Introduction
Glioma is the most common primary brain tumor affecting yearly 3–5/100,000 and occurring mainly in adults >45 years old (1–3). The ability of glioma to invade and infiltrate diffusely contiguous brain tissue limits the complete surgical resection and the efficacy of standard therapies (4). Glioblastoma multiforme (GBM), a grade IV astrocytoma as currently defined by the World Health Organization (WHO) classification (5), is the most common and the most lethal form of brain tumor. The therapeutic approach against this tumor consists in surgical resection followed by radiation and chemotherapy with temozolomide (TMZ) (6,7). At present, such treatment can only slightly modify the patient’s outcome. In fact, the tumor typically recurs after an average of only 6.9 months, resulting in a median survival rate of <1 year following diagnosis (8). Permanent cell lines represent important tools to study the behaviour of human tumors, such as their growth and metabolism, drug sensitivity and resistance, as well as genomic and expression profiles (9–11). Furthermore, some cultivated cancer cells can originate a novel tumor when transplanted into nude mice, providing an experimental system to test potential novel therapeutic drugs (12). Here we report the establishment and the characterization, by cytogenetic and molecular approaches, of a novel cell line termed as ANGM-CSS, derived from a patient with GBM.
Materials and methods
Patient history
The patient was a 56-year-old male, surgically treated to remove a large primary tumor localized in the left temporo-occipital lobe with invasion of the ventricular cornus (Fig. 1A). Hematoxylin and eosin staining (Fig. 1B) and immunohistochemical examination for GFAP, α-SMA and HMB45 were performed as part of the routine assessment of tumor type/phenotype. Immunostaining demonstrated a weak positivity for GFAP (Fig. 1C) but was negative for α-SMA and HMB45 (data not shown). The final diagnosis was GBM with spindle, mitotically active cells showing a fascicular growth pattern. After surgery, the patient was treated with temozolomide at a daily dose of 75 mg/m2 of body surface in association with fractionated radiotherapy (60 Gy) for 6–7 weeks. The patient died 18 months after surgery.
Establishment of primary culture
After surgical removal, upon institutional Ethics Committee approval, the tumor specimen was placed immediately in DMEM-F12 medium without serum, repeatedly washed with phosphate-buffered saline (PBS, Invitrogen, Carlsbad, CA, USA) and then placed in a 30-mm Petri dish. The specimen was cut in 1–2 mm or tinier fragments and transferred in a poly-D-lysine treated flask with a small amount of Dulbecco’s modified Eagle’s medium/F12 medium (D-MEM/F12, Invitrogen) (1:1, v/v) supplemented with 10% fetal bovine serum (FBS, Invitrogen), 100 U/ml penicillin and 100 μg/ml streptomycin (PenStrep, Invitrogen) in order to allow the fragments to adhere to the surface of the flask. Primary culture was incubated at 37°C in 5% CO2 humidified atmosphere, and 5 ml of complete medium was added 24 h later. After one week, the primary culture was washed with PBS to remove non-adherent fragments and fresh medium prewarmed at 37°C was added. These procedures were repeated every 3 days until primary culture reached local confluence. Then cells were treated with 0.05% trypsin (Invitrogen) and 0.02% EDTA (Invitrogen), washed with PBS and transferred into a T-75 flask without biocoat and containing complete medium DMEM/F12. Next, the culture was serially transferred by using the same procedures once or twice a week. Every 10 passages, one amount of cells was counted with Z1-Coulter (IL-Laboratories). Cells (50×106) were frozen in medium with 10% dimethyl sulfoxide (DMSO) and stored in liquid nitrogen. Cells were propagated by serial passages (split ratio 1:3) along 2 years, until 105th passage. Growth curves were established at the 32nd passages by seeding 1×105 cells into three 35-mm culture dishes. Triplicate dishes were harvested and counted daily with Z1-Coulter (IL-Laboratories). The cell number was determined as the average number of cells ± SD in each time interval.
