Flavopiridol (2-(2-chlorophenyl)-5,7-dihydroxy-8-[(3S,4R)-3-hydroxy-1-methyl-4-piperidinyl]-4-chromenone), was obtained from Sigma-Aldrich (Munich, Germany). Acetonitrile and water were of HPLC grade (Merck, Darmstadt, Germany). All other chemicals and solvents were commercially available, of analytical grade and used without further purification.

Chinese hamster ovary (CHO) cells that were stably transfected with OATP1B1, OATP1B3 or OATP2B1 and wild-type CHO cells were provided by the University of Zurich, Switzerland and have been extensively previously characterized (34,35). The CHO cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FCS, 50 μg/ml L-proline, 100 U/ml penicillin and 100 μg/ml streptomycin. The selective medium for stably transfected CHO cells additionally contained 500 μg/ml gene-ticin sulfate (G418) (36). All the media and supplements were obtained from Invitrogen (Karlsruhe, Germany). The mammalian ZR-75-1 breast cancer cell line was purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA) and was maintained in RPMI medium supplemented with 10% FCS, 100 U/ml penicillin, 100 μg/ml streptomycin and 1% GlutaMAX. The cells were grown in T-flasks with a 25 cm² growth area (BD Biosciences, Franklin Lakes, NJ, USA), maintained at 37°C under 5% CO₂ and 95% relative humidity. The cells were passaged once a week and were used up to passage 55 (37).

For lentiviral transduction, ZR-75-1 cells were plated in 24-well tissue culture plates at a density of 40,000 cells/well in 0.5 ml of growth medium. After 24 h, 250 μl of medium supplemented with 8 μg/ml polybrene (H9268; Sigma) was added. Transductions were performed by the addition of 10 μl of shRNA (Mission^® transductionparticlesNM_006446, Sigma, TRCN0000043203, coding sequence CCGGGCCTTCATCTAAGGCTAACA TCTCGAGATGTTAG-CCTTAG-ATGAAGGCTTTTTG). Twenty-four hours after the transduction, the cell culture medium was changed, and 1 ml of growth medium supplemented with 1 or 5 μg/ml of puromycin (P9620; Sigma) was added to select infected cells after an additional 24 h. The obtained silencing efficiency was evaluated after 3 weeks via real-time PCR and immunofluorescence (38).

Total RNA was extracted from cell lines using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The concentration, purity and integrity of the RNA samples were determined through UV absorbance and electrophoresis. Total RNA (2 μg) were reverse transcribed to cDNA using random hexamer primers and the RevertAid™ H Minus M-MuLV Reverse Transcriptase system (Fermentas, St. Leon-Rot, Germany), as recommended by the manufacturer. TaqMan^® Gene Expression assays (Applied Biosystems, Warrington, UK) were purchased for human OATP1B1. The 18S gene was used as a reference gene, as previously described (23). Multiplex quantitative real-time RT-PCR was performed in an amplification mixture with a volume of 20 μl. The target gene amplification mixture contained 10 μl of 2× TaqMan^® Universal PCR Master Mix, 1 μl of the appropriate Gene Expression Assay, 1 μl of the TaqMan^® endogenous control (human β-actin or 18S), 10 ng of template cDNA diluted in 5 μl of nuclease-free water and 3 μl of nuclease free water. The thermal cycling conditions were as follows: 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. Fluorescence generation due to TaqMan^® probe cleavage via the 5′-3′ exonuclease activity of DNA polymerase was measured with the ABI PRISM 7700 Sequence Detection System (Applied Biosystems). All samples were amplified in triplicate. To cover the range of expected Ct values for the target mRNA, a standard curve of six serial dilutions from 50 ng to 500 pg of pooled cDNA was analyzed using the Sequence Detection Software (SDS 1.9.1.; Applied Biosystems). The results were imported into Microsoft Excel for further analysis. Comparable cDNA contents in the experimental samples were calculated according to the standard curve method. Relative gene expression data are given as the n-fold change in transcription of target genes normalized to the endogenous control. Real-time RT-PCR was performed with the following prefabricated TaqMan^® Gene Expression Assays (Applied Biosystems) containing intron-spanning primer Hs00272374_m1 for OATP1B1.

