Introduction
Gastric cancer (GC) is one of the most common malignant tumors and the third most common cause of death from malignancies worldwide (1). Despite intensive investigations of anticancer treatments for GC, the prognosis of unresectable advanced or recurrent GC remains poor. The median overall survival of GC patients has reached only ~1 year using conventional cytotoxic chemotherapy (2–4). Trastuzumab, a monoclonal antibody against human epidermal growth factor receptor (EGFR) 2 (HER2), used in combination with chemotherapy has shown a survival benefit when used as a first-line treatment in patients with HER2-positive advanced GC (5). However, HER2 overexpression has only been reported in 13–23% of GC cases (6–8). Fibroblast growth factor receptor 2 amplification, MET amplification and RhoA mutations have been anticipated as new molecular targets in GC, but these aberrations are relatively infrequent (9–12). Therefore, new therapeutic modalities are still needed.
The mitogen-activated protein kinase (MAPK) signal pathway cascade and its downstream factors promote cancer cell proliferation, differentiation and survival. The three-tiered kinase cascade consisting of RAF, mitogen-activated protein kinase kinase (MEK), and extracellular signal-regulated kinase (ERK) is frequently dysregulated in malignancies as a result of activating mutations in the upstream RAS (KRAS, NRAS and HRAS) (13,14). The activating BRAF mutation has been detected in a variety of human cancers (15), and the success of RAF inhibitors in BRAF-mutated melanoma has revealed a new modality and has substantiated the contribution of the MAPK signal to carcinogenesis (16,17). Somatic oncogenic MEK1 mutations have also been identified in several human malignancies (18–21). In addition, our previous study demonstrated that MEK1 mutations in poorly differentiated GC cell lines that are hypersensitive to MEK inhibitors have transformational abilities and that the growth of these cancer cells is dependent on these mutations (22). Considering the addiction of cancer cells to active MEK1 mutations for proliferation, GC with such oncogenic MEK1 mutations might be suitable for targeted therapy with MEK inhibitors.
A persistent problem is the development of resistance to molecular-targeted therapies. A series of resistance mechanisms for MEK inhibition that operate ERK-dependently or ERK-independently have been reported, including MEK mutations, elevated RAS or RAF protein levels, and the activation of an alternative PI3K/AKT or STAT3 pathway (23–25). Currently, the phosphorylation of EGFR after the inhibition of the MAPK signal has been suggested as another potential mechanism responsible for the resistance to MEK inhibition in various cancers, and combination therapy with EGFR inhibitors yielded synergistic effects (26,27). In this study, we observed the phosphorylation of EGFR and HER2 after MEK inhibition in a MEK1-mutated GC cell line. Then, the relevancy of this mechanism to MEK inhibitor resistance was validated, and combinations with other tyrosine kinase inhibitors were tested to develop new therapeutic possibilities.
Materials and methods
Reagents and ligand
Trametinib (GSK1120212) and lapatinib (GW572016) were purchased from Selleck Chemicals (Houston, TX, USA) and were dissolved in dimethyl sulfoxide (DMSO) for the in vitro experiments. Recombinant human epidermal growth factor (EGF) was obtained from R&D Systems (Minneapolis, MN, USA) and was constituted in sterile phosphate-buffered saline (PBS).
Antibodies
Rabbit-antibodies specific for ERK1/2, EGFR, HER2, phospho-ERK1/2 (pERK1/2), phospho-EGFR (pEGFR), phospho-HER2 (pHER2), poly (ADP-ribose) polymerase (PARP), caspase-3, cleaved PARP (cPARP), cleaved caspase-3 (cCaspase-3), and β-actin were obtained from Cell Signaling Technology (Beverly, MA, USA).
Cell cultures
A poorly differentiated GC cell line harboring the MEK1 Q56P mutation, OCUM-1, was propagated in RPMI-1640 (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco BRL, Grand Island, NY, USA) and 1% Penicillin-Streptomycin Mixed Solution (Nacalai Tesque, Kyoto, Japan) in a humidified atmosphere of 5% CO2 at 37°C.
