Human tumor tissues and sera were obtained from the Department of Pathology, Pusan National University Hospital after diagnosis and staging. Tissues were frozen in liquid nitrogen and stored at −80°C until use. The human colon cancer cell lines SNU-C1, SNU-C2A, SNU-C4, and SNU-C5; the human ovarian cancer cell lines SNU-8 and SNU-840; the human lung cancer cell lines SK-LC-5 and SK-LC-14; and the human breast cancer cell line MCF7 were obtained from the Korean Type Culture Collection (KTCC) and the American Type Culture Collection (ATCC). All these cell lines were maintained in RPMI-1640 medium (Gibco-BRL Life Technologies Inc., Grand Island, NY, USA) supplemented with 10% fetal bovine serum, 2 mM l-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin. The study was conducted under an approved protocol from Ethical Committeee in this institution.

Total RNA was isolated from human tissue samples and human tumor cell lines using the standard TRIzol reagent (Life Technologies, Gaithersburg, MD, USA) and RNA isolation kit (RNeasy Maxi Kit, Qiagen, Hilden, Germany) following the manufacturer's instructions. The amount of RNA isolated was measured at 260 nm by a spectrophotometer (Ultrospec 2000, Pharmacia Biotech, Cambridge, UK). Normal tissue total RNA was purchased from Clontech Laboratories, Inc. (Palo Alto, CA, USA) and Ambion, Inc. (Austin, Texas, USA). Total RNA from several cancer cell lines other than the ones used in this experiment was obtained from the Ludwig Institute for Cancer Research (LICR), New York Branch at the Memorial Sloan-Kettering Cancer Center.

Poly(A)+ RNA from normal testis was purchased from Clontech Laboratories Inc. mRNA (5 μg) was used to construct a cDNA library in the ZAP Express vector (Stratagene, La Jolla, CA, USA), following the manufacturer's instructions. The library contained approximately 1 million recombinants and was used for immunoscreening without prior amplification. Serum was prepared from a colon cancer patient and was diluted 1:200 for SEREX analysis. The colon cancer patient was immunized frequently (5 times) with a new dendritic cell vaccine (DC-Vac) into which autologous tumor lysate was loaded by electroporation and pulse. Serum from a human colon cancer patient was kindly provided by Dr Chi-Dug Kang (Pusan National University, Pusan City, Korea). The patient is a 56-year-old male with stage IV colon cancer. All sera from colon cancer patients and healthy individuals used in this study were diluted 1:200. To remove serum antibodies that react with Escherichia coli/bacteriophage-related antigens, sera were absorbed with E. coli/bacteriophage lysates as described by Lee et al (15).

Immunoscreening of the cDNA library was performed as previously described (15,22). Briefly, E. coli XL1 blue MRF cells were transfected with the recombinant phages, and then plated at a density of approximately 5,000 pfu/150-mm plate (NZCYM-IPTG agar). The plates were incubated at 37°C for 8 h, and transferred to nitrocellulose filters (Protran BA 85, 0.45 μm; Schleicher & Schuell, Keene, NH, USA). The filters were then incubated with a 1:200 dilution of the patient's sera, which had been preabsorbed with E. coli-phage lysate. The serum-reactive clones were detected with an AP-conjugated secondary antibody and visualized by incubation with 5-bromo-4-chloro-3-indolyl-phosphate/nitroblue tetrazolium (BCIP/NBT). After screening, the isolated positive clones were removed from the plate and preserved in suspension medium (SM) buffer with 25 μl of chloroform. Positive phages were mixed with a helper phage to co-infect XL-1 Blue MRF, and they were rescued into pBluescript phagemid forms by in vivo excision. The excised phagemids were transformed into the host bacteria (XLOLR) to amplify plasmid DNA for extraction and stock. The size of the inserted cDNA was determined by restriction enzyme digestion with EcoRI and XhoI. The cDNA was sequenced commercially (Macrogen, Seoul, Korea).