ZR-75-1 OATP1B1-knockdown cells and cells transduced with the empty vector were allowed to attach on culture slides overnight (8-Chamber Polystyrene Vessel Tissue Culture-Treated Glass Slides; BD Falcon). Formalin fixation was followed by a washing step and a blocking step (by 5% BSA). The primary antibody against OATP1B1 (OATP1B1/1B3 mMDQ mouse monoclonal antibody; Acris Antibodies, Herford, Germany) was diluted 1:100, and incubation was performed for 2 h. Optimal antibody concentrations were determined by titrating serial antibody dilutions. The applied dilutions corresponded to the minimum concentration necessary to produce a positive signal. Wild-type and OATP1B1-transfected CHO cells were used as controls. Following incubation with the secondary antibody (1:1,000 dilution; Alexa Fluor^® 488 goat anti-mouse IgG; Invitrogen, Carlsbad, CA, USA) for 30 min, cell nuclei were stained with 0.5 μg/ml Hoechst 33342 (Sigma-Aldrich). Thereafter, the slides were rinsed with distilled water before being mounted in Mowiol 4–88 (Carl Roth, Karlsruhe, Germany). Fluorescent staining was visualized with an Axioplan 2 microscope (Carl Zeiss, Jena, Germany). Images were captured using a AxioCam HRc2 Color CCD digital camera and AxioVision 4.8 software (Carl Zeiss Vision GmbH, Aalen, Germany). To minimize background signals and to make the signal intensity and extension in different samples comparable, the exposure times for the individual antibodies were evaluated and kept constant between the samples (38).

Transport assays were performed on 12-well plates as described in detail elsewhere (34). Briefly, CHO cells were seeded at a density of 350,000 cells/well on 12-well plates (BD Biosciences, Franklin Lakes, NJ, USA). Uptake assays were generally performed on day 3 after seeding, when the cells had grown to confluence. Twenty-four hours before starting the transport experiments, the cells were additionally treated with 5 mM sodium butyrate (Sigma-Aldrich) to induce non-specific gene expression (39). Flavopiridol was dissolved in DMSO and was diluted with uptake buffer (pH 7.4; final DMSO concentration of 0.5%) to 25–800 μM. Control experiments contained DMSO in the medium in place of flavopiridol. Prior to the transport experiment, the cells were rinsed twice with 2 ml of prewarmed (37°C) uptake buffer (116.4 mM NaCl, 5.3 mM KCl, 1 mM NaH₂PO₄, 0.8 mM MgSO₄, 5.5 mMD-glucose and 20 mM Hepes; pH adjusted to 7.4). Uptake was initiated by adding 0.25 ml of uptake buffer containing the substrate. After the indicated time period at 37°C, uptake was stopped by removing the uptake solution and washing the cells five times with 2 ml of buffer (pH 7.4). The cells were then trypsinized by the addition of 100 μl of trypsin and transferred into test tubes. Next, the cell membranes were disrupted via repeated (5 times) shock freezing in liquid nitrogen and thawing. Following centrifugation at 13,500 × g for 5 min, 100 μl of the supernatant was diluted with methanol/water (2:1; v/v), and aliquots (80 μl) were analyzed via HPLC (37).

For the inhibition experiments with rifampicin and bromosulfophthalein (BSP; Sigma-Aldrich), stock solutions of these compounds were prepared in DMSO containing the indicated concentrations. CHO cells grown on 12-well plates were first washed twice with pre-warmed uptake buffer (pH 7.4) and incubated for 10 min at 37°C under 5% CO₂ with 1 μM flavopiridol in the presence of the inhibitors ranging from 0.0001 to 100 μM. Control experiments were performed without BSP and rifampicin under identical conditions as mentioned above.

CellTiter-Blue (Promega, Southampton, UK) is a type of a colorimetric assay used to measure cell viability via non-specific redox enzyme activity (reduction from resazurin to resorufin by viable cells). ZR-75-1 cells (50,000 cells/ml) were seeded into 96-well flat-bottomed plates and incubated for 24 h at 37°C under 5% CO₂. For cytotoxicity assays, the cells were incubated with various concentrations of flavopiridol (5–400 μM) for 72 h. The CellTiter-Blue (20 μl) reagent was added to the wells, and the plate was incubated for 2 h, protected from light. The absorbance was recorded for resazurin (605 nm) and resorufin (573 nm). The assay results were measured on a Tecan M200 multimode plate reader (Tecan Austria GmbH, Groedig, Austria). The absorbance was also measured in CellTiter-Blue assays in blank wells (without resveratrol) and subtracted from the values from experimental wells. The viability of the treated cells was expressed as a percentage of the viability of the corresponding control cells. All experiments were repeated at least three times.