Immunophenotypical characterization of ANGM-CSS cell line
Immunofluorescence analysis was performed at different passages to establish GFAP, nestin, CD133 and vimentin localization in the ANGM cell cultures. After trypsin treatment, 105 cells were seeded on 20×20 mm coverslips, rinsed twice in PBS, and fixed in PBS containing 4% formaldehyde (pH 7.2–7.4) for 10 min at room temperature (RT), washed for 10 min three times with PBS, permeabilized with PBS/0.2% Triton X-100 (MP Biomedical) and blocked for 30 min with PBS containing bovine serum albumin (BSA). After three washings with PBS, the cells were incubated with a primary antibody against CD133 (AP2010b, purified rabbit, ABGENT), nestin (sc-23927, mouse monoclonal IgG1, Santa Cruz Biotechnology), vimentin (sc-6260, mouse monoclonal IgG1, Santa Cruz Biotechnology), GFAP (sc-58766, mouse monoclonal IgG1, Santa Cruz Biotechnology) diluted 1:300 in BSA for 1 h at RT. After extensive washing in PBS, the coverslips were incubated with the secondary antibodies for 30 min at room temperature. A goat anti-mouse IgG-FITC conjugated (sc-2010, 1:200, Santa Cruz Biotechnology) for vimentin, nestin and GFAP, and a goat anti-rabbit Ig-G FITC conjugated (sc-2012, 1:200, Santa Cruz Biotechnology) for CD-133 were used as secondary antibodies. Nuclei were then washed only once with PBS and stained with DAPI (1 mg/ml). The fluorescent staining was visualized using Nikon E1000 microscopy.
Cytogenetic analysis
ANGM-CSS cells were subcultured at passages 5, 32, 67, 86 and incubated overnight with Colcemid (0.05 mg/ml, Invitrogen). Cells were dispersed with 0.5% trypsin (Invitrogen) and 0.02 EDTA (Invitrogen), then washed with 1X PBS and treated with 0.075 M KCl hypotonic solution and fetal bovine serum (1:1, v/v) for 20 min at 37°C. The cells were then fixed with methanol:acetic acid (3:1, v/v) solution and stored for 1 h at −20°C. Cell suspension were dropped on ice glass slides and stained in Giemsa stain after banding with GAG-acid solution at 55°C. Karyotyping was performed by use of the Genikon software (Nikon Italia, Firenze, Italy) and described in accordance to the International System for Human Cytogenetic Nomenclature (ISCN 2009).
SNP array analysis
SNP array experiments and data analysis were performed using the Genome-Wide Human SNP 6.0 array (Affymetrix, Santa Clara, CA, USA) as previously described (13).
Multicolor fluorescence in situ hybridization (M-FISH)
M-FISH analysis of ANGM-CSS cells was performed using the commercially available 24-colour SpectraVysion probe (Abbott), according to the manufacturer’s instructions. Metaphase images were captured using a Leica DM-RXA2 epifluorescence microscope equipped with an 8-position automated filter wheel and a cooled CCD camera (Princeton Instruments). Six fluorescent images per metaphase were captured using filter combinations specific for SpectrumGold, SpectrumAqua, SpectrumGreen, FRed, Red, and DAPI. Images were processed using the Leica CW4000 M-FISH software.
FISH
BAC clones for FISH analysis were selected according to the March 2006 release of the UCSC Human Genome Browser (http://genome.ucsc.edu) (data not shown). FISH experiments were carried out as previously described (14).
Quantitative reverse transcription polymerase chain reaction (RTq-PCR)
Expression analysis of EGFR and MET genes was performed comparing the mRNA levels in the ANGM-CSS cell line and normal human astrocytes (NHA) (Lonza Walkersville, MD, USA) by QRT-PCR on 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA) using MGB TaqMan chemistry and the 2−ΔCt relative method for relative quantification (15). For the analysis were used the following TaqMan® Gene Expression Assays (Applied Biosystems): MET (Hs01565580_m1) and EGFR (Hs01076092_m1). The human large ribosomal protein transcript (Human RPLP09, Applied Biosystems) was used as endogenous control.
Quantitative methylation-specific PCR (QMSP) for the MGMT gene
DNA extracted from ANGM-CSS underwent bisulfite treatment and subsequent DNA purification using the Epitect Bisulfate kit (Qiagen Sci, MD, USA) according to the manufacturer’s instructions. Bisulphite converted DNA was used as template for fluorescence-based real-time QMSP. Real-time PCR experiments for MGMT were performed as previously described (16).
