All animal work performed in the present study was approved by the Animal Ethics Committee of the Dalian Medical University. The detail protocols and experimental processes conformed to the Experimental Animal Management Regulations of Dalian Medical University.

Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), TRIzol and Lipofectamine™ 2000 reagents were purchased from Invitrogen (Camarillo, CA, USA). Rg3 was provided by Dalian Fusheng Pharmaceutical Co., Ltd. (Dalian, China). It was diluted with cell culture media to final concentration. Cell Counting kit-8 (CCK-8) was purchased from Dojindo Laboratories (Kumamoto, Japan). Annexin V/FITC kit was purchased from Nanjing KeyGen Biotech Co., Ltd. (Nanjing, Jiangsu, China). Antibodies specific for PARP, caspase-3, -8, -9, Bcl-2, survivin, Bax, FUT4, β-actin, HRP-conjugated anti-rabbit and anti-mouse antibodies were purchased from Proteintech Group (Wuhan, China). Antibodies specific for p-p65, p65, pIκBα, IκBα, pIKKα/β and IKKα/β were purchased from Cell Signaling Technology (Boston, MA, USA). p65 siRNA was purchased from the Shanghai GenePharma Co. (Shanghai, China). NF-κB inhibitor (Bay 11-7082) was purchased from Selleck Chemicals (Houston, TX, USA). Nuclear extract kit and EMSA kit were purchased from Thermo Fisher Scientific (Waltham, MA, USA). ChIP kit was purchased from Millipore (Billerica, MA, USA). The enhanced chemiluminescence (ECL) assay kit was purchased from Amersham Biosciences (Pittsburgh, PA, USA).

Human melanoma cell lines A375P, A375M, C8161, Mevo and SK-MEL-28 were gifted from Dr Mary Hendrix (Stanley Manne Children’s Research Institute Northwestern University’s Feinberg School of Medicine, Chicago, IL, USA) and were grown in DMEM with 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin; maintained at 37°C under 5% CO₂ in humidified air.

Melanoma cells were plated at a density of 2,000 cells/well in 96-well plates, and treated with various concentrations of Rg3 for 24 h the following day. Cell viability was evaluated in cells using CCK-8 kit according to the manufacturer’s instructions. Briefly, 10 μl of the CCK-8 solution was added to cell cultures for the designated times. Plates were incubated for 1 h with CCK-8 solution at 37°C. The optical density (OD) was read at 450 nm absorbance on a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA).

Cells (1×10³ cells/well) were plated in 6-well plates containing DMEM with 10% FBS at 37°C. After 24 h, cells were treated with different concentrations of Rg3 (0, 25, 50, 75 and 100 μg/ml) for 24 h and then cells were allowed to grow for 10 days in the absence of Rg3. Cells were fixed and stained with crystal violet (0.5%) for 20 min at room temperature. Images were captured with the inverted microscope (Olympus IX71; Olympus, Tokyo, Japan).

Apoptosis was assessed by Annexin V-binding analysis of flow cytometry. For flow cytometric analysis, cells (1×10⁵) were seeded in 6-cm dishes overnight before treated with various concentrations of Rg3 for 24 h. Both adherent and floating cells were harvested and combined, washed twice with PBS, resuspended in 500 μl of binding buffer, and stained using an Annexin V-FITC/PI kit according to the manufacturer’s instructions. After incubation in the dark for 30 min, the cells were analyzed using FACScalibur instrument (FACSCalibur; BD Biosciences, San Jose, CA, USA). All experiments were performed in duplicate and reproducibility was checked in three independent experiments.

Total RNA was extracted using TRIzol (Invitrogen) according to the manufacturer’s protocol. RNA was reverse transcribed into cDNA using PrimeScript™ RT reagent kit (Takara, Tokyo, Japan). The FUT4 primers were 5′-AAGGTCCAGGCCCACTGAAG-3′ (forward) and 5′-CAGTTCAGGTGACAGAGGCTCAA-3′ (reverse); the GAPDH primers were 5′-ATGGGGAAGGTGAAGGTCG-3′ (forward) and 5′-GGGGTCATTGATGGCAACAATA-3′ (reverse). Real-time quantitative PCR reactions were performed with Applied Biosystems StepOne Real-time PCR system (Life Technologies, Carlsbad, CA, USA). Relative FUT4 mRNA levels were normalized with GAPDH and calculated using 2^−ΔΔCT method.

Cells were washed with PBS (pH 7.4), and incubated with 2× concentrated electrophoresis sample buffer (125 mM Tris-HCl, pH 6.8, 5% glycerol, 2% SDS, 1% β-mercaptoethanol) for 30 min on ice. Protein concentration was determined with Coomassie protein assay reagent using bovine serum albumin as a standard. Total protein (50–70 μg) from the whole cell lysates was separated by 12% SDS-PAGE and proteins separated in the gel were transferred electrophoretically onto nitrocellulose membrane (Millipore, Billerica, MA, USA), incubated with TTBS (50 mM Tris HCl, pH 7.5, 0.15 M NaCl, 0.1% Tween-20) containing 5% fat-free dry milk for 2 h followed by overnight incubation with the appropriate primary antibodies at the dilutions recommended by the suppliers at 4°C. After incubation with an HRP-conjugated appropriate secondary antibody, ECL (enhanced chemiluminescence) detection system (Bio-Rad Laboratories) was used to visualize immunoreactive bands.

Cells were treated with Rg3 (75 μg/ml) for 24 h. The DNA binding activities of NF-κB in nuclear extracts were assessed using the EMSA kit with biotin-labeled double-stranded NF-κB oligonucleotides (Beyotime, Nantong, China). The sequences of the oligonucleotides adopted were as follows: 5′-CGCTTGATGACTCAGCCGGAA-3′ and 3′-GCGAACTACTGAGTCGG CCTT-5′. Briefly, nuclear extracts (8 μg/sample) were incubated with the oligonucleotides in reaction buffer for 20 min. Protein DNA complexes were separated on a 6.5% non-denaturing acrylamide gel, transferred to positively charged nylon membranes, and immobilized by UV cross-linking for 10 min. Band shifts were detected by chemiluminescence method with a detection system (Bio-Rad Laboratories).

The NF-κB luciferase activity was determined in A375P and C8161 cells after co-transfected, using Lipofectamine 2000 reagent, with 2 μg of NF-κB luciferase plasmids and 0.2 μg of pGL3, which constitutively expressed Renilla luciferase. Twenty-four hours after transfection, the cells were treated with Rg3 (50 or 75 μg/ml as indicated) for 24 h. The luciferase activity was assayed using the Dual Luciferase reporter assay system Berthold Technologies (Bad Wildbad, Germany). Firefly luciferase activity was measured and the reading was normalized to Renilla luciferase activity, which served as an internal control for transfection efficiency