The cDNAs were prepared for use as templates for RT-PCR using the Superscript first strand synthesis kit (Invitrogen Life Technologies, Carlsbad, CA, USA) with 1 μg of total RNA. The specific primers used for KP-CoT-23 were GCGATGAAGGAAAAATGGAA (forward) and GAGC CAGTCATTCTCCCAGATIIIIIGATAACTGC (reverse). For blocking extension of non-specifically primed templates and generating consistently high PCR specificity, we used a dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker (Segene Ins. Seoul, Korea). PCR primers used to verify the CCDC83 variants were GGA TGTTGAAGAAGCGATGAAGGA (forward) and CCAGGG GGCCCAAGTTTACA (reverse). The cDNA template concentrations were normalized to the amplification of GAPDH. For PCR, a 20 μl reaction mixture containing 2 μl of cDNA, 0.2 mM dNTP, 1.5 mM MgCl₂, 0.25 μM each of the gene specific forward and reverse primers, and 3 units of Taq DNA polymerase (Solgent, Daejun, Korea) was preheated to 94°C for 5 min, followed by 35 cycles at 94°C for 30 sec, 60°C for 30 sec, and 72°C for 1 min followed by a final elongation step at 72°C for 5 min. Amplified PCR products were analyzed on 1.5% agarose gels stained with ethidium bromide.

To generate His-tagged KP-CoT-23 proteins, we selected an open reading frame (ORF) cDNA from codons 514 to 1,748 within the CCDC83 ORF (NM_173556), including the target sequence for KP-CoT-23 variants. The PCR products contained the NdeI and XhoI restriction enzyme sites. The primers for the partial protein were GGAATTCCATATGGAAAACTCAGGG (forward) and CCGCTCGAGGAGAAAAGACTTCA (reverse). The PCR product was subcloned into the pET21a expression plasmid. E. coli BL21 cells containing the KP-CoT-23 plasmid were grown in LB liquid medium, and IPTG was added to a final concentration of 0.5 mM. Affinity chromatography using Ni-NTA resin (Qiagen) was performed to purify KP-CoT-23 recombinant protein. The purity of the recombinant protein was determined by SDS-PAGE and western blotting using anti-His antibody (Invitrogen Life Technologies) (Fig. 4C).

A 100 ng of purified 6X His-KP-CoT-23 protein was separated on a 10% SDS-PAGE and transferred to a nitrocellulose membrane (Hybond-ECL; GE Healthcare, Little Chalfont, UK). After blocking with TBST (TBS and 0.1% Tween-20) containing 5% skim milk for 1 h at room temperature, the membrane was incubated in sera (1:200 dilution) overnight at room temperature. The membranes were washed and incubated with horseradish peroxidase-conjugated sheep anti-human IgG antibody (GE Healthcare) (1:3,000 dilution) for 1 h at room temperature. After washing with TBST and incubating with chemiluminescence reagent plus (PerkinElmer, Waltham, MA, USA), the membrane was exposed to Kodak medical X-ray film.

A testis cDNA expression library containing approximately 2x10⁵ clones was immunoscreened with serum from a colon cancer patient immunized with dendritic cells. As shown in Table I, 64 clones representing 40 genes were isolated, and the antigens were designated the names KP-CoT-1 through KP-CoT-40.

When the cDNA sequences encoding the 40 colon cancer antigens were compared to those in the Cancer Immunome Database, 17 of the 40 antigens (43%) had been previously identified by SEREX analysis with any cDNA/serum combination, while the remaining 23 (57%) had not been previously reported (Table I). These included 3 genes with testis-specific expression in the UniGene database (KP-CoT-11, KP-CoT-23, and KP-CoT-27). Among the 3 genes with testis-specific profiles, KP-CoT-11, corresponding to sperm acrosome-associated protein (SPACA7), which was represented by 2 overlapping clones, was isolated. KP-CoT-27 was previously reported as a CT antigen, CAGE (23). KP-CoT-23 was identical to coiled-coil domain containing 83 (CCDC83). KP-CoT-2 (GKAP1), which was represented by 15 clones, was the most frequently isolated gene. Although GKAP1 mRNA expression was observed in some normal tissues, the highest expression was observed in the testis as previously reported (24).