TP53 and KRAS mutation analysis
PCR amplifications of KRAS gene exon 2 and TP53 gene exons 4–8 were performed as previously described (17). Amplification reactions were performed in a GeneAmp PCR System 9700 (Perkin-Elmer, Foster City, CA, USA) in a final reaction volume of 25 μl containing 100 ng of genomic DNA template, 0.25 nM dNTPs, 20 pmol of each primers, 1 U HotMaster Taq polymerase (Eppendorf), in 1X PCR reaction buffer. All PCR products were purified using GFX™ PCR DNA and Gel Band Purification kit (GE Healthcare, Buckinghamshire, UK) and sequenced. Sequencing reactions were performed in 10 μl of final volume using 3 pmol of primer, 4–6 ng of DNA template and 1 μl of Big Dye Terminator Ready Reaction mix v.1.1 (Applied Biosystems). Sequencing reactions were loaded on an ABI 3100 capillary sequencer (Applied Biosystems) and by the Sequencing Analysis software v.3.7 (PE Applied Biosystems).
FIG-ROS1 and FGFR3-TACC3 fusion gene detection
Total RNA was isolated from ANGM-CSS cell line using the TRIzol reagent (InvitrogenTM Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. The Agilent 2100 Bioanalyzer was used to measure the quantity, integrity and purity of total RNA. RNA (1 μg) was reverse transcribed by High Capacity cDNA Reverse Transcription kit (Life Technologies) according to the manufacturer’s instructions. To detect the possible presence of FIG-ROS1 fusion transcript, reverse transcriptase (RT)-PCR experiments were performed using primers previously reported (18). The detection of the FGFR3-TACC3 fusion gene was performed on the basis of the results previously described (19) and using the primers TACC3_Ex5_f (CTTGAACTCTGCCAGCACCT) and FGFR3_Ex16_r GTGGGCAAACACGGAGTC. Briefly, for both chimeric genes, 2 μl cDNA was used as template in a final volume of 50 μl containing 10X PCR buffer, 0.25 mM of each dNTP, 0.5 μM of each forward and reverse primer, 0.5 U HotMaster Taq DNA polymerase (5Prime). The PCRs were run on a GeneAmp PCR System 9700 (Applied Biosystem) with the cycling profile of initial denaturation for 2 min at 94°C followed by 35 cycles of 1 min at 94°C, 1 min at 56°C and 2 min at 72°C, with a final extension for 10 min at 72°C. For the experiments for FIG-ROS1 detection, the cDNA of U118MG cell line was used as positive control (18–20). The PCR product (20 μl) was analyzed by electrophoresis through a 1% agarose gel containing ethidium bromide for staining.
Murine xenograft model
Six female, 6-week old athymic nude mice (Crl:CD1-NU-Foxn1nu from Charles River Laboratories, Italy) were used for transplantation studies in accordance with national and institutional guidelines and were kept under specific pathogen-free (SPF) conditions. The mice were inoculated subcutaneously with 200 μl of cell suspension at four different concentrations (from a minimum concentration of 5×105 cells in 200 μl of mixture PBS/Matrigel 1:1, to a maximum concentration of 10×106 cells in 200 μl of mixture PBS/Matrigel 1:1). Mice were bilaterally inoculated on the flank (three injections for each concentration), while a control mouse was inoculated with Matrigel. The tumor diameter was measured weekly with a digital caliper and the tumor volume (mm3) was calculated as previously described (21). All mice used in the experiment were monitored daily for signs of suffering and to identify cases of spontaneous death.
