Contributed equally
A 34-KD protein encoded by the
The PI3K/AKT signaling pathway regulates various cellular functions including tumorigenesis by inhibiting apoptosis and activating proliferation of cancer cells (
In an effort to identify the physiological mechanism that triggers the induction of NEDD4-1-mediated PTEN downregulation, we found the involvement of p34SEI-1 in this process. p34SEI-1 is known to act as a transcriptional regulator, cell cycle regulator, senescence inhibitor and apoptosis inhibitor (
In this report, we suggest that p34SEI-1 oncogenic protein promotes tumor progression by inducing NEDD4-1 mediated PTEN ubiquitination/degradation and activating the PI3K/AKT pathway.
MCF7 breast cancer and HEK293 human epithelial kidney cells were used for this study. Each cell line was cultured in DMEM medium (WelGENE Inc., Daegu, Korea) supplemented with 10% fetal bovine serum (Gibco-BRL, Carlsbad, CA, USA) and 1% antibiotic-antimycotic (Gibco-BRL). All of the cells were cultured at 37°C in a humidified atmosphere composed of 95% air and 5% CO2.
Cells were washed in an ice-cold PBS buffer and lased in RIPA lysis buffer (1% sodium deoxycholate, 0.1% SDS, 1% Triton X-100, 10 mM Tris-HCl, pH 8.0, 140 mM NaCl, 0.025% NaN3 and 1.0 mM protease inhibitor). The protein amount was quantified using a protein assay kit (Bio-Rad, Seoul, Korea). Each protein sample was subjected to SDS-PAGE and transferred to an Immobilon Transfer Membranes (Millipore, cat. no. IPVH00010, Billerica, MA, USA). The filter was blocked in 5% non-fat dry milk/0.1% Tween/TBS followed by incubation with each corresponding antibody. Immune-detection was done by using the Power Opti-ECL Western blotting Detection reagent (Bionote, Hwaseong, Korea). Antibodies used in this study were purchased as follows: p34SEI-1 (Enzo Life Sciences, ALX-804-645, Farmingdale, NY, USA), pAKT (Ser473) (Cell Signaling, cat. no. 9271, Danvers, MA, USA), PTEN (Santa Cruz Biotechnology, sc-7974, Santa Cruz, CA, USA), NEDD4-1 (Santa Cruz Biotechnology, sc-25508), and γ-tubulin (Santa Cruz Biotechnology, sc-7396).
For ectopic overexpression of p34SEI-1, MCF7 or HEK293 cells were transfected for 12, 24 or 48 h with 6-8 μg of either C-terminal EGFP-tagged p34SEI-1 expression vector (p34SEI-1-EGFP) or a control vector (pEGFP) by using Lipofectamine 2000 (Invitrogen, Seoul, Korea). To knockdown endogenous p34SEI-1 and NEDD4-1, MCF7 or HEK293 cells were transiently transfected with p34SEI-1 or NEDD4-1 specific siRNA (20 pmol siRNA final concentration) with a control of scrambled siRNA. The following target sequences were used to generate p34SEI-1 or NEDD4-1 siRNA; p34SEI-1 siRNA (5-CCGAAUUGGACUAC CUCAUdTdT-3) and NEDD4-1 siRNA (5-UUCCAUGAAUC UAGAAGAACATT-3 (
To analyze the interaction between p34SEI-1 and NEDD4-1, HEK293 cells were co-transfected with EGFP-tagged p34SEI-1 (p34SEI-1-EGFP) and HA-tagged NEDD4-1 (pHA-NEDD4-1) plasmids and cell lysates were immuno precipitated with either anti-EGFP (Abcam, ab290, Cambridge, MA, USA) or anti-HA (Sigma, H9658, St. Louis, MO, USA) antibodies. IP was performed by lysing cells in IP buffer (50 mM of Tris-HCl pH 7.4, 150 mM of NaCl, 10 mM of NaF, 10 mM of Na3VO4, 1 mM of PMSF, 1% of NP-40) with protease inhibitors, followed by pre-clearing with protein A/G Sepharose (Santa Cruz Biotechnology, sc-2003). Pre-cleared lysates were incubated with each antibody for 16 h at 4°C with continuous agitation, and then protein A/G Sepharose was added. After 4 h, the lysate-antibody-agarose A/G bead complex was collected by centrifugation at 10,000 x g for 5 min, the complex was then washed three times with IP buffer, and proteins were eluted from the beads by boiling them in SDS sample buffer and analyzed by using a western blot with the indicated a ntibodies. Proteins were probed with the corresponding antibodies.
