Recombinant human TGF-β1 was purchased from Peprotech, London, UK. PD98059 was obtained from Cell Signaling Technology, Inc., Danvers, MA, USA. SB203580 was acquired from Calbiochem, Madison, WI, USA. SP600125 was obtained from SABiosciences, Frederick, MD, USA.

MT-2Org cells were kindly provided as a gift by the Cell Biology Institute, Research Center, Hayashibara Biochemical Laboratories, Inc. Okayama, Japan. MT-2Org cells were seeded in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), streptomycin and penicillin. MT-2Rst cells were established from the MT-2Org cells by continuous exposure to CB (5 μg/cm²) for more than eight months as previously described (12,14). 293FT cells were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% FBS. The UICC (the International Union Against Cancer) standard of CB was kindly provided by the Department of Occupational Health, National Institute for Occupational Health, South Africa (23). Chrysotile asbestos is composed of Mg₃Si₂O₅ (OH)₄. Chrysotile-A from Zimbabwe contains 2% fibrous anthophyllite, although CB from Canada does not contain any fibrous impurities.

Total RNA was extracted from cells using the RNeasy mini kit (Qiagen, Hilden, Germany), and cDNAs were synthesized using the PrimeScript II^® 1st strand cDNA Synthesis kit (Takara, Shiga, Japan), according to the manufacturer’s instructions. Real-time RT-PCR was performed using Brilliant II Fast SYBR^® Green QPCR Master Mix (Stratagene, La Jolla, CA, USA) with the Mx3000P QPCR System (Agilent Technologies Inc.), according to the manufacturer’s instructions. Real-time RT-PCR of the TGF-β1 primers were 5′-TTCAACACATCAGAGCTCCG-3′ (forward) and 5′-ATAACCACTCTGGCGAGTCG-3′ (reverse), for TGF-βRI: 5′-TAATTCCTCGAGATAGGCCG-3′ (forward) and 5′-TCGATGGTGAATGACAGTGC-3′ (reverse), for TGF-βRII: 5′-CAGCAGAAGCTGAGTTCAACC-3′ (forward) and 5′-GTGTTCTGCTTCAGCTTGGC-3′ (reverse), for SMAD2: 5′-GGAATTTGCTGCTCTTCTGG-3′ (forward) and 5′-TCTGCCTTCGGTATTCTGCT-3′ (reverse), for SMAD3: 5′-CCCCAGAGCAATATTCCAGA-3′ (forward) and 5′-GGCTCGCAGTAGGTAACTGG-3′ (reverse), for GAPDH: 5′-GAGTCAACGGATTTGGTCGT-3′ (forward) and 5′-TTGATTTTGGAGGGATCTCG-3′ (reverse). The relative gene expression was calculated by the ΔΔCt method using an endogenous control (GAPDH) as 1.0. The formula is expressed as follows: 2^−ΔΔCt = 2^{− (ΔCt for target gene − ΔCt for GAPDH)}.

Cultured cells were purified using the Ficoll-Paque method to remove CB. Cells (2×10⁵/ml) were cultured in 24-well plates in RPMI-1640 medium supplemented with 10% 1X Serum Replacement 1 (Sigma-Aldrich) for 3 days. Levels of TGF-β were quantified by immunoassay using Quantikine ELISA kits (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions.

Cell surface proteins were stained with anti-human latency associated peptide (LAP) (TGF-β1)-PE antibody (27232) or anti-human TGF-βRII-PE antibody (FAB241P) (R&D Systems). Analysis was performed by a flow cytometer (FACSCalibur™; BD Biosciences, Franklin Lakes, NJ, USA). For intracellular staining of TGF-β1, cell surface TGF-β1 was blocked with 2.5 μg/ml of anti-human TGF-β1 antibody (9016) (R&D Systems) for 30 min at room temperature. Cells were fixed and permeabilized using a fixation/permeabilization solution (BD Biosciences) for 20 min at 4°C. After washing twice in BD Perm/Wash buffer (BD Biosciences), cells were stained with anti-human TGF-β1-PE (9016) (R&D Systems) for 30 min at 4°C. After washing with BD Perm/Wash buffer, cells were resuspended in PBS and analyzed on a flow cytometer.

