The human cervical carcinoma cell lines, HeLa cells were purchased from Cell Bank of Type Culture Collection of Chinese Academy of Sciences, Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). HeLa cells were cultured in RPMI-1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with heat-inactivated 10% fetal bovine serum (FBS) (Biochrom AG) and 1% penicillin/streptomycin at 37°C in a humidified atmosphere containing 5% CO₂.

siRNAs were designed to target different regions of the coding sequences of the hTERT mRNA (GenBank accession no. AF015950) according to Reynolds et al (25). Selected sequences were submitted to blast search in the GenBank database to confirm that only the hTERT gene was targeted. Short hairpin RNA (shRNA) targeting the TLR4 transcript was synthesized and annealed. The synthesized oligonucleotides contain specific target sequence, a loop, the reverse complement of the target sequence, a stop codon for U6 promoter and two sticky ends. The target sequences in the oligonucleotide for suppressing hTERT: siRNAsequence: GTCTGCCGTTGCCCAAGAG (sense); Sequences for the scrambled siRNA: AATTCTCCGAACGTGTCACGT (sense), which does not target any gene product and have no significant sequence similarity to human gene sequences, and was used as control to determine the effects of siRNA delivery. The siRNA and scramble sequence were cloned into expressing plasmid pGCsilencer (Genechem, Shanghai, China), respectivly, and transiently transfected into HeLa cells using Lipofectamine™ 2000 reagent (Invitrogen) according to the manufacturer’s instructions. Transfection efficiency was evaluated by a fluorescence microscope. Transfection was screen by G418 (Invitrogen) and obtained from two siRNA clones and one scramble clone, named as T1, T2 and N, respectively. HeLa cells without transfection was used as parental control.

T1, T2, N and HeLa cells were harvested for RNA extraction following culture for 72 h. RNA was insolated using TRIzol reagent (Invitrogen). RNA was reverse-transcribed into cDNA by a Primescript™ RT reagent kit based on the manufacturer’s protocols (Takara, Dalian, China). Quantitative real-time polymerase chain reaction (RT-PCR) assays were carried out using SYBR-Green Real-Time PCR Master Mix (Toyobo, Osaka, Japan) and RT-PCR amplification equipment using specific primers: forward primers, 5′-GGAGCAAGTTGCAAAGCATTG-3′ and reverse, 5′-TCCCACGACGTAGTACATGTT-3′; GAPDH forward primers, 5′-TGTGGGCATCAATGGATTTGG-3′ and reverse, 5′-ACACCATGTATTCCGGGTCAAT-3′. The PCR conditions were: a pre-denaturing at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 sec, annealing/extension at 54°C for 20 sec, final extention 72°C for 5 min. The amplification specificity was checked by melting curve analysis. Quantitative data were analyzed by using the Light Cycler software version 3.5 (Roche, Mannheim, Germany) and relative quantification of hTERT mRNA was derived by the 2^−ΔΔCT method, as previous described (26).

Cells were dissociated with trypsin (Gibco) and collected into 1.5 ml EP tubes. The cells were washed twice with prechilled PBS (pH 7.2) after centrifugation and were then lysed on ice for 30 min in 60 μl cell lysis buffer (1 ml RIPA + 10 μl PMSF, Beyotime). The cell lysates were centrifuged at 4°C, at 12,000 rpm for 5 min, and the supernatants were collected, and protein concentrations were determined using the Bradford reagent (Sigma). Lysates were separated on 8 or 15% SDS-PAGE; proteins were transferred to Immobilon membrane (Millipore, Bedford, MA) immunoblotted with specific primary antibodies and incubated with corresponding horseradish peroxidase-conjugated secondary antibody. Protein bands were visualized with enhanced chemiluminescence reagent (ECL, Amersham, GE Healthcare, Velizy-Villacoublay, France). The primary antibodies used in the western blots were: antibodies against TLR4, β-actin, BCL-2 and survivin (Santa Cruz Biotechnology, Santa Cruz, USA); Akt, phosphorylated(p-) Akt, PI3K, p-PI3K, mTOR and p-mTOR (Sigma-Aldrich, St. Louis, MO, USA); Secondary Abs used for immunodetection were: HRP-conjugated goat anti-mouse IgG (Santa Cruz Biotechnology). A gel image analysis system was used to scan the membrane and analyze the intensity of each band.

