The aim of the present study was to investigate the effects of
Stress is caused by a variety of stressors, that is, harmful stimuli or challenges that lead to various physiological, behavioral, emotional and cognitive alterations known as stress responses. It is an adaptive response mediated by the stress system, which includes the central nervous system and peripheral components in various physiological and pathological states. The primary components of the stress system are corticotropin-releasing hormone (CRH), also known as corticotropin-releasing factor, locus coeruleus-norepinephrine-autonomic systems and their peripheral effectors, the hypothalamus-pituitary-adrenal (HPA) axis and the limbs of the autonomic system (
Following acute exposure to stressors, including fatigue, heat shock, skin burn, cooling, frostbite, immobilization and swimming under load, the amplitude and synchronization of the CRH and arginine-vasopressin pulsations in the hypophyseal portal system markedly increase, causing adrenocorticotropic hormone (ACTH) and cortisol secretion levels to increase (
Adaptogens augment resistance to stress and increase concentration, performance and fatigue endurance (
As medicinal plants,
Previous studies have shown that ADAPT-232 forte, which comprises
In a previous study, we established an acute stress model in which adult rats were subjected to water-floating and high-intensity exercise, with the aim of simulating psychological and physical stress, respectively (
A total of 40 male Sprague-Dawley rats (age, 10 weeks; weight, 300±20 g) were purchased from the Shanghai SLAC Laboratory Animal Co. Ltd. (Shanghai, China). Prior to the study, the rats were housed for 3 days in a clean-grade animal breeding center with an indoor temperature of 20–24°C and humidity of 50–70%, under alternate dark/light cycles. Tap water and laboratory feed were available
Four identical plastic containers (1.00×0.67×0.60 m) were used as floating devices and were placed in an inflatable swimming pool (3.8×5 m) in which a wave of 15–20° was produced using three water pumps (Shenzhen XingRisheng Industrial Co., Ltd., Shenzhen, China). Three-year-old tabby cats, weighing ~5 kg, were purchased from a local pet store, fed feline food, and maintained in a cage in a clean-grade room with an alternate light/dark cycle at 20–24°C and 50–70% humidity. According to the feline predator stress model proposed by Adamec
At 7:00 a.m. on day 7, the rats in the
Following the treadmill exercise, all rats were anaesthetized with 50 mg/kg sodium pentobarbital dissolved in normal saline and sacrificed via decapitation. Within 30 min, 5 ml blood was harvested, the hair and skull at the back of the head were carefully removed and the hypothalamus was isolated using tweezers. Hypothalamic tissue was immediately immersed in liquid nitrogen and stored at −80°C for subsequent reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assays to evaluate the mRNA expression levels of CRH, NPY, c-Fos and Fra-2. Serum was isolated for the subsequent measurement of ACTH and IL-1β concentrations.
CORT concentration was measured using a CORT ELISA kit (assay sensitivity of 46.88 pg/ml; Elabscience Biotechnology Co., Ltd., Wuhan, China) according to the manufacturers instructions. Briefly, serum samples were added to 96-well plates containing biotinylated primary antibody and incubated at 37°C for 45 min. Plates were washed and horseradish peroxidase-conjugated streptavidin solution was added to the wells and incubated for a further 30 min at 37°C. The plates were then washed, 3,3,5,5-tetramethylbenzidine substrate was added and the plates were incubated for an additional 15 min at 37°C. Finally, stop solution was added to the wells to terminate the reaction. The resultant absorbance was measured at 450 nm using an iMark microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The concentration of CORT was determined using a standard curve.
Serum ACTH and IL-1β concentrations were measured using radioimmunoassay testing kits (North Institute of Biological Technology, Beijing, China), according to the manufacturers instructions. Assay sensitivities for ACTH and IL-1β were <0.1 ng/ml and <5 pg/ml, respectively, for a 100-µl sample. The detection limit for ACTH was ~405 pg/ml.