Cultured MT-2Org cells, MT-2Rst cells, MT-2Org control cells, MT-2Rst control cells, and TGF-β1-knockdown in MT-2Rst cells were purified using the Ficoll density gradient method to remove CB completely, and cells were then cultured for 2–4 days in the absence of CB. Cells (2×10⁴/100 μl) were cultured in 96-well U-bottom plates in RPMI-1640 medium supplemented with 10% 1X Serum Replacement 1 (Sigma-Aldrich) in the presence or absence of TGF-β1. The proliferation was evaluated on day 3 based on [³H]-thymidine incorporation. After 2 days of culture, 3.7 kBq (0.1 μCi) [³H]-thymidine (10 μl) (GE Healthcare UK Ltd., Buckinghamshire, UK) was added to each well. After 16 h of culture, [³H]-thymidine incorporation was measured using a liquid scintillation counter (LSC-5100, Aloka, Japan).

Cells were lysed in 50 mM Tris-HCl (pH 7.2) buffer containing 150 mM NaCl, 1% Nonidet P-40, 1% deoxycholic acid, 0.05% sodium dodecyl sulfate (SDS), 1X protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA), and 1X Halt Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific Inc., Rockford, IL, USA). Proteins were quantified using the BCA assay kit (Thermo Fisher Scientific Inc.), and 10 μg of protein was resolved on 10% SDS-PAGE under reducing conditions with 5% 2-mercaptoethanol and transferred to a PVDF membrane. Proteins were probed with the following antibodies: p-SMAD2, p-SMAD3, SMAD2/3 (Cell Signaling Technology, Inc.), p-ERK, p-JNK, ERK1, JNK1/3, p38α, (Santa Cruz Biotechnology, Santa Cruz, CA, USA), p-p38 (BD Biosciences, San Jose, CA, USA), and GAPDH (Millipore Corp. Headquarters, Billerica, MA, USA), and incubated with HRP-conjugated anti-mouse IgG or anti-rabbit IgG (Santa Cruz Biotechnology). Proteins were detected with ECL Plus Western Blotting Detection Reagents (GE Healthcare UK Ltd.). The intensity of western blotting was quantified with Dolphon-View2 Band Tool (Kurabo Industries Ltd, Osaka, Japan).

Three kinds of double-stranded oligonucleotides 5′-GATCCCCGGAGGTCACCCGCGTGCTATTC A AGAGATAGCACGCGGGTGACCTCCTTTTTGGAAA-3′ (no. 1), 5′-GATCCCCGTTCAAGCAGAGTACACACTTCAAG AGAGTGTGTACTCTGCTTGAACTTTTTGGAAA-3′ (no. 2) and 5′-GATCCCCGTGGACATCAACGGGTTCATTCAAG AGATGAACCCGTTGATGTCCACTTTTTGGAAA (no. 3) were subcloned into pSUPER digested by BglII-HindIII (24). Resulting constructs were digested with BamHI/SalI, and short hairpin RNA (shRNA) containing human H1 RNA polymerase III promoter subcloned into the BamHI-SalI site of pRDI292 as described previously (25).

The vesicular stomatitis virus G protein (VSV-G)-pseudotyped HIV-1-based vector system was generated as described previously (26). The Replication-defective lentiviral vector particles were produced by transient cotransfection of the second-generation packaging construct pCMV-ΔR8.91 (27), the VSV-G envelope plasmid pMDG2 and the lentiviral vector into 293FT cells with FuGENE6 (Roche Diagnostics, Mannheim, Germany). The supernatant containing the virus was collected 48 and 72 h after transfection. The lentivirus-containing supernatants were subjected to MT-2Org and MT-2Rst cells (0.5×10⁵ in 2 ml of medium) in a 6-well plate. After 3 days, cells were treated with 1 μg/ml of puromycin to select stable clones expressing the shRNA.

Cells (1×10⁵/ml) were cultured in the absence or presence of 5, 12.5 or 25 μg/cm² CB in 24-well plates for 24 h. Apoptotic cells were detected by staining with Annexin V-FITC and propidium iodide (PI) (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer’s protocol, and stained cells were analyzed using a flow cytometer.

A t-test and a Fisher’s parametric least significant difference (PLSD) were performed to determine statistical differences between the experimental groups.

