We used human RMS cell lines (a gift of Dr Peter Houghton, World Children’s Research Hospital, Columbus, OH, USA), including the RH30 ARMS cell line and the RD ERMS cell line. RMS cells used for experiments were cultured in Roswell Park Memorial Institute medium (RPMI)-1640 (Sigma, St. Louis, MO, USA), supplemented with 100 IU/ml penicillin, 10 μg/ml streptomycin, and 50 μg/ml neomycin (Life Technologies, Grand Island, NY, USA) in the presence of 10% heat-inactivated fetal bovine serum (FBS) (Life Technologies). The cells were cultured in a humidified atmosphere at 37°C in 5% CO₂ at an initial cell density of 2.5×10⁴ cells/flask (Corning, Cambridge, MA, USA), and the medium was changed every 48 h.

The expression of IGF1R, and INSR in RMS cell lines was evaluated by flow cytometry analysis as previously described (31). The antigens were detected with anti-human/mouse INS R/CD220 conjugated with APC (R&D Systems, Minneapolis, MN, USA); and phycoerythrin (PE)-anti-IGF1R monoclonal antibody, clone no. 33255 (R&D Systems). Briefly, the cells were stained in phosphate-buffered saline (PBS) (Ca²⁺- and Mg²⁺-free) supplemented with 2% bovine calf serum (BCS) (HyClone Laboratories, Inc., Logan, UT, USA). After the final wash, cells were resuspended in PBS and analyzed by FACS using the Navios Flow Cytometer (Beckman Coulter, Inc., Brea, CA, USA).

Total RNA was isolated from cells treated with 5-azacitidine (AzaC), 2′-deoxy-5-azacytidine (DAC), or trichostatin A (TsA) (all from Sigma) and from cell controls with the RNeasy kit (Qiagen, Valencia, CA, USA). The RNA was reverse-transcribed with MultiScribe Reverse Transcriptase and oligo-dT primers (Applied Biosystems, Foster City, CA, USA). Quantitative assessment of mRNA levels was performed by RT-qPCR on an ABI 7500 instrument with Power SYBR-Green PCR Master Mix reagent. Real-time conditions were as follows: 95°C (15 sec), 40 cycles at 95°C (15 sec), and 60°C (1 min). According to melting point analysis, only one PCR product was amplified under these conditions. The relative quantity of a target, normalized to the endogenous control β-2 microglobulin gene and relative to a calibrator, is expressed as 2^−ΔΔCt (fold difference), where Ct is the threshold cycle, ΔCt = (Ct of target genes) - (Ct of endogenous control gene, β-2 microglobulin), and ΔΔCt = (ΔCt of samples for target gene) - (ΔCt of calibrator for the target gene). The following primer pairs were used: IGF2 forward, CCATGTCCTCCTCGCATCTC and reverse, CGTGGCAGAGCTGGTGAAG; H19 forward, GGCTCTGGAAGGTGAAGCTAGA and reverse, GCGGGCGCTGCTGTT.

DNA was isolated with the DNeasy Blood and Tissue kit (Qiagen), and exactly 100 ng of genomic DNA prepared from the indicated cells were used for bisulfite modification with the EpiTect Bisulfite kit (Qiagen) according to the manufacturer’s instructions. Bisulfite-treated DNA was subjected to nested PCR with methylation-specific primers for the human H19-IGF2 DMR (32): 1st outer primer hH19O forward, AGG TGT TTT AGT TTT ATG GAT GAT GG and reverse, TCC TAT AAA TAT CCT ATT CCC AAA TAA CC; 2nd inner primer hH19I forward, TGT ATA GTA TAT GGG TAT TTT TGG AGG TTT and hH19-DMR-I reverse, same as hH19-DMR-O reverse. Next, the PCR products were cut with BstUI restriction enzyme and visualized on an agarose gel. In parallel after agarose gel electrophoresis, the PCR products were eluted using the QIAquick Gel Extraction kit (Qiagen). The eluted amplicons were subsequently ligated into the pCR2.1-TOPO vector and transformed into TOP10 bacteria using the TOPO TA Cloning kit (Invitrogen Life Technologies, Carlsbad, CA, USA). The plasmids were prepared using the QIAprep Spin Miniprep kit (Qiagen), sequenced with M13 forward and reverse primers, and the methylation pattern visualized using CpGviewer software. All experiments were conducted with three independent isolations of all cell populations.