The sequence of the isolated 860-base KP-CoT-23 clone completely matched bases 370 to 1,239 in the 2,345-bp sequence of CCDC83. Comparison with genome databases showed that CCDC83 has 3 splice variants of 2,345 bp (CCDC83-1, NM_173556), 2,035 bp (CCDC83-2, BC040208), and 1,030 bp (CCDC83-3, AY251167), which encode for proteins of 444, 413, and 314 amino acids, respectively. The CCDC83 gene is approximately 52 kb and contains 11 exons, whereas CCDC83-2 has a deletion in exon 8 and CCDC83-3 has deletions in exons 4 and 8. To verify these 3 variants, we performed RT-PCR using specific primer sets that included the deletion regions of testis and several cancer cell lines. As shown in Fig. 1, RT-PCR analysis yielded the expected 3 bands, including a major 800-bp band (CCDC83-2), in testis, whereas only one band (CCDC83-3) or two bands (CCDC83-2 and -3) were detected in the colon cancer cell line SK-CO-1, the breast cancer cell line MCF7, and the small lung cancer cell line NCI-H146. No CCDC83-1 mRNA expression was observed in the cancer cell lines tested. Each band was cloned and sequenced. We confirmed that CCDC83-2 has a deletion in exon 8 and CCDC83-3 has deletions in exons 4 and 8 (data not shown). The KP-CoT-23 clone isolated matched exons 1–5 of the 11 exons in the CCDC83 gene. In this region, 2 KP-CoT-23 variants were named KP-CoT-23a, which included 5 exons, and KP-CoT-23b, which had 4 exons (deletion of exon 4 in KP-CoT-23a).

To investigate the restricted expression of KP-CoT-23 variant mRNAs in normal adult tissues, RT-PCR was performed using gene specific primer pairs to detect KP-CoT-23a and KP-CoT-23b. As shown in Fig. 2, expression of the 2 KP-CoT-23 variant mRNAs was restricted to the testis. KP-CoT-23a was strongly expressed in testis, while KP-CoT-23b was weakly expressed. The KP-CoT-23a and KP-CoT-23b genes were frequently and broadly expressed in a variety of cancer cell lines, including colon cancer cell lines (9/10 and 10/10, respectively), hepatoma cell lines (1/3 and 3/3, respectively), breast cancer cell lines (5/6 and 6/6, respectively), lung cancer cell lines (8/10 for both), ovary cancer cell lines (6/9 and 5/9, respectively), melanoma cell lines (3/9 and 2/9, respectively), renal cancer cell lines (1/2), sarcoma cell lines (3/6 and 6/6, respectively), and renal cancer cell lines (2/2 for both) (Fig. 3A, Table II). In addition, the KP-CoT-23a and KP-CoT-23b genes were expressed in various tumors, including colon cancer (4/16 and 12/16, respectively), stomach tumors (3/10 and 4/10, respectively), breast cancer (4/10 and 9/10, respectively), lung cancer (9/16 and 6/16, respectively), and ovarian cancer (9/10 and 10/10, respectively) (Fig. 3B). These results indicate that KP-CoT-23 is a novel cancer testis antigen that is frequently expressed in several types of cancer, including colon cancer.

To determine whether immune recognition of the KP-CoT-23 protein is cancer-related, allogeneic sera samples obtained from 21 healthy blood donors and 37 patients with colon cancer were tested for KP-CoT-23 reactivity by western blot analysis. As shown in Fig. 4A and B, 26/37 (70%) sera from colon cancer patients and 4/21 (19%) sera from healthy patients were reactive against KP-CoT-23. The correlation between KP-CoT-23 mRNA expression and positive IgG was not evaluated due to a lack of paired samples; therefore, this requires further investigation in a future study. Nonetheless, the results of KP-CoT-23 recognition by sera from colon cancer patients and healthy individuals indicate that KP-CoT-23 is an immunogenic tumor antigen in colon cancer patients.