ZR-75-1 wild-type and OATP1B1 knockdown cells were plated on 6-well plates at a concentration of 1×10⁶ cells/ml and allowed to attach overnight. After 24 and 48 h of incubation at 37°C cells were trypsinized by the addition of 100 μl of trypsin, transferred into 15 ml tubes and centrifuged (4°C, 800 rpm, 5 min) (40). The supernatant was discarded and the cell pellet washed with cold PBS (phosphate-buffered saline, pH 7.4), centrifuged (4°C, 800 rpm, 5 min), resuspended in 1 ml cold ethanol (70%) and fixed for 30 min at 4°C. After two washing steps with cold PBS, the cell pellet was resuspended in 500 μl cold PBS and transferred into a 5 ml polystyrene round bottom tube. RNAse A and propidium iodide were added to a final concentration of 50 μg/ml and incubated for 1 h at 4°C. The final cell number was adjusted between 0.5 and 1×10⁶ cells in 500 μl. Cells were analyzed by the FACSCalibur flow cytometer (BD Biosciences). Cell cycle distribution was calculated with ModFid LT software (Verity Software House, Topsham, ME, USA).

Total protein was determined using the colorimetric bicinchoninic acid protein (BCA) assay kit (Pierce Science, Rockford, IL, USA) with bovine serum albumin as a standard and quantification at a wavelength of 562 nm on a spectrophotometer (UV-1800; Shimadzu). Raw data were analyzed using UVProbe software (version 2.31; Shimadzu). The protein concentrations were consistent among the plates (0.150±0.005 mg/well).

The determination of flavopiridol was performed using a Merck ‘La Chrom’ System (Merck, Darmstadt, Germany) equipped with an L-7250 injector, an L-7100 pump, an L-7300 column oven (set at 37°C), a D-7000 interface, and a L-7400 UV detector (set at a wavelength at 264 nm). Chromatographic separation of flavopiridol was performed on a Hypersil BDS C18 Column (5 μM, 250 × 4.6 mm I.D.; Thermo Electron Corp.), preceded by a Hypersil BDS C18 precolumn (5 μM, 10 × 4.6 mm I.D.) at a flow rate of 1 ml/min. The mobile phase consisted of a continuous linear gradient, mixed from 10 mM ammonium acetate/acetic acid buffer, pH 7.4 (mobile phase A), and acetonitrile (mobile phase B), to elute flavopiridol. The mobile phase was filtered through a 0.45 μM filter (HVLP04700; Millipore, Vienna, Austria). The gradient ranged from 10% acetonitrile (0 min) to 40% B at 15 min and linearly increased to 80% B at 17 min where it remained constant for 23 min. Subsequently, the percentage of acetonitrile was decreased within 3 min to 10% in order to equilibrate the column for 9 min before application of the next sample. The sample injection volume was 80 μl. Calibration of the chromatogram was accomplished using the external standard method by spiking drug-free cell culture medium with standard solutions of flavopiridol to give a concentration range of 0.005–1 μg/ml (average correlation coefficient: >0.999). For this method the lower limit of quantification for flavopiridol was 10 ng/ml. Coefficients of accuracy and precision for this compound were <9.8%.

Kinetic analysis of the uptake of flavopiridol was performed over a substrate concentration range of 25–800 μM. Prior to these experiments, the linearity of cellular uptake over time (1, 3 and 10 min) was individually determined for wild-type and OATP-transfected CHO cells by using flavopiridol (50 μM) as a substrate. Cellular uptake rates are presented after normalization for the incubation time and total protein content. Net uptake rates were calculated as the difference in the uptake rate of the transfected and wild-type cells for each individual concentration. The data were fitted to the Michaelis-Menten model. Kinetic parameters were calculated using the GraphPad Prism Version 5.0 software program (GraphPad Software, San Diego, CA, USA) for Michaelis-Menten: V = Vmax * S/(Km + S), where V is the rate of the reaction, Vmax is the maximum velocity, Km is the Michaelis constant and S is the substrate concentration. The intrinsic clearance, which is defined as the ratio Vmax/Km, quantifies the transport capacity. IC₅₀ values were determined by plotting the log inhibitor concentration against the net uptake rate and non-linear regression of the dataset using the equation:

in which y is the net uptake rate (pmol/μg protein/min), I is the inhibitor concentration (μM), s is the slope at the point of inversion, and a and b are the maximum and minimum values for cellular uptake. Net uptake was calculated for each inhibitor concentration as the difference in the uptake rates of the transporter-expressing and wild-type cell lines. Unless otherwise indicated, values are expressed as mean ± SD of three individual experiments. Significant differences from control values were determined using a Student’s paired t-test at a significance level of P<0.05.