Human phospho-receptor tyrosine kinase (RTK) array
The screening of 49 phosphorylated tyrosine kinases in the OCUM-1 cell line was performed using the Human Phospho-RTK Array kit (R&D Systems). Whole lyses of OCUM-1 cells incubated in the absence (DMSO) or presence of 1 nM trametinib for 72 h were compared in accordance with the manufacturer’s recommendation. Protein detection was accomplished using an anti-phospho-tyrosine-HRP detection antibody and an enhanced chemiluminescence system (Image Quant LAS4000; GE Healthcare Life Science, Buckinghamshire, UK).
Growth inhibition assay
The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to evaluate the growth inhibitory effect of the drugs, as previously described (28). When the effect of EGF was evaluated, 1% FBS was used.
Real-time reverse transcription polymerase chain reaction (RT-PCR)
A total of 1 μg of RNA was isolated from the cells using ISOGEN reagent (Nippon Gene, Tokyo, Japan) and then converted to cDNA using GeneAmp RNA-PCR kit (Applied Biosystems, Foster City, CA USA). Real-time PCR was performed using SYBR Premix Ex Taq and Thermal Cycler Dice (Takara, Shiga, Japan), as described previously (29). The glyceraldehyde 3-phosphate dehydrogenase (GAPD, NM_002046) gene was used to normalize the expression levels in subsequent quantitative analyses. To amplify the target genes encoding amphiregulin (AREG), EGF, heparin-binding EGF-like growth factor (HB-EGF), neuregulin 1 (NRG1), transforming growth factor α (TGFA), EGFR, HER2, HER3, and HER4 (AREG, EGF, HB-EGF, NRG1, TGFA, EGFR, ERBB2, ERBB3 and ERBB4 genes, respectively), the following primers were used: AREG-F, GTCGCTCTTGATAC TCGGCTCAG; AREG-R, TCCCAGAGTAGGTGTCATTG AGGTC; EGF-F, CAACCAGTGGCTGGTGAGGA; EGF-R, GAGCCCTTATCACTGGATACTGGAA; HB-EGF-F, CAA GGTGATTTCAGACTGCAGAGG; HB-EGF-R, TTTGGCA CTTGAAGGCTCTGG; NRG1-F, GCCAGGAATCGGCTG CAGGT; NRG1-R, AGCCAGTGATGCT TTGTTAATGCGA; TGFA-F, CTTTGGAAACCAGCAGGTCTGA; TGFA-R, CCCAAATAAGCCAGGCTGTTCTA; EGFR-F, CATCCA GGCCCAACTGTGAG; EGFR-R, CAGTGGAAGCCTT GAAGCAGAA; ERBB2-F, TGGGAGCCTGGCATTTCTG; E R BB2-R, CG G CCATG C TGAGATGTATAG GTA; ERBB3-F, GGGAGCATTTAATGGCAGCTA; ERBB3-R, GAATGGAATTGTCTGGGACTGG; ERBB4-F, GCAGCT AACTTTGAATGCCTGTCTC; ERBB4-R, GCAGCTA ACTTTGAATGCCTGTCTC; GAPD-F, GCACCGTCAAG GCTGAGAAC; and GAPD-R, ATGGTGGTGAAGACG CCAGT.
Western blot analysis
The western blot analysis was performed as described previously (28). Briefly, subconfluent cells were washed with cold PBS and harvested with Lysis A buffer containing 1% Triton X-100, 20 mM Tris-HCl (pH 7.0), 5 mM EDTA, 50 mM sodium chloride, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, and a protease inhibitor mix, Complete™ (Roche Diagnostics). Whole-cell lyses were separated using SDS-PAGE and were blotted onto a polyvinylidene fluoride membrane. After blocking with 3% bovine serum albumin in a TBS buffer (pH 8.0) with 0.1% Tween-20, the membrane was probed with the primary antibody. After rinsing twice with TBS buffer, the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody and washed, followed by visualization using an ECL detection system and LAS-4000. When the cells were stimulated using EGF, the cells were incubated with 1% FBS medium.