Telomerase activity was determined with the conventional telomeric repeat amplification protocol (TRAP) using the TRAP Telo TAGGG PCR enzyme-linked immunosorbent assay (ELISA) kit (Roche) according to the manufacturer’s protocol (27).

Genomic DNA of the cultured cells was isolated by the high pure template preparation kit (Roche) and telomere length was estimated by using the Telo TAGGG Telomere Length Assay kit (Roche). In brief, 2 μg of genomic DNA was digested with restriction enzymes HinfI and RasI at 37°C for 2 h and separated on 0.8% (w/v) gel. The DNA fragments were then transferred to a positively charged nylon membrane in 20X saline-sodium citrate buffer overnight at room temperature. The membrane was hybridized with a DIG-labeled telomere-specific probe and detected by an anti-DIG alkaline phosphatase and CDP Star as the chemiluminescence substrate. Telomere length was calculated using the Kodak Digital Sciences 1D™ sofeware (Roche).

To measure the effect of downregulation of hTERT by siRNA on cell proliferation, CCK-8 assay (Cell Counting Kit-8, Dojindo, Japan) was performed. In brief, 5×10³ of cells were seeded into each well of a 96-well plate. The proliferative activity was determined at the end of different experimental periods (24, 48, 72, 96 and 120 h) using CCK-8 assay according to the manufacturer’s instructions. In brief, 10 μl of CCK-8 was added to each well followed by incubation for an additional 2 h. When the media changed from red to yellow, the absorbance value at a wavelength of 450 nm was detected by an enzyme-linked immunosorbent assay reader (Thermo Labsystems, Finland). The experiment was performed at least three times with similar results.

The proliferation rate of cells was determined by measuring the incorporation of bromodeoxyuridine (BrdU) into the genomic DNA. In brief, 5×10³ of cells were seeded into each well of a 96-well plate and cultured for 3 h, and cells were treated with 20 μM 5-bromo-2-deoxyuridine (BrdU, Sigma, Dallas, TX). After a 2-h incubation with BrdU, cells was fixed for 15 min in phosphate-buffered saline containing 4% paraformaldehyde. Cells were incubated with anti-BrdU IgGs (1:1000 dilution; Sigma) overnight at 4°C, then washed with PBS containing 0.1% Triton X-100, and incubated for 1 h at 25°C in blocking buffer containing Cy3-conjugated anti-mouse IgGs (1:2000 dilution; Jackson Immunoresearch, West Grove, PA). Cells were washed three times, and counterstained with 4,6-diamidino-2-phenylindole (DAPI, 1 μg/ml; Sigma). Coverslips were mounted in antifade (90% glycerol, 10% 1 M Tris pH 8.0, 0.2% propyl gallate) on glass slides and labeled cells were viewed by indirect immunofluorescence and ultraviolet microscopy. BrdU-labeled cells were counted from digital images taken from random fields for a total of 300 cells per coverslip.

Cells were harvested and washed with cold PBS, and then fixed with 75% ethanol at −20°C overnight. The fixed cells were washed with cold PBS twice, then adding 500 μl of DNA staining solution (containing 200 μg/ml RNase A and 20 μg/ml propidium iodide staining solution (Whitehouse Station, NJ, USA) and incubated for 30 min. Finally, the distribution of cells in the cell-cycle phases were analyzed from the DNA histogram with a FACS Caliber flow cytometer (Becton-Dickinson, San Jose, CA, USA) and CellQuest software (CA, USA).

The percentage of apoptotic cells was assessed by the TUNEL technique following the manufacturer’s instructions (In situ cell death detection kit, POD, Roche Diagnostic, Branchburg, NJ, USA). The number of apoptotic bodies were counted and averaged from three visual fields. In addition, we also detected caspase-3 and caspase-8 activity by ELISA as an additional indicator of apoptosis.

The activity of caspase-3 and caspase-8 was measured using caspase colorimetric protease assay kits (Millipore Corp., Billerica, MA, USA) according to the manufacturer’s instructions. Briefly, cells were cultured for 24 h, then washed twice with ice-cold PBS and harvested by centrifugation at 700 g for 10 min. The cell pellets were then lysed in 150 μl buffer provided in the kit. Protein concentrations of lysates were determined using the Lowry method (28). Then, an aliquot of lysates (80 μl) was incubated with 10 μl substrate of each caspase at 37°C for 2 h. Samples were analyzed at 405 nm using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA).