HEK293 cells were transfected with p34SEI-1-EGFP plasmid and/or NEDD4-1 siRNA in the presence of HA-Ub. Forty-eight hours after transfection, cells were treated with 10 μM proteasome inhibitor MG132 (A.G. Scientific Inc, M-1157, San Diego, CA, USA) for 16 h. The cells were lysed with RIPA buffer with protease inhibitors. The lysates were centrifuged to obtain cytosolic proteins. Ubiquitinated PTEN was immunoprecipitated by anti-PTEN antibody (Santa Cruz Biotechnology, sc-7974), followed by immunoblotting with anti-Ub antibody (Santa Cruz Biotechnology, sc-8017).
Four-micrometer-thick sections were sliced onto Silane Coated Micro Slides (Muto Pure Chemicals Corp., Tokyo, Japan) and incubated at 60°C for 2 h. The slides were then deparaffinised by application of xylene and incubation (5 min x 3) at room temperature. Sections were hydrated by applying graded alcohol and endogenous peroxidase activity was quenched by incubating the sections in methanol with 0.3% H2O2 for 30 min at room temperature. After washing the slides in PBS (5 min x 2), antigen retrieval was performed by heating the slides in citrate buffer (0.01 M, pH 6.0) using a microwave in a pressure cooker for 15 min. After heating, the samples were allowed to cool for 2 h at room temperature followed by washing with PBS (5 min x 2). An immunohistochemical analysis was performed using p34SEI-1 (Biorbyt, Cambridge, UK) and NEDD4-1 (Proteintech, cat. no. 13690-1-AP, Chicago, IL, USA) rabbit polyclonal antibodies with 1:50 dilution each by PBS. The tissues were incubated with primary antibodies for 2 h at room temperature and washed three times with PBS followed by incubation using an Ultra Vision Quanto Detection System HRP DAB (Lab Vision Corp., Fremont, CA, USA) according to the manufacturer’s instructions. The immunostained slides were examined by two independent observers and a consensus score was determined for each specimen. A positive reaction for both antibodies was scored into 4 grades, according to the intensity of the staining: 0, 1+, 2+ and 3+. The percentages of positive cells were also scored into 4 categories: 0, 0%; 1, 1–30%; 2, 31–60%; and 3, 61–100%. The final score, calculated as the product of the intensity score multiplied by the percentage score, was classified as follows: 0, negative; 1–3, weak; 4–6, moderate; and 7–9, strong. Samples with a final score less than 3 were grouped together as expression negative while those with a score greater than 4 were grouped together as expression positive.
The total RNA was extracted from HEK293 cells after transfection with either pEGFP or p34SEI-1-EGFP using an RNeasy mini kit (Qiagen, Hilden, Germany). For reverse transcription, 1
Cells were co-transfected with p34SEI-1-EGFP and pGL4-NF-κB plasmids using Lipofectamine 2000 (Invitrogen) transfection reagent following the manufacturer’s protocol, in which the NF-κB genes were subcloned into the pGL4 basic luciferase reporter vector (pGL4.1; Promega). The following day, 14–18 h later, cells were lysed and luciferase assays were performed using Luciferase Assay System (Promega, cat. no. E1501) and the luciferase activity levels were measured after standardization against pGL4.1.