Full-length H19 and Exon1 complementary DNA (GenBank: AF087017.1) was PCR-amplified and cloned into the pcDNA3.1 expression vector, and the vector was introduced into RH30 cells using Lipofectamine 2000 (both from Invitrogen Life Technologies). Cells were positively selected with G418 (200 μg/ml) for 2 weeks. The level of H19 overexpression was assessed by RT-qPCR, and the cells were subjected to proliferation assays. Enhanced expression of miR-675 was performed by transfecting RD and RH30 cells with miR-675-3p, -5p, or both (Sigma). Cells were seeded into 24-well plates (3×10⁴) and transfected with Lipofectamine 2000 (Invitrogen Life Technologies) and 40 μM microRNA for 24 h. In parallel, cells were transfected with MISSION miRNA Negative Control (Sigma). Next, cells were replated for proliferation assays or receptor expression analysis by flow cytometry.

The cells were incubated with or without 0.5, 1, 2, 5, 10, 20, or 50 μM AzaC (Sigma). After 96 h, the cells were collected, washed with PBS, centrifuged at 1,200 rpm for 8 min, and resuspended in 1 ml RPMI-1640 medium supplemented with 10% FBS at a concentration of 10⁶ cells/ml. Then, 2 μl of Vybrant DyeCycle Orange Stain (Invitrogen Life Technologies) was added to the cells, which were gently vortexed. Samples were kept at 37°C for 30 min in the dark and were analyzed using a flow cytometer (Navios, Beckman Coulter, Inc.).

For Annexin V/PI assays, cells were stained with Annexin V-FITC and PI and evaluated for apoptosis by flow cytometry according to the manufacturer’s instructions (BD Biosciences, San Diego, CA, USA). Briefly, 1×10⁶ cells were washed twice with PBS and stained with 5 μl of Annexin V-FITC and 10 μl of PI (5 μg/ml) in 1X binding buffer (10 mM HEPES, pH 7.4, 140 mM NaOH, 2.5 mM CaCl₂) for 15 min at room temperature in the dark. The apoptotic cells were determined using a Navios flow cytometer (Beckman Coulter, Inc.). Annexin V⁺ PI⁻ cells represented the early apoptotic populations, while Annexin V⁺ PI⁺ cells represented either late apoptotic or secondary necrotic populations.

Polycarbonate membranes (8-μm) were covered with 50 μl of 0.5% gelatin. The cells were detached with 0.5 mmol/l ethylenediaminetetraacetic acid (EDTA), washed in RPMI-1640, resuspended in RPMI-1640 with 0.5% bovine serum albumin (BSA), and seeded at a density of 3×10⁴ in 120 μl into the upper chambers of Transwell inserts (Corning). The lower chambers were filled with IGF1 (100 ng/ml), IGF2 (100 ng/ml), INS (10 ng/ml), or 0.5% BSA in RPMI-1640 (control). After 24 h, the inserts were removed from the Transwell supports. Cells remaining in the upper chambers were scraped off with cotton wool, and cells that had transmigrated were stained by HEMA 3 according to the manufacturer’s instructions (Thermo Fisher Scientific, Pittsburgh, PA, USA) and counted either on the lower side of the membrane or on the bottom of the Transwell chamber.

Cells were incubated with or without 1 or 5 μM AzaC for 72 h, collected, counted, mixed in 0.35% top agar (in RPMI-1640 medium supplemented with 10% FBS) and plated at 1,250 cells/well onto 24-well plates containing a solidified bottom layer (0.5% base agar in the same growth medium). Every 3 days, colonies were fed with 250 μl/well culture medium with 10% FBS. After 21 days, unstained colonies were counted.

