CTD, dimethyl sulfoxide (DMSO), 4’,6-diamidino-2-phenylindole (DAPI), propidium iodide (PI) and Trypsin-EDTA were obtained from Sigma Chemical Co. (St. Louis, MO, USA). Minimum essential medium (MEM), fetal bovine serum (FBS), L-glutamine and penicillin-streptomycin were purchased from Gibco^®/Invitrogen Life Technologies (Carlsbad, CA, USA). Primary antibody against caspase-3, cleaved caspase-4, cleaved caspase-8, AIF, Bax, Bcl-xL, cytochrome c, GRP78, IRE1α, IRE1β, ATF6α, calpain 1, calpain 2, XBP-1 and peroxidase conjugated secondary antibodies were purchased from Cell Signaling Technology, Inc. (Beverly, MA, USA). The enhanced chemiluminescence (ECL) detection system was obtained from Amersham Life Sciences, Inc. (Arlington Heights, IL, USA).

The human lung cancer cell line (H460 cells) was purchased from the Food Industry Research and Development Institute (Hsinchu, Taiwan). Cells were cultured in RPMI-1640 supplemented with 10% heat inactivated FBS, 100 U/ml penicillin, 100 μg/ml streptomycin, and 2 mM L-glutamine in a 75-cm² tissue culture flasks at 37°C under 5% CO₂ in humidified air.

H460 cells (2×10⁵ cells/well) were cultured in 12-well plates for 24 h then treated with CTD at various concentrations (0, 5, 7.5, 10, 15, 30 μM) or 0.5% DMSO as a vehicle control for 24 and 48 h. For cell morphological examinations, cells in the wells were examined and photographed under contrast phase microscopy. For total viable cell measurements, cells in each well were harvested, counted and stained with PI (5 μg/ml) and then were analyzed by using flow cytometry (FACSCalibur, BD Biosciences, San Jose, CA, USA) assay as previously described (15). For cell cycle distribution and sub-G1 phase determinations, all harvested cells from each well were washed with phosphate buffer solution (PBS), incubated with RNase A (50 μg/ml) for 30 min, and were stained with PI (50 μg/ml) for 5 min, and analyzed for cell cycle distribution including sub-G1 phase by using flow cytometry system (Becton-Dickinson, San Jose, CA, USA). The percentages of cells in different phases of the cell cycle were analyzed by using the ModFit LT 3.0 program (Verity Software House, ME, USA), as previously described (16).

Annexin VFITC/PI staining method was used to confirm cell apoptosis which were observed in sub-G1 of cell cycle assay. Briefly, H460 cells (2×10⁵ cells/well) were treated with CTD for 0, 1, 3 and 6 h. Cells were harvested and washed with PBS, re-suspended in binding buffer (10 mM HEPES/NaOH pH 7.4, 140 mM NaCl, 25 mM CaCl₂), and stained with FITC-conjugated Annexin V (Pharmingen, Becton-Dickinson Co., San Diego, CA, USA) for 15 min in the dark, at room temperature and washed with binding buffer. All samples were measured for the Annexin V-FITC/PI fluorescence intensity by flow cytometry as described (17).

H460 cells (3×10⁵ cells/well) were placed in 6-well plates for 24 h and were treated with CTD of various concentrations (0, 5, 10, 15 μM) for 24 h. DNA samples were isolated by using DNA isolation kit. The isolated DNA (2 μg) was investigated by using DNA gel electrophoresis which was carried out in 0.5% agarose gel in Tris/acetate buffer at 15 V for 2 h as described previously (17). After electrophoresis, ethidium bromide was used to stain the DNA in the gel, and the gel was further examined and photographed by fluorescence microscopy as previously described (18).

ROS, Ca²⁺ and ΔΨ_m measurements were performed by flow cytometry. Briefly, H460 cells (2×10⁵ cells/well) were treated with 10 μM of CTD for 0, 1, 3, 6, 12 or 24 h. All cells from each treatment and time point were isolated by centrifugation and then were re-suspended in 500 μl of DCFH-DA (10 μM) for 30 min for further ROS (H₂O₂) measurement, re-suspended in 500 μl of Fluo-3/AM (2.5 μg/ml) for 30 min for further intracellular Ca²⁺ concentrations measurement and re-suspended in 500 μl of DiOC₆ (4 μmol/l) for 30 min to further the levels of ΔΨ_m measurement. All samples were analyzed by flow cytometry as described (17).