Results
The primary culture grew initially slowly, reaching cell confluence three weeks after surgical removal. Analysis by phase contrast microscopy showed a mixed population with dendritic-like and spindle cells (Fig. 1D). From the 26th passage, the cells showed a spindle shape with large nuclei. Cells were propagated until the 105th passage, growing continuously for >2 years, without morphological changes. The doubling time was calculated at the 32nd passage. One day after subculturing, the cells entered an exponential growth phase, where the doubling time was ∼60 h. Immunofluorescence analysis showed a decrease in GFAP immunoreactivity, starting from the 17th passage to completely disappear during further serial passages in vitro. The cells were persistently positive for vimentin and nestin, while only a small fraction of the ANGM-CSS cell population showed a CD133 staining (data not shown). Cytogenetic and molecular analyses were performed at the 32nd, at the 70th and at the last passages. Metaphase spreads from long-term cultured cells were treated by conventional cytogenetic methods for karyotype analysis and thirty-two metaphases were analyzed. The cytogenetic analysis showed a strong karyotypic complexity and heterogeneity; the chromosome number was near-tetraploid and in addition to whole chromosome losses (chromosomes 10, 14 and 21) and gains (chromosomes 7, 20 and 19), two clonal chromosomal translocations were observed: a t(6;14) (p12;q11.2), and a t(8;10) (q24.2;q21.1). Moreover, the recurrent deletion of the long arm of chromosome 6 was detected and one marker chromosome apparently composed of chromosome 12 material [mar (12)] was found to be recurrent in 100% of the cell population (Fig. 2). According to the 2009 recommendations of the International System for Human Cytogenetic Nomenclature (22), the karyotype was described as follows: 88∼91,XXYY,−6,+7,del(9)(p21.1)×2,−10,−12,+der(14)t(6;14)(p12;q11.2)×2,−17,+19,+20,−21,+marx2[p32].
To better define genomic gains and losses, SNP array analysis was performed on DNA extracted at the same passages. The SNP analysis confirmed the high genomic complexity, showing, in addition to the losses and gains of whole chromosomes detected by chromosome banding, the deletion of the 6q, copy number alterations at 5q (gain of a 14.6 Mb region from 5q34 to 5qter) and 9p (loss of a 28.7-Mb segment from 9p24.3 to 9p21.1); in addition, chromosome 12 showed copy number changes from 10 to 1 along its long arm (Fig. 3A), similarly to regions of chromosomes 7, 16 and 17. The overall SNP array results are listed in Table II.
M-FISH analysis confirmed the presence of the unbalanced translocation der(14)t(6;14)(p12;q11.2) and detected two additional unbalanced translocations: der(8)t(8;10)(q24.2;q21.1) and der(9)t(5;9)(q34;p21), in agreement with the SNP array data and clarified that the additional material on der(12), already detected by G-banding and SNP-array CGH, originated from amplified material from chromosomes 7, 12 and 17 (Fig. 3B–E). Chromosome aberrations detected by both SNP array and M-FISH analyses, were further validated by FISH experiments with locus-specific BAC probes. Interestingly, the long arm of the der(12) was shown to be almost entirely composed by amplified chromosome 12 sequences, together with chromosomes 7, 16 and 17 material (Fig. 4). Moreover, we finely mapped the breakpoints of all unbalanced translocations (data not shown). Then, combining classical cytogenetic, molecular cytogenetic and SNP array data for ANGM-CCS cell line, it was possible to define the karyotype as: 88∼91,XXYY,−6,+7,+add(9)(p21.1)ishdup(5)(q34)×2,+der(8)t(8;10)(q24.2;q21.1),−10,+der(12)ishins(7;17;16)(12 qter→12q24::7?::17?::16?::12q24.3)×2,+der(14)t(6;14)(p12;q11.2)×2,−17,+19,+20[cp32]. ANGM-CSS showed an increased expression of EGFR and MET as compared to a normal human astrocytes (NHA) cell line (data not shown). The relative mRNA expression value for the MET and EGFR in the tumor cell line was, respectively 4.65 and 1.45. ANGM-CSS did not show methylation of the MGMT promoter or pathogenic mutations in the hotspot regions (exons 5–8) of the TP53 gene, neither were mutations detected in codons 12 and 13 of the KRAS gene. No FIG-ROS1 or FGFR3-TACC3 chimeric gene was detected. Six weeks after the subcutaneous injection of ANGM-CSS cells in athymic nude mice, all animals showed growth of a macroscopically visible tumor. Mice were sacrified eight weeks after injections and the tumors were immediately excised. One fragment was used for serial transplantation in other mice whereas the other section was used to start a new culture. The newly injected mice developed tumors two weeks after inoculation. The morphology of the cells grown after heterotransplantation did not differ from the initial culture (Fig. 1E). The human origin of the tumor cells was confirmed by chromosome analysis that revealed the same karyotype (data not shown).
