |
1.84±0.31 | 2.08±0.57 |
1.25±0.64 |
L, % | 21.57±8.51 |
32.41±5.31 | 28.51±7.13 |
23.37±10.46 |
M, 109/l | 0.43±0.17 |
0.35±0.07 | 0.44±0.15 | 0.49±0.39 |
M, % | 5.63±2.04 |
6.12±1.30 | 6.07±1.96 | 7.77±3.24 |
N, 109/l | 5.74±2.25 |
3.42±0.71 | 4.70±1.38 |
4.51±3.16 |
N, % | 70.47±10.45 |
59.04±5.95 | 62.98±7.53 |
67.80±11.87 |
PLR | 237.62±181.47 |
136.03±36.19 | 164.94±57.32 |
191.23±136.05 |
NLR | 4.12±2.73 |
1.90±0.50 | 2.43±0.98 |
4.26±3.84 |
P<0.05 RA compared to HC,
P<0.05 AS compared to RA,
P<0.05 SLE compared to RA. ACPA, anticitrullinated protein antibodies; AS, ankylosing spondylitis; CRP, C-reactive protein; DAS28, disease activity score; ESR, erythrocyte sedimentation rate; HC, healthy controls; HCT, hematocrit; HGB, hemoglobin; L, lymphocyte count; L%, lymphocyte percentage; M, monocyte count; M%, monocyte percentage; MPV, mean platelet volume; N, neutrophils count; N%, neutrophils percentage; NLR, neutrophil-to-lymphocyte ratio; PCT, plateletcrit; PDW, platelet distribution width; PLR, platelet-to-lymphocyte ratio; PLT, platelet count; PJC, pain joint count; RA, Rheumatoid arthritis; RBC, red blood cell count; RF, rheumatoid factors; SLE, systemic lupus erythematosus; SJC, swollen joint count; VAS, visual analogue scale; WBC, white blood cell count.
Expression of PBMC hsa_circ_0000175 and hsa_circ_0008410 in equation.
Item | B | S.E | Wald | df | P | Exp (B) |
---|---|---|---|---|---|---|
hsa_circ_0000175 - | 2.019 | 0.443 | 20.742 | 1 | <0.0001 | 0.133 |
hsa_circ_0008410 | 0.550 | 0.106 | 26.877 | 1 | <0.0001 | 1.733 |
Constant | −0.292 | 0.351 | 0.694 | 1 | 0.4050 | 0.747 |
circRNAs, circular RNAs.