The mRNA expression of caspase-3 and -8 were performed by real-time PCR. Briefly, H460 cells (2×10⁵ cells/well) were treated with 10 μM of CTD for 0, 12 and 24 h. Then cells were harvested and total RNA was extracted from each treatment using the Qiagen RNeasy mini kit (Qiagen, Inc., Valencia, CA) as described previously (19). High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) was used to reverse-transcribe all RNA samples at 42°C for 30 min according to the standard protocol of the supplier. The following conditions were used for quantitative PCR: 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 sec at 95°C, 1 min at 60°C using 1 μl of the cDNA reverse-transcribed as described above, 2X SYBR-Green PCR Master mix (Applied Biosystems) and 200 nM forward and reverse primers: caspase-3 forward, CAGTGGAGGCCGACTTCTTG and reverse, TGGCACAAA GCGACTGGAT; caspase-8 forward, GGATGGCCACTGTG AATAACTG and reverse, TCGAGGACATCGCTCTCTCA; GAPDH forward, ACACCCACTCCTCCACCTTT and reverse, TAGCCAAATTCGTTGTCATACC. All assays were performed by Applied Biosystems 7300 real-time PCR system in triplicates and expression fold-changes were derived using the comparative CT method (20,21).

H460 cells (1×10⁶ cells/dish) were placed in 10-cm dish for 24 h then were incubated with 10 μM CTD for 0, 6, 12, 24 and 48 h. After treatment under each experimental condition, total cell lysates were denatured with ice-cold lysis buffer [10 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EGTA, 0.3 mM PMSF, 0.2 mM sodium orthovanadate, 0.1% SDS, 1 mM EDTA, 1% NP-40, 10 mg/ml leupeptin, and 10 mg/ml aprotinin] and then were centrifuged at 13,000 × g for 10 min at 4°C (16,17). A Bio-Rad protein assay kit (Hercules, CA, USA) was used for measuring the total protein of each sample. The clarified protein lysates (30 μg) were electrophoretically resolved on denaturing SDS-polyacrylamide gel (12%) followed by transfer onto nitrocellulose membranes, and then blotted with the relevant primary antibodies (anti-caspase-3, caspase-4, caspase-8, AIF, Bax, Bcl-xL, cytochrome c, GRP78, IRE1α, IRE1β, ATF6α, calpain 1, calpain 2, XBP-1) overnight at 4°C followed by peroxidase-conjugated secondary antibody for 1 h at room temperature (25°C). Finally, proteins were visualized by ECL detection (Amersham Biosciences ECL™) and exposed to X-ray film and bands obtained were quantified using NIH Image analyzer (NIH, Bethesda, MD) (17,18).

H460 cells (3×10⁵ cells/well) were placed on 6-well chamber slides and incubated with 10 μM CTD for 24 h. The cells were fixed in 4% formaldehyde in PBS for 15 min followed by using 0.3% Triton X-100 in PBS for 1 h and by using 2% BSA for blocking non-specific binding sites. Then cells were stained by primary antibodies such as anti-cytochrome c, anti-AIF and anti-Endo G (all in green fluorescence) overnight. Then cells were washed twice with PBS and were stained with secondary antibody (FITC-conjugated goat anti-mouse IgG) followed PI (red fluorescence) staining for nuclein examination as described previously. Slides with cells were mounted, examined and photo-micrographed under a Leica TCS SP2 Confocal Spectral Microscope as described previously (17,18). Localization of protein in nuclei is demonstrated by the development of orange color due to red and green overlapped pixels.

All data were performed and expressed as mean ± SD from triplicate experiments. Statistically significant differences between the CTD-treated and -untreated (control) groups were analyzed by Student’s t-test, with values of ^*p<0.05 considered statistically significant.