Statistical analysis
The results are shown as the mean value ± standard deviation (SD) for three replicate independent experiments. The statistical analyses were performed using the Student’s t-test (two-tailed). A P-value <0.05 was considered statistically significant. The statistical analyses were two-tailed and were performed using Microsoft Excel (Microsoft, Redmond, WA, USA).
Results
MEK inhibition led to the phosphorylation of EGFR and HER2 in the MEK1-mutated OCUM-1 cell line
To address the phosphorylation of RTK after MEK inhibition, we used a phospho-RTK array. The arrangement of the RTK array is summarized in Fig. 1B. The phosphorylation levels of EGFR and HER2 were elevated at 72 h after treatment with a MEK inhibitor (trametinib) (Fig. 1A). Next, to validate the results of the RTK array, we evaluated the phosphorylation level of EGFR and HER2 using a western blot analysis. In addition to the inhibitory effect on the ERK signal, trametinib led to the activation of EGFR and HER2 signals similar to the results of the RTK array. In addition, the phosphorylation of ERK1/2, which had been inhibited by trametinib, was reactivated following the activation of the EGFR and HER2 signals (Fig. 2). These results suggest that the EGFR and HER2 signals are activated under MEK inhibition in MEK1-mutated GC. To investigate the mechanism responsible for the activation of the EGFR and HER2 signals, real-time RT-PCR was performed. However, no significant changes in the mRNA expression levels of the molecules relative to the EGFR and HER2 signals were observed (AREG, EGF, HB-EGF, NRG1, TGFA, EGFR, HER2, HER3 and HER4; data not shown).
Ligand-induced EGFR and HER2 activation led to the acquisition of resistance to a MEK inhibitor
To verify the contribution of EGFR and HER2 signals to MEK inhibitor resistance, the experiments were performed using recombinant human EGF (10 ng/ml) as the ligand. After the EGF-induced activation of the EGFR and HER2 signals, the OCUM-1 cell line became resistant to trametinib (Fig. 3A). Using a western blot analysis, EGF stimulation was shown to increase the phosphorylation levels of EGFR and HER2, and ERK1/2, which had been suppressed by trametinib, was re-phosphorylated (Fig. 4B).
Lapatinib abolished the resistance to trametinib induced by EGF
Next, to investigate the effect of lapatinib (an EGFR and HER2 dual tyrosine kinase inhibitor) on the EGF-induced resistance, a combination therapy was tested. The EGF-induced resistance to trametinib was abolished by lapatinib (Fig. 4A). The suppression of the phosphorylation levels of ERK1/2 through the inhibition of EGFR and HER2 by lapatinib can explain the restored response to trametinib (Fig. 4B). These results suggest that the activation of EGFR and HER2 signals potentially plays an important role in MEK inhibitor resistance and that lapatinib may abolish such resistance.
Combination of trametinib and lapatinib synergistically inhibits cell growth
To investigate the role of the activated EGFR and HER2 signals during treatment with trametinib, we examined the synergistic anticancer effect of trametinib and lapatinib in the OCUM-1 cell line using an MTT assay. The combination of trametinib and lapatinib showed a synergistic effect on the inhibition of cell proliferation (Fig. 3B). Furthermore, lapatinib decreased the phosphorylation levels of EGFR and HER2, which had been activated after the treatment with trametinib, and the phosphorylation level of ERK1/2 was inhibited to a greater degree by the combination treatment than by trametinib monotherapy (Fig. 5A). Cleaved PARP and cleaved caspase-3, which are hallmarks of apoptosis, had also increased at 72 h after the trametinib and lapatinib combination therapy, compared with after trametinib monotherapy (Fig. 5B). These results suggest that activated EGFR and HER2 signals are involved in salvage pathways under MEK inhibition in MEK1-mutated GC and that trametinib and lapatinib exert a synergistic effect by inhibiting the salvage signals.