Cells were plated in culture flasks at an initial density of 10⁴ cells/cm² in the presence or absence of AzaC and miR-675-3p or -5p or both. The cell number was calculated at 24, 48, 72, and 96 h after culture initiation. At the indicated time points, the cells were harvested from the culture flasks by trypsinization, and the number of cells was determined using a Navios cytometer.

Western blotting was performed on extracts prepared from RMS cell lines (2×10⁶ cells) that were kept in RPMI medium containing low levels of BSA (0.5%) to render the cells quiescent, as previously described (33). The cells were divided and stimulated with optimal doses of IGF1 (100 ng/ml), IGF2 (100 ng/ml), INS (10 ng/ml) for 5 min at 37°C and then lysed (for 10 min) on ice in RIPA buffer (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), containing protease and phosphatase inhibitors (Roche Diagnostics Corp., Indianapolis, IN, USA). Subsequently, the extracted proteins were separated by either 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and the fractionated proteins were transferred to a PVDF membrane (Bio-Rad, Hercules, CA, USA). Phosphorylation of the intracellular kinases, p42/44 mitogen-activated protein kinase (MAPK) (Thr202/Tyr204) was detected using commercial mouse phospho-specific mAb (p42/44) polyclonal antibody (Cell Signaling Technology, Inc., Danvers, MA, USA) with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG secondary antibody (Santa Cruz Biotechnology, Inc.). Equal loading in the lanes was evaluated with appropriate mAb: p42/44 anti-MAPK clone no. 9102 (Cell Signaling Technology, Inc.). The membranes were developed with an enhanced chemiluminescence (ECL) reagent (Amersham Pharmacia Biotech, Little Chalfont, UK).

All results are presented as mean ± standard error of the mean (SEM). Statistical analysis of the data was performed using the non-parametric Mann-Whitney test or Student’s t-test, with p<0.05 considered significant.

Hypermethylation of the DMR at the IGF2-H19 locus (known as LOI) is an important epigenetic change occurring in ARMS and ERMS cells and leads to overexpression of IGF2 and downregulation of H19. As mentioned above, while IGF2 is an autocrine factor for RMS cells that stimulates proliferation of these cells after binding to the IGF1R and INSR, H19-derived ncRNA gives rise to several miRNAs that negatively regulate cell proliferation. One of these miRNAs, miR-675, downregulates IGF1R, which in turn binds IGF2 and IGF1 in murine placental cells (28).

To better address the LOI phenomenon at the DMR for the IGF2-H19 locus and the role of IGF2 and H19-derived miR-675 in the proliferation of RMS cells, we employed the DNMT inhibitor AzaC to reverse hypermethylation of the DMR at the IGF2-H19 locus (Fig. 1A and B). We found that exposure of the RH30 ARMS cell line and the RD ERMS cell line to 5 μM AzaC resulted in demethylation of the hypermethylated DMR for this tandem gene from ~76 to 25% and from ~80 to 29%, respectively.

The erasure of methylation at the DMR for the IGF2-H19 locus in response to increasing doses of AzaC resulted, as predicted, in upregulation of H19 and downregulation of IGF2 expression at the mRNA level (Fig. 1C–F). Similar results were obtained by employing another DNMT inhibitor, decitabine (data not shown). At the same time, TsA, which is a potent deacetylating agent, did not change the IGF2/H19 mRNA ratio in RMS cells (data not shown).

Downregulation of IGF2 after AzaC treatment was subsequently confirmed at the protein level in RH30- and RD-derived conditioned media by employing a sensitive ELISA (data not shown).

Next, we performed in vitro assays to see whether AzaC, by down-regulating IGF2 and upregulating H19, affects proliferation of RMS cells. First, to exclude a non-specific toxic effect of AzaC treatment on RMS cells, we evaluated the effect of increasing doses of AzaC on Annexin V binding in RH30 and RD cells (data not shown). By employing PI staining and Annexin V binding, we found that AzaC does not significantly affect cell survival at concentrations <10 μM.