H460 cells were treated with 0, 5, 7.5, 10, 15 and 30 μM of CTD for 24 and 48 h before the cells were examined and photographed for examining the cell morphological changes and were harvested for the percentage of viable cells and the results are shown in Fig. 1. Fig. 1A and B indicate that CTD induced cell morphological changes and led to cell death and debris. CTD led to enhancement of dead cells following 5–30 μM as indicated by white arrows. Furthermore, Fig. 1C shows a significant dose-dependent reduction of living cells with CTD treatment in H460 cells and these effects are dose-dependent.

H460 cells were treated with 0, 5, 7.5, 10, 15 and 30 μM of CTD for 24 and 48 h before the cells were examined for sub-G1 phase in cell cycle assay and the results are shown in Fig. 2. Data from Fig. 2A–C indicated that CTD induced sub-G1 phase development, thus CTD induced apoptosis and these effects are dose-dependent. To determine whether apoptosis mediated the growth inhibition observed in H460 cells treated with CTD, we performed an Annexin V-FITC/PI double-staining experiment and results are shown in Fig. 2D and E, a considerable increase in apoptotic cells was observed for H460 cells treated with CTD and these effects are time-dependent.

In order to delineate the mechanism of cell apoptosis mediated by CTD, we performed a DNA fragmentation assay, since DNA fragmentation is the characteristic for apoptosis. H460 cells were treated with 0, 5, 10 and 15 μM of CTD for 24 h and DNA was then isolated and analyzed by DNA agarose gel electrophoresis and the results are shown in Fig. 3. Fig. 3 indicates a typical ladder pattern of internucleosomal fragmentation was observed in cells after 24 h of CTD treatment. Low-molecular-weight DNA from these cells was resolved in 2.0% agarose gels (Fig. 3). These results suggest that CTD is a potent inducer of apoptosis in H460 cells.

To further examine the effects of CTD and whether it induced cell death in H460 cells through the production of Ca²⁺ or dysfunction of mitochondrial, the results from flow cytometric assay are shown in Fig. 4. Fig. 4A demonstrates that CTD decreased ROS from 1–12 h treatment. However, Fig. 4B indicates that CTD promoted the production of Ca²⁺ and these effects are time-dependent. Fig. 4C indicated that CTD decreased the levels of ΔΨ_m and these effects are time-dependent. Fig. 4B shows that CTD promoted the Ca²⁺ release from 1 h up to 24 h treatment, however, the highest levels of Ca²⁺ release is in 6 h treatment. Both results indicated that CTD induced apoptosis of H460 cells is associated with dysfunction of mitochondria.

To further examine CTD promoting caspase-3 and -8 activities in H460 cells, and whether or not it was through the expression of mRNA of caspase-3 and -8, the cells were treated with CTD for 12 and 24 h and then isolated for total RNA followed by real-time PCR assay and the results are shown in Fig. 5. Data indicated that CTD promoted the gene expression of mRNA in caspase-3 and -8.

For further examination on whether CTD induced apoptosis in H460 cells through the effects of apoptosis-associated protein, H460 cells were treated with 10 μM of CTD for 0, 6, 12, 24 and 48 h and then total proteins were quantitated and apoptosis-associated proteins were examined by western blot analysis and the results are shown in Fig. 6, indicated that CTD significantly promoted the expression of cleaved caspase-3 and -8, cytochrome c, Bax and AIF but inhibited the levels of Bcl-xL (Fig. 6A). Furthermore, CTD promoted ER stress-associated protein expression such as GRP78, IRE1α, IRE1β, ATF6α and caspase-4 (Fig. 6B). CTD promoted the expression of calpain 2 and XBP-1, but inhibited calpain 1 (Fig. 6C) that are associated with apoptosis pathways. These results indicated that CTD induced apoptosis in H460 cells through both caspase-dependent and -independent, ER stress and mitochondria-dependent pathways.

In order to confirm that CTD affects the translocation of cytochrome c, AIF and Endo G involved in apoptosis in H460 cells, cells were exposed to 10 μM of CTD for 24 h were then stained by anti-cytochrome c, AIF and Endo G and then were stained with secondary antibody and examined and photographed by confocal laser microscopy. The results are shown in Fig. 7, which indicated that CTD promoted the cytochrome c (Fig. 7A), AIF (Fig. 7B) and Endo G (Fig. 7C) release from mitochondria in H460 cells when compared to CTD untreated (control) groups.