To assess the effect of downregulation of hTERT on cell migration, wound-healing assay was performed. In brief, the transfected cell lines were seeded on a 24-well plate and allowed to reach confluence. After scratching the bottom of the well with a pipette tip, the monolayer of cells was washed three times with PBS, and incubated in RPMI-1640 medium containing 1% FBS for 24 h; this medium was then replaced with RPMI-1640 medium containing 10% FBS. After 48 h, cell migration was evaluated using an inverted phase-contrast microscope (Leica DMR, Germany).

The invasiveness of silencing the downregulated hTERT by siRNA in vitro was measured using BD BioCoat™ Matrigel invasion chambers (Becton-Dickinson Labware, Bedford, MA, USA) according to the manufacturer’s instructions. Filters were precoated on the upper side with Matrigel (1 mg/ml; BD Biosciences, San Jose, CA). The lower chamber was filled with culture media containing 10% FBS. Cells (5×10⁴) were seeded in serum-free media in the upper chambers at 37°C for 24 h. After incubation, cells invading the bottom surface of the filter were fixed and stained with 0.1% crystal violet in 20% methanol. Invasiveness was determined by counting the penetrating cells under a Nikon phase-contrast microscope and counted in >10 fields of view at ×200 magnification.

To investigate the effects of silencing the targeting hTERT on the tumorigenicity of xenografts and the influence on survival of tumor-burdened animals, 40 female BALB/nude mice (aged 4–6 weeks) were obtained from Tonghua Laboratory Animal Center (Beijing, China) and housed within a dedicated SPF facility at Laboratory Animal Center of Jilin University. T1, T2, N and HeLa (1×10⁸) cells were subcutaneously injected into the right flank of mice, respectively. Tumor volume was measured by calipers every 5 days until mice were sacrificed under anesthesia. Each tumor was excised and weighed when mice were sacrificed on Day 21. Parts of each tumor tissue were wax embedded for H&E stained to study cell apoptosis in vivo by TUNEL. All animal experiments were performed in accordance with institutional guidelines, following a protocol approved by the Ethics Committees of the Disease Model Research Center, Jilin University (Changchun, China).

All experiments were performed in triplicate and the data were recorded as mean ± SD. Statistical comparison of more than two groups was performed using one-way ANOVA followed by the Tukey post-hoc test. Statistical analyses were undertaken using the SPSS^® statistical package, version 19.0 (SPSS, Inc., Chicago, IL, USA) and the GraphPad Prism version 5.01 (GraphPad Software, San Diego, CA, USA) for Windows^®. P-values <0.05 were considered to be statistically significant.

We designed sticky siRNAs cloned into the pGC silencer and and confirmed by sequencing that the recombinant plasmid construct met the requirements. The recombinant plasmids transfected into HeLa cells, were screed by G418 obtained from T1 and T2, two stable siRNA-hTERT clone cells, and then we tested their silencing efficiency both at the mRNA and protein levels in HeLa cells. Real-time RT-PCR results showed that hTERT mRNA expression in T1 and T2 group were significantly decreased compared to N group (scramble group) and control group (without transfection group) (Fig. 1A, P<0.01). There was no significant difference in N group and the control group; on protein level, there was no significant inhibition in hTERT protein expression in N group or the control group (P>0.05), while the band density decreased dramatically in the T1 and T2 groups as compared with the N and the control group (P<0.01)(Fig. 1B). These results demonstrated that silencing hTERT was able to significantly decrease hTERT expression in cervical cancer cells (P<0.01).

Telomerase activity was detected by TRAP-PCR kit. The value of T1 (1.078±0.284) and T2 (1.030±0.218) were significantly decreased compared N (2.806±0.477) and the parental cells (2.810±0.348). The ratio of inhibition of telomerase activity in HeLa cells exposed to the T1 and T2 were both over 64.4% (P<0.05), showing that downregulation could inhibit telomerase activity.