Long-term exposure to CB results in CB-dependent resistance to apoptosis and upregulates IL-10 production in MT-2Org cells, as previously described (14). Given that MT-2Org cells are known to have a Treg cell-like suppressive function (20), in this study we investigated the production of an anti-inflammatory cytokine, TGF-β1, in MT-2Rst cells by long-term exposure to CB. The production of TGF-β1 in culture supernatants was augmented large in MT-2Rst compared to MT-2Org cells (Fig. 1B). Besides FACS analysis showed that intracellular TGF-β1 was strongly expressed in both MT-2Org and MT-2Rst cells as shown in the middle and bottom panels of Fig. 1A, but there were no significant differences such as those revealed by real-time RT-PCR (top panel of Fig. 1A). Additionally, the cell surface TGF-β1 expression was increased in MT-2Rst cells, although there were no significant differences between MT-2Org and MT-2Rst cells (Fig. 1C). MT-2 cells are HTLV-1-immortalized human polyclonal T cell line and express Tax protein which represses TGF-β1 signaling in human T cells (28). Although we compared the gene expression level of Tax1 between MT-2Org and MT-2Rst cells, there were no differences in the gene expression level (data not shown). These results suggested that the upregulation of TGF-β1 production in MT-2Rst cells induced by long-term exposure to CB leads to an enhancement of Treg-like phenotypes in a Tax-independent manner.

Although TGF-β1 inhibits the proliferation of T cells and NK cells, TGF-β1 does not inhibit the growth of TGF-β1-producing Treg cells (29). Therefore, we examined whether TGF-β1 inhibits the proliferation of MT-2Rst cells. As shown in Fig. 2A, the proliferation of MT-2Org cells was significantly inhibited by TGF-β1, whereas MT-2Rst cells were not inhibited. In order to confirm whether the resistance to TGF-β1-mediated growth inhibition depends on TGF-β1 production, TGF-β1 knockdown in MT-2Rst cells was generated using lentiviral vector-mediated RNA interference. The knockdown efficiency of three TGF-β1 shRNA constructs was examined by real-time RT-PCR and ELISA (Fig. 3A), and the results confirmed that the expression of TGF-β1 mRNA and production of TGF-β1 significantly decreased in construct nos. 1 and 2. Therefore, these cell clones (construct nos. 1 and 2) were employed in subsequent experiments. Interestingly, TGF-β1-knockdown cells significantly inhibited their proliferation by TGF-β1 treatment in a manner similar to the MT-2Org control transduced with a control lentiviral vector, although these growth suppressions due to TGF-β1 were not observed in MT-2Rst control cells transduced with a control lentiviral vector (Fig. 3B). These results suggested that MT-2Rst cells acquired the resistance to TGF-β1-mediated growth inhibition through upregulation of TGF-β1 production.

Next, we investigated the expression of TGF-β receptor (R) I and TGF-βRII in MT-2Org and MT-2Rst cells to elucidate a mechanism in which TGF-β1 did not inhibit the growth of TGF-β1-producing MT-2Rst cells. Real-time RT-PCR revealed that both cells expressed TGF-βR1 and TGF-βR2 mRNA, and that the latter expression was significantly decreased in MT-2Rst cells (Fig. 2B). However, FACS analysis showed that the expression of cell surface TGF-βRII was low in both cells and there were no significant differences (Fig. 2B). Additionally, expression of TGF-βR1 and TGF-βR2 mRNA decreased in MT-2Rst control cells was enhanced in TGF-β1-knockdown cells, and was particularly remarkable in construct no. 1 when compared with the MT-2Rst control cells (Fig. 3C). These results suggested that the acquisition of the resistance to TGF-β1-mediated growth inhibition might be partly associated with the expression level of TGF-βRI/II.