Next, by employing an anchorage-dependent proliferation assay in plastic dishes (Fig. 2A and C) and an anchorage-independent colony-forming assay in soft agar (Fig. 2B and D), we observed an AzaC dose-dependent inhibition of RH30 (Fig. 2A and B) and RD (Fig. 2C and D) cell proliferation. The effect of AzaC on proliferation of RMS cells was subsequently evaluated by employing FACS-based time-lapse monitoring of the cell cycle (Fig. 3). We found that AzaC at a dose of 5 μM inhibits cell proliferation in G2/M phase and reduces the number of cells in G1 phase in both RH30 (Fig. 3A) and RD (Fig. 3B) cells.

We are aware that this effect is most likely the result of a combined increase in H19 expression as well as epigenetic changes in other genes that regulate the cell cycle. At this point, however, we observed that AzaC treatment did not reactivate other epigenetically regulated suppressor genes, such as p16^INK4A and p14, and did not increase the expression of p21^waf1 and p53 (data not shown). Furthermore, despite the fact that IGF2 is downregulated in RMS cells after AzaC treatment, addition of this growth factor to RMS cells did not abrogate AzaC-mediated G2/M inhibition, which again indicates major involvement of H19-derived miR-675 in expression of the IGF2 signaling receptor, IGF1R.

As mentioned above, H19-derived miR-675 downregulates the expression of IGF1R in murine placental cells (24). To address whether miR-675 is involved in regulation of IGF1R expression in human RMS cells, we measured the expression of two isoforms of this miRNA (miR-675-3p and -5p) in RH30 and RD cells, unexposed and exposed to AzaC (Fig. 4A and B). We observed an AzaC dose-dependent increase in both miR-675 isoforms in these cells.

Next, to shed more light on the role of H19 and miR-675 on proliferation of RMS cells we cloned the entire H19 gene and H19 Exon1 (E1.1) into the pcDNA3.1 expression vector and transfected them into RH30 cells. We observed an inhibitory effect of H19 and H19 Exon1 (E1.1) ncRNA on proliferation of RMS cells, both in plastic dishes (Fig. 4C) and in a soft agar colony-forming assay (Fig. 4D). To better address the potential involvement of H19-encoded miR-675, we transfected RH30 and RD cells with miR-675-3p or -5p and observed the expected decrease in proliferation of RH30 and RD cells (Fig. 4E and F).

Our results described above demonstrate an inhibitory effect of AzaC on the proliferation of RMS cells due to upregulation of miR-675 and downregulation of IGF1R expression. However, it is known that, in addition to IGF2, IGF1 and INS also affect the proliferation of RMS cells (19–25). While IGF2 binds to IGF1R, both IGF1 and INS interact also with the INSR. Since we did not see a positive effect of IGF1 or INS as a replacement for IGF2 in AzaC-treated cells, we asked whether miR-675 also downregulates the INSR.

In order to clarify this issue, we applied a bioinformatic tool (rna22v1.0) to search for potential miR-675 targets in the INSR mRNA. As with IGF1R, we observed the presence of miR-675-3p and/or -5p sites in the 3′UTR and coding sequence of the INSR gene (data available upon request).

To confirm whether AzaC affects the expression of the INSR, we first evaluated the expression of the INSR in parallel with the expression of IGF1R in RH30 and RD cells by FACS analysis (Fig. 5A and B). We found that exposure of RMS cells to AzaC decreases the expression of IGF2-, IGF1-, and INS-binding receptors in a dose-dependent manner and, moreover, attenuates activation of MAPK p42/44 in RMS cells stimulated with INS, IGF1 and 2 and exposed to AzaC (Fig. 5C and D).

This effect of AzaC on INSR and IGF1R signaling was correlated with a decrease in the chemotactic responsiveness of RH30 and RD cells to INS, IGF1 and 2 gradients (Fig. 6A and B). Importantly, as was the case for the IGF1R (Fig. 5A and B), downregulation of the INSR in RH30 and RD cells transfected with miR-675-3p and -5p isoforms was observed by FACS analysis (Fig. 6C and D).