Discussion
We successfully established a novel cell line, named ANGM-CSS, from a patient with GBM. Cell line immunoreactivity for GFAP showed a decrease after serial passages in culture, as previously described (23–27); whereas, the immunohistochemical positivity for vimentin and nestin was persistent. The immunohistochemical results recapitulate the phenotype of the GMB cell lines, according to data from literature (26–28). We provided a detailed characterization of ANGM-CSS by use of cytogenetic and molecular approaches. As expected, the cytogenetic analysis of ANGM-CSS showed a very complex karyotype characterized by several chromo-some aberrations, in line with the data described in previous studies concerning human glioma cell lines (29–31). Gliomas have been extensively analyzed by genetic techniques. They typically show highly complex karyotypes (31). The most common numerical chromosomal changes include losses of 9p, chr10, chr17 and chr22 and gain of chromosomes chr7 and chr20 (31–35). Other structural abnormalities were also reported in chromosomal arms 1p, 6q, 9p, 9q and 13q (31). Similary to the latter data, G-banding, molecular cytogenetic and SNP array analysis performed on ANGM-CSS disclosed a near-tetraploid karyotype harbouring numerous copy number changes, including gain of whole chromosomes 7, 20 and 19 and loss of whole chromosomes 10, 14 and 21, in addition to gains of sub-regions in 5q, 7 and 17 and loss of 6q and 9p. Moreover, three structural chromosome rearrangements were identified in ANGM-CSS: a t(8;10)(q24.2;q21.1), a t(6;14)(p12;q11.2) and an add(9)(p21.1) ish dup(5)(q34). In summary, the genetic analyses indicate that the ANGM-CSS cell line recapitulates the key properties of GBM. The Cancer Genome Atlas Research Network reported in GBM frequent genetic alterations in three critical pathways: the RTK/RAS/PI3K, the p53 and the RB signalling pathways (36). ANGM-CSS presents a profound deregulation of proliferation and survival due to disruption of the RTK/RAS/PI3K pathway due to the amplification of the EGFR and MET genes and the homozygous deletion of NF1 and PTEN genes, as detected by SNP array analysis (Table I). Quantitative RT-PCR analysis confirmed an increased expression at the mRNA level of the EGFR and MET genes. The cell line under study does not show the presence of FIG-ROS1 and FGFR3-TACC3 chimeric transcripts, already described for U118MG glioblastoma cell line and for primary tumors, respectively (19,20).
While no mutation or deletions were detected in the TP53 gene, ANGM-CSS was characterized by amplification of the MDM2 gene and homozygous deletion of the CDKN2A gene (Table I). The MDM2 gene encodes for a protein involved in the degradation of the p53 protein and its expression is negatively regulated by the ARF protein, encoded by CDKN2A, leading to an abnormal regulation of apoptosis and senescence mediated by p53 (37). The Rb pathway was affected by the amplification of CDK4 and CDK6 and the homozygous deletion of the CDKN2A/CDKN2B genes. All these alterations affect the G1/S phase progression. Another feature of the ANGM-CSS is the absence of methylation in the promoter region of the MGMT gene. Alkylating agents induce cell death by forming cross-links between adjacent DNA strands through the alkylation of the O6 position of guanine. MGMT promoter hypermethylation with consequent loss of MGMT protein expression reduces the DNA repair activity of glioma cells overcoming resistance to alkylating agents. The absence of MGMT promoter hypermethylation in ANGM-CSS leads to a transcriptionally active MGMT which rapidly removes the alkyl adducts preventing the formation of cross-links thereby causing resistance to alkylating drugs (38,39). ANGM-CSS cell also gave rise to tumors in vivo. All six SCID mice that were injected with tumor cells developed solid tumors, demonstrating that this cell line is capable of being propagated in animal models, which may aid in the development of test systems for new therapies.