To investigate whether OATPs other than OATP1B1 contribute to flavopiridol uptake respective studies were performed in CHO cells transfected with OATP1B1, OATP1B3 and OATP2B1 using wild-type CHO cells transfected with the empty vector as controls. Western blot analysis confirmed that these cells highly expressed the respective transporters in the membranes (data not shown). Uptake of flavopiridol (25–800 μM) for all three OATPs was only linear for up to 1 min (Fig. 1). We therefore finalized all experiments at the initial linear phase. As shown in Table I and Fig. 2, the initial net OATP1B1-, OATP1B3- and OATP2B1-mediated accumulation rates (tranfected wild-type) for flavopiridol followed Michaelis-Menten kinetics, with ~4–5-fold higher Vmax values for OATP1B3 compared to OATP1B1 and OATP2B1 (Vmax, 2263 vs. 583 and 422 pmol/mg protein/min). The affinity of flavopiridol for both OATP1B1 and OATP1B3 showed very similar Km values (66.0 and 66.8 μM) but was significantly higher for OATP2B1 (175 μM).

To investigate whether known OATP inhibitors impact OATP1B1-, OATP1B3- and OATP2B1-mediated flavopiridol accumulation, flavopiridol was quantified after treatment of OATP1B1-, OATP1B3- and OATP2B1-overexpressing CHO cells with 1 μM flavopiridol in the absence and presence of increasing concentrations of the known OATP inhibitors bromsulphophthalein (BSP) and rifampicin (41,42). As shown in Fig. 3 rifampicin was a potent inhibitor for flavopiridol uptake in OATP1B3- followed by OATP2B1- and OATP1B1-transfected CHO cells (IC₅₀ values, 1.00, 1.36 and 2.06 μM, respectively). BSP, however, did not inhibit but rather stimulated OATP-dependent flavopiridol uptake at concentrations up to 100 μM.

The cells exhibiting the lowest expression of OATP1B1 (relative mRNA expression was reduced from 14.8±0.26 to 1.19±0.02) were chosen for further experiments. Because ZR-75-1 cells express OATP1B1 (23) but not OATP1B3 and OATP2B1, the expression of the OATP1B1 protein was furthermore confirmed by immunofluorescence. Fig. 4 clearly shows constitutive expression (bright green fluorescence) of OATP1B1 in ZR-75-1 control cells (transfected with empty vector) (Fig. A) and suppressed protein levels of this transporter in ZR-75-1 OATP1B1-knockdown cells (Fig. B).

Based on much higher OATP1B1 expression levels in wild-type ZR-75-1 breast cancer cell lines compared to OATP1B1 knockdown ZR-75-1 cells, we expected increased intracellular flavopiridol levels in the wild-type cells. For kinetic analysis, an incubation time of 1 min was chosen in order to prevent cellular uptake from interference with cellular efflux mechanisms such as MRP1 and BCRP. Fig. 5 depicts representative Michaelis-Menten kinetics for a significantly higher flavopiridol uptake (2.5-fold) by wild-type compared to OATP1B1 knockdown ZR-75-1 cells (Vmax, 1876 pmol/mg vs. 758 protein/min). Affinity of flavopiridol to OATP1B1, however, was comparable in wild-type and OATP1B1 knockdown ZR-75-1 cells (Km, 80.8 μM±14.1 and 99.0 μM±24.0) indicating that OATP1B1 knockdown did not unmask other transporters for flavopiridol.

The cytotoxicity of flavopiridol against ZR-75-1 and OATP1B1 knockdown ZR-75-1 breast cancer cells was quantified using the CellTiter-Blue test kit. As shown in Fig. 6, flavopiridol was significantly less toxic in OATP1B1 knockdown (IC₅₀, 6.64 μM) than in wild-type ZR-75-1 cells (IC₅₀, 1.45 μM) underscoring that OATP1B1 is important for flavopiridol uptake.

ZR-75-1 cells were incubated with 5 μM flavopiridol for 8, 24 and 48 h and then subjected to FACS analyses. In the absence of flavopiridol both cell lines showed a nearly identical distribution of cells in the different phases of the cell cycle (Fig. 7). Addition of flavopiridol, however, exhibited distinct effects dependent on OATP1B1 expression. While the cell cycle of wild-type cells was inhibited in G1 and G2/M phase, OATP1B1-knockdown cells were inhibited only in G1 phase at the expense of G2/M- and S-phase cells after 24 and 48 h of flavopiridol treatment. Notably, reduced uptake of flavopiridol in OATP1B1 knockdown cells was also associated with a decreased proportion of cells in sub-G1 indicating decreased induction of apoptosis observed after 48 h of flavopiridol incubation (14.5 compared to 18.2% for wild-type cells).