Frozen hypothalamic tissue was punched and ground into pellets using a mortar and pestle so that the pellets were as small as possible. RNA was isolated and subsequently purified from the punched pellets of hypothalamic tissue using an RNAprep Micro Sample RNA Extraction kit, according to the manufacturer's protocol (BioTeke Corporation, Beijing, China). Following the isolation and purification of the total RNA, the concentration of each individual total RNA sample was standardized as 250 ng/ml. To generate single-strand cDNA, total RNA was used as the starting template for first strand cDNA synthesis, using a PCR RevertAid First strand cDNA Synthesis kit (Thermo Fisher Scientific, Waltham, MA, US) according to the manufacturer's instructions. Subsequently, qPCR was performed using CFX connect Real-Time qPCR system (Bio-Rad Laboratories, Inc.) and a SuperReal PreMix Plus (SYBR Green; Qiagen, Inc., Valencia, CA, USA) kit. The PCR primers used for each gene are presented in
All measurement data are expressed as the mean ± standard error of the mean. Absolute measurement data of hormone concentrations are provided; however, gene expression data are expressed as arbitrary optical density units. One-way analysis of variance was used to determine the significance of the effects of the adaptogen treatment on hormone and gene expression. If a significant interaction was detected, post hoc Dunnets t-tests were performed. All stressed groups were compared with the control group using the one-tailed t-test on the basis of the
The mRNA expression levels of CRH in the hypothalamus were significantly higher in the stress control group compared with the quiet control group (P<0.05). No significant differences in the serum levels of CORT and ACTH were detected between the stress control and quiet control groups following the water-floating and exhaustion experiments. The expression levels of CRH mRNA in the hypothalamus and of CORT in the serum were significantly reduced in the
No significant differences in the serum IL-1β levels and hypothalamic NPY mRNA expression were identified between the four groups (P>0.05;
The c-Fos and Fra-2 mRNA expression levels in the hypothalamus of the stress control group were significantly higher compared with those of the quiet control (P<0.05). The c-Fos mRNA expression levels in the
In the present study, a 3-h water-floating experiment including a feline predator stress element, and a 2-h treadmill exercise were conducted as psychological and physical stressors, respectively. Prior to the initiation of the experiment, all rats underwent 6 days of training to enable them to adapt to the long-term and intense stimulations on day 7. Following the experiment, serum levels of CORT and ACTH were determined, in addition to the CRH mRNA expression levels in the hypothalamus. CRH mRNA expression was significantly increased following exposure to prolonged compound stress; however, no significant differences in ACTH and CORT levels were observed. Furthermore, ACTH levels appeared to decrease slightly following the compound stress. It has been reported that the magnitude and duration of increases in serum ACTH concentration may be associated with the duration and intensity of the ACTH-releasing stimulus, and that elevated levels of ACTH persist throughout a 2-h period of ether stress (>700 pg/ml) (
Notably, the present results demonstrated that
In the present study, the effects of
In addition to stress-induced changes in the HPA axis and cytokine expression following stimulation with various stressors, a number of ‘molecular chaperones’ appear to be crucially involved in the regulation of the neuroendocrine system and immune response (
Numerous studies have identified the central pathways mediating the stress response by mapping neuronal activation using c-Fos as a dependable indicator (
A previous study has demonstrated that stress induces a marked elevation in the expression levels of the AP-1 complex in the rat hypothalamus, pituitary gland, adrenal gland and gastric mucosa, suggesting that AP-1 binding may be a sensitive tool for monitoring the severity of inputs of extracellular stress signals (
In the present study, following persisting stimuli, Fra-2 mRNA expression was significantly induced in the hypothalamus after 5 h of physical and psychological stress. Furthermore, following treatment with
The stress-associated markers investigated in the present study are associated with each other, participating in the complex process of the stress response. For example, a synthetic analogue of an ACTH (
In conclusion, the present study demonstrated that CRH, c-Fos and Fra-2 levels were significantly elevated after 5 h of prolonged compound stress.
The present study was supported by the Scientific Research Foundation in the Twelfth Five-Year Plan Period of China (no. CWS11J252). The authors thank the Department of Traditional Chinese Medicine of Nanjing Jinling Hospital for providing
Comparison of the hypothalamus levels of CRH and the serum levels of CORT and ACTH between the four groups. (A) The mRNA expression levels of CRH in the hypothalamus were significantly increased in the stress control group compared with the quiet control following the water-floating and exhaustion experiments. By contrast, the serum levels of (B) CORT and (C) ACTH showed no significant difference. Compared with stress control group, the mRNA expression levels of CRH in the hypothalamus and the serum level of CORT were significantly reduced in
Comparison of serum IL-β levels and hypothalamic NPY mRNA expression levels between the four groups. No significant differences were detected in the (A) serum IL-1β levels and (B) hypothalamic NPY mRNA expression levels between the rats in the four groups (P>0.05). IL-1β, interleukin-1β;
Comparison of c-Fos and Fra-2 mRNA expression levels in hypothalamus between the four groups. The mRNA expression levels of (A) c-Fos and (B) Fra-2 in the hypothalamus of the stress control group were significantly elevated compared with the quiet control group. The c-Fos mRNA expression levels in the
Primer sequences for polymerase chain reaction.
Gene | Direction | Primer (5′-3′) |
---|---|---|
CRH | Forward | ATCTCACCTTCCACCTTCTG |
Reverse | GCAACATTTCATTTCCCGATAATC | |
NPY | Forward | ACAGAGATATGGCAAGAGA |
Reverse | CACAGGATGAGATGAGATG | |
c-Fos | Forward | GGGAGGACCTTATCTGTGCG |
Reverse | TCTCCGGAAGAGGTGAGGAC | |
Fra-2 | Forward | AACCTTGTCTTCACCTACC |
Reverse | CCACTGCTACTGCTTCTG |
CRH, corticotropin-releasing hormone; NPY, neuropeptide-Y; Fra-2, Fos-related antigen 2.