As part of an effort to identify how p34SEI-1 promotes tumor progression in various cancer cells, we initially tested the effect of p34SEI-1 on the PI3K/AKT signaling pathway because of its vital roles in tumorigenesis. After MCF7 and HEK293 cells were transfected with the EGFP control vector (pEGFP) and C-terminal EGFP-tagged p34SEI-1 (p34SEI-1-EGFP) plasmids, AKT phosphorylation on serine 473 residue was examined because phosphorylation on this residue is known to promote signal transduction related with tumor malignancies. Our data showed that p34SEI-1 overexpression significantly increased AKT phosphorylation on this residue (
Our results imply that p34SEI-1 may downregulate PTEN in a NEDD4-1-dependent manner. However, it is possible that p34SEI-1 may affect other proteins or pathways and indirectly cause PTEN downregulation. For example, p34SEI-1 might activate different types of E3 ligases rather than NEDD4-1 and downregulate PTEN. In fact, two different research groups suggested apparently discrepant results. Wang
Our data indicate that p34SEI-1 might exert positive effect on NEDD4-1 expression probably by controlling NEDD4-1 turnover. This hypothesis was examined by employing cycloheximide chase experiment. Briefly, HEK293 cells were transfected with pEGFP and p34SEI-1-EGFP plasmids in the presence of cycloheximide (CHX, 20
In addition, the positive effect of p34SEI-1 on NEDD4-1 expression was also checked at the transcriptional level because p34SEI-1 is a well-known transcriptional co-activator. NEDD4-1 transcription was measured by using RT-PCR after HEK293 cells were transfected with either pEGFP or p34SEI-1-EGFP expression vector. Our data showed that NEDD4-1 transcription was slightly increased by p34SEI-1 overexpression (
Considering the role of p34SEI-1 as a positive regulator of NEDD4-1, we hypothesized that high level of p34SEI-1 in cancer cells might contribute to similar high levels of NEDD4-1 protein in cancer cells. We therefore conducted an immunohistochemical analysis of both p34SEI-1 and NEDD4-1 expression in 36 tissue samples from patients with breast cancer. We assessed p34SEI-1 expression in formalin-fixed and paraffin-embedded samples obtained from surgical resections of 36 patients with breast cancer. Normal and cancer breast tissues showed immune-negative and strong immune-positive staining, respectively, for both p34SEI-1 and NEDD4-1 (
It has been suggested that PTEN is located in the nucleus as well as the cytosol. Trotman
The PI3K signaling pathway plays important roles in cells by controlling many different cellular functions, in which AKT is the key regulator of the PI3K pathway to promote signal transduction related with tumor malignancies. AKT is phosphorylated and activated by either PI3K activation or PTEN inactivation. In the present study, we suggest a mechanism of how p34SEI-1 has oncogenic potential to promote carcinogenesis. Our data show that p34SEI-1 overexpression stabilizes NEDD4-1 and in turn NEDD4-1 induces poly-ubiquitination/degradation of a PTEN tumor suppressor, and subsequently promotes tumorigenesis by positively regulating the PI3K/AKT pathway as summarized in
We previously showed that p34SEI-1 directly binds and stabilizes the X-linked inhibitor of apoptosis protein (XIAP) leading to an anti-apoptotic effect (
Our data revealed that p34SEI-1 affects PTEN subcellular localization as well as its protein expression. It has been suggested that NEDD4-1 can mediate both mono- and poly-ubiquitination of PTEN and it can cause PTEN nuclear transport by catalyzing PTEN mono-ubiquitination (
In summary, our previous and current results suggest that p34SEI-1 is highly expressed in human breast cancer cells acting as an oncoprotein. In this process, p34SEI-1 appears to cause tumorigenesis by inducing NEDD4-1-mediated PTEN down-regulation and positively regulating the PI3K/AKT pathway. Thus, therapeutic strategies that interfere with the function of p34SEI-1 are expected to be promising targets for new anticancer drugs for breast cancer treatment.
34-KD protein encoding SEI-1 (selected with Ink4a-1 as bait) gene;
phosphatase and tensin homolog deleted on chromosome ten;
neuronal precursor cell-expressed developmentally downregulated 4-1;
phosphoinositide-3 kinase
This study was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MEST) (nos. R11-2005-017-04001-0 and 2011-0030701) and Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2012R1A1A3012438).