We then examined the effects of suppression of hTERT on telomere length. Analysis of terminal restriction fragments (TRFs) by Southern blotting demonstrated that the telomere lengths observed in N clones were 5–6 kb, similar to that of parental cells. In contrast, telomere lengths in clones T1 and T2 showed significant shortening, with lengths averaging 2–3 kb (Fig. 2). Taken together, these observations indicate that stable suppression of hTERT by RNAi functionally inhibits telomerase activity and length in human cervical cancer cells.

We examined the effects of silencing hTERT on tumor cervical cell growth in vitro. The anti-proliferative effect of silencing hTERT on HeLa tumor cells was examined using CCK-8 assays. The results clearly show that T1 and T2 clone cells significantly inhibited cell proliferation compared to N clone cell and parental cells at different time periods (P<0.01, Fig. 3A). The proliferation rate of HeLa cells was determined using BrdU assay. As shown Fig. 3B, the proliferation rate of T1 and T2 were significantly reduced the N and parental cells (P<0.01), in agreement with the CCK-8 assays. These results showed that silencing hTERT inhibits cell proliferation.

The effects of silencing hTERT on the cell cycles of HeLa cells were then analyzed by flow cytometry. The result showed that T1 and T2 had an increased percentage of arrest at the G0/G1 phase and a decreased percentage of arrest at the S phase compared with the N and parental cells (P<0.05, Table I). In addition, SPF and PI were also reduced in T1 and T2 clone cells compared with the N and parental cells.

To investigate whether silencing hTERT could induce apoptosis, we analyzed apoptosis after treatment with hTERT siRNA. As shown Fig. 4A, T1 and T2 clone cells have substantial brown staining in the cell nucleus, whereas, the N clone and parental cells have a small amount of brown staining in the cell nucleus. Statistical analysis showed that the cell apoptosis ratio of T1 and T2 were significantly higher than those of the N clone and parental cells (P<0.01, Fig. 4B).

To explore the possible mechanism of induction of cell apoptosis of silenced hTERT, caspase-3, caspase-8 and caspase-10 activity was determined by ELISA. The results showed that caspase-3 and caspase-8 activity significantly increase in T1and T2 clone cells compared to the N clone and parental cell (P<0.01) (Fig. 4C and D). Thus, silencing hTERT induced cell apoptosis of human cervical cancer cells.

To ascertain the inhibitory effect of silencing hTERT on cervical cancer migration, a wound-healing assay was performed. After 24-h of treatment, cells in the parental and the N clone cells efficiently spread into the wound area to such an extent that the wound boundary was not apparent, while only some cells of T1 and T2 clones spread forward in HeLa cells (Fig. 5A). Statistical analysis showed that the cell migration ratio of T1 and T2 was significantly reduced compared to the N clone and parental cells (P<0.01, Fig. 5B).

The ability of the silenced hTERT to reduce the invasiveness of HeLa cells was then investigated by the transwell system. It was found that invasion was decreased significantly in T1 and T2 clone cells compared to the N clone and parental cells (P<0.01, Fig. 5C and D).

We investigated the effect of the silenced hTERT on tumor growth in nude mice with cervical cancer xenografts. At three days after the end of treatment, mice were sacrificed, and tumor weights were measured. As shown Fig. 6A, tumor weight was significantly less in the T1 and T2 clone cells than those of the N clone and parental cells. Tumor volume of all groups was measured, and the tumor volume was significantly lower in T1 and T2 clone cells on Days 10, 15 and 20 (Fig. 6B, P<0.01 for all).

In addition, we determined tumor tissue cell apoptosis in vivo by TUNEL. The cell apoptosis ratio of T1 and T2 in vivo was significantly higher than those of the N clone and parental cells (P<0.01, Fig. 6C and D). These data demonstrated that the silencing of hTERT suppressed tumor growth of cervical cancer in vivo.

To clarify the molecular mechanisms involved in the silencing of hTERT inhibition of HeLa cell proliferation, we mainly focused on the effects of silencing hTERT on the activation of the PI3K/Akt pathway, which participate in the main intracellular signaling required for cell proliferation and survival. Our results demonstrated that silencing of hTERT inhibited the tyrosine phosphorylation of AKT and PI3K (Fig. 7). These results might indicate that knockdown of hTERT inhibits tumor cell growth, to some extent, by suppressing the PI3K/AKT pathway.