Discussion
In this study, we demonstrated the reactivation of ERK1/2 via the activation of EGFR and HER2 signals after MEK inhibition with trametinib, and EGF-induced resistance in the MEK1-mutated GC cell line. Our data also identified the receptor tyrosine kinase family members EGFR and HER2 as potent targets for overcoming resistance to MEK inhibitors. Moreover, the combination of trametinib and lapatinib was more effective against a MEK1-mutated GC cell line than trametinib monotherapy. To the best of our knowledge, this is the first report to show the activation of EGFR and HER2 after MEK inhibition, the potential of combination therapy as a therapeutic strategy, and the possibility of overcoming resistance in MEK1-mutated GC.
The serine threonine kinases BRAF, MEK, and ERK are major regulators of the MAPK signal and are frequently dysregulated in malignancies. Given the role of these kinases in cancer, the MAPK signal has become an attractive target for molecular targeted drugs (30). While a number of MAPK signal inhibitors, as well as RAF inhibitors, have been developed and are in clinical use, the acquisition of resistance has hindered the continuation of treatment, resulting in a limited survival benefit. Resistance to MAPK inhibitors is mediated by many mechanisms, including the reactivation of RAS/RAF/MEK/ERK signals, MEK mutations, and increases in the RAS or RAF protein levels, as well as increased signals through alternative pathways, including the PI3K/AKT and STAT3 pathways (31). Recently, BRAF inhibition leading to a feedback activation of EGFR and a strong synergistic effect of BRAF and EGFR inhibition were described in BRAF-mutated colorectal cancer cell lines (32). Furthermore, the combination of a MEK inhibitor and a dual EGFR and HER2 inhibitor produced a synergistic effect by inhibiting the activation of ERK signals both in vivo and in vitro in KRAS-mutated colon and lung cancer cell lines (27). These results suggest that the activation of HER family members is an important salvage signal during MAPK inhibition. Similarly, in our data, the EGFR and HER2 signals were activated after treatment with a MEK inhibitor, resulting in the re-activation of the ERK signal. In addition, EGF stimulation also activated the ERK signal via the activation of EGFR and HER2 in the MEK1-mutated GC cell line, which led to MEK inhibitor resistance. The effects of the EGFR and HER2 signals were abolished by the inhibitor. These findings indicate the possibility of a novel combination therapy comprised of a MEK inhibitor and a HER inhibitor for GC patients, similar to results observed for other malignancies.
To address how MEK inhibition by trametinib activates EGFR and HER2, we investigated the mRNA expression of the corresponding genes using real-time RT-PCR. However, no significant change in mRNA expression was observed. MEK inhibition reportedly leads to MYC degradation and HER2 and HER3 upregulation in KRAS-mutated colon and lung cancer (27). Another study has shown that CDC25c, which can bind to EGFR, may be involved in the activation of EGFR in a BRAF-mutated colorectal cancer cell line (32). However, the detailed mechanism responsible for the activation of HER signals after MEK inhibition remains unclear. Furthermore, the activation of HER signals has been reported to result not only from MAPK inhibition, but also from exposure to cytotoxic agents, including 5-FU, oxaliplatin in colorectal cancer cells, and pemetrexed in non-small cell lung cancer (33,34). These findings suggest that the activation of HER signals plays a primary salvage role in many cancers, promising that resistance to many anticancer therapies can be overcome. Therefore, further research on approaches to overcoming such resistance is needed.
In conclusion, the present study revealed that the activation of EGFR and HER2 signals after MEK inhibition may serve as a potential mechanism responsible for the resistance to a MEK inhibitor in MEK1-mutated GC. Additionally, combined treatment with trametinib and lapatinib exhibited a synergistic effect by inhibiting the activation of the EGFR and HER2 signals. These data may contribute to the development of novel therapeutic strategies for MEK1-mutated GC.