Effect of p34SEI-1 on the alteration of endogenous pAKT, PTEN and NEDD4-1 protein levels. (A) MCF7 and HEK293 cells were transfected with either an empty control vector (pEGFP) or C-terminal EGFP-tagged p34SEI-1 overexpressing vector (p34SEI-1-EGFP) as indicated in Materials and methods. (B) MCF7 cells were transfected with either scrambled RNA (scRNA) or p34SEI-1 siRNA for 48 h. Endogenous pAKT, PTEN and NEDD4-1 levels was detected by western blot analysis using each corresponding antibody.
Positive effect of p34SEI-1 on the NEDD4-1 stability. (A) HEK293 cells were co-transfected with p34SEI-1-EGFP and/or NEDD4-1 siRNA vector with controls. Expression levels of p34SEI-1, NEDD4-1, PTEN and pAKT were examined by using a western blot analysis. (B) p34SEI-1 induced PTEN poly-ubiquitination. HEK293 cells were transfected with p34SEI-1-EGFP and/or NEDD4-1 siRNA in the presence of HA-Ub and MG132. Cell lysates were immunoprecipitated (IP) with anti-PTEN antibody and immunoblotted (IB) with anti-ubiquitin. The total lysates before immunoprecipitation (Input) and the immunoprecipitate supernatants (Sup) were then subjected to immunoblot analysis with corresponding antibodies.
Positive effect of p34SEI-1 on NEDD4-1 expression. (A) Cycloheximide chase experiment. HEK293 cells were transfected with pEGFP and p34SEI-1-EGFP plasmids for 24 h and treated with cycloheximide (20
Expression of p34SEI-1 and NEDD4-1 in breast tissues containing adjacent histologically normal and invasive ductal carcinoma tissues. (A) Representative images from normal and cancerous tissues. Weak or strong immune-reactivity against p34SEI-1 and NEDD4-1 are detected in normal breast epithelial cells (panels a and b) or in breast cancer cells (panels c and d), respectively. (B) Approximately half (i.e., 18 of 36) of the tumor samples from patients with breast cancer reacted with the anti-p34SEI-1 antibody, whereas 21 of the tumor samples reacted with the anti-NEDD4-1 antibody. (C) The correlation in p34SEI-1 and NEDD4-1 expression levels of tissue samples. The statistical correlation between the expression of p34SEI-1 and NEDD4-1 in human breast cancer was determined using an chi-square test (i.e., P=0.000001531).
Change of subcellular localization of PTEN in response to overexpressed p34SEI-1. MCF7 cells were transfected with pEGFP and p34SEI-1-EGFP vectors for indicated times and PTEN sub-localization was detected with immunofluorescence staining as indicated in Materials and methods.
Summary model. Cellular function of p34SEI-1 onco-protein in NEDD4-1-mediated ubiquitination/degradation of PTEN tumor suppressor protein and activation of the PI3K/AKT pathway.
Oligonucleotide sequences and conditions for RT-PCR analysis.
Primer name | Primer sequence (5′→3′) |
Amplicon | Conditions size (bp) |
Source |
---|---|---|---|---|
pRT-SEI-1 | F: AGGACCTCAGCCACATTGAG | 142 bp | 60°C | This study |
R: GGTGCCCAAAGTTCATTGTC | 27 cycles | |||
pRT-NEDD4-1 | F: GGAGTTGCCAGAGAATGGTT | 151 bp | 60°C | This study |
R: TTGCCATGATAAACTGCCAT | 27 cycles | |||
pRT-NF-κB | F: CCGCACCTCCACTCCATCC | 121 bp | 62°C | Sarma |
R: ACATCAGCACCCAAGGACACC | 26 cycles | Du and Galan ( | ||
pRT-ACTB | F: AGGTCGGAGTCAACGGATTTG | 377 bp | 58°C | This study |
R: GTGATGGCATGGACTGTGGT | 21 cycles |
F, forward primer; R, reverse primer.
All sequences are shown in the 5′→3′ direction.
Conditions are shown in the order of annealing temperature (°C) and number of cycles.