To elucidate the molecular mechanism involved in overexpression and over-production of TGF-β1 in MT-2Rst cells, we investigated the importance of these aspects and the activation of MAPKs, such as ERK1/2, p38 and JNK1. Given that we previously reported that exposure to chrysotile-A induces apoptosis via phosphorylation of p38 and JNK (13), we examined the activation of MAPKs in MT-2Org cells subjected to short-term exposure to CB. As shown in Fig. 4, ERK1/2, p38 and JNK1 were phosphorylated when MT-2Org cells were exposed to 5 or 12.5 μg/cm² of CB, although there were no significant differences between the treated and control groups. Furthermore, as shown in Fig. 5A and B, phosphorylated p38 in MT-2Rst control was decreased by knockdown of TGF-β1. To confirm the association between TGF-β1 production and p38 MAP kinase activation, MT-2Rst cells were treated with ERK inhibitor PD98059, p38 MAP kinase inhibitor SB203580, or JNK inhibitor SP600125. As shown in Fig. 5C, TGF-β1 production was largely reduced by inhibition of p38 phosphorylation, while decreased TGF-β1 production was also induced by inhibition of ERK and JNK phosphorylation involved in proliferation of cells (30). These results suggested that long-term exposure to CB upregulates TGF-β1 production via constitutive activation of the phosphorylation of p38.

To determine whether MT-2Rst cells acquire resistance to asbestos-induced apoptosis depending on the modification of TGF-β1 production, we examined the occurrence of apoptosis caused by co-culturing with CB in TGF-β1-knockdown cells using the Annexin V method. As shown in Fig. 6A, the short-term and high-dose exposure to CB did not induce apoptosis in TGF-β1-knockdown cells as in the MT-2Rst control cells, not knocked down, when compared with the appearance of apoptosis in MT-2Org cells. The short-term and high-dose exposure to CB in MT-2Org cells slightly increased in TGF-β1 production via apoptosis, although there were no significant differences between the treated and control groups (Fig. 6B). These results indicated that acquisition of resistance to CB-induced apoptosis in MT-2Rst cells occurs independently of enhanced TGF-β1 production by long-term exposure to CB.

TGF-β1-Smad pathway is involved in the inhibition of T cell proliferation (31–34). We examined that the expression and phophorylation of SMAD2/3 in TGF-β1 producing MT-2Rst cells. SMAD2 was highly expressed at mRNA and protein levels in MT-2Org and MT-2Rst cells, and the level of SMAD2 mRNA was significantly higher in MT-2Rst than MT-2Org cells (Fig. 7A). Similarly, in Fig. 8, there were no significant differences in the protein level of SMAD2 arising from the level of SMAD2 mRNA between MT-2Org control and MT-2Rst control cells, suggesting that SMAD2 is degraded by proteasome to maintain a certain amount of SMAD2 protein (35). On the other hand, mRNA and protein expression levels of SMAD3 were lower in MT-2Rst than MT-2Org cells, and the protein level of SMAD3 was significantly decreased in MT-2Rst compared with MT-2Org cells (Fig. 7). Similarly, the mRNA and protein level of SMAD3 were significantly decreased in MT-2Rst cells (Fig. 8). SMAD2/3 was highly phosphorylated in MT-2Rst cells compared with MT-2Org cells (Fig. 7B), although the level of phosphorylated SMAD3 was not enhanced in MT-2Rst cells (Fig. 8). The level of phosphorylated SMAD2 (p-SMAD2) and SMAD3 (p-SMAD3) were normalized to the protein expression level of SMAD2 and SMAD3, respectively. The levels of p-SMAD2/SMAD2 and p-SMAD3/SMAD3 were increased in MT-2Rst cells compared with MT-2Org cells (Figs. 7B and 8), suggesting that Smad-dependent TGF-β1 signaling through the activation of TGF-βRI/II stimulated by autocrine TGF-β1 from MT-2Rst cells was performed normally in MT-2Rst cells.

However, the results from TGF-β1-knockdown in MT-2Rst cells showed that there were no significant differences in mRNA expression of SMAD2 and SMAD3 among MT-2Rst control, TGF-β1-knockdown nos. 1 and 2 (Fig. 8). Whereas the level of p-SMAD2/SMAD2 was decreased in TGF-β1-knockdown cells, and was particularly remarkable in construct no. 2 when compared with the MT-2Rst control cells (Fig. 8B). The SMAD3 protein expression decreased in the MT-2Rst control was recovered slightly by TGF-β1-knockdown, although there were no differences in p-SMAD3/SMAD3 among MT-2Rst control, TGF-β1-knockdown nos. 1 and 2. Thus, phosphorylation of SMAD2 and SMAD3 may be coordinated with the expression of SMAD2 and SMAD3. These results were insufficient to understand that long-term exposure of MT-2Org cells to CB induces TGF-β1 production, and results in acquisition of the resistance to TGF-β1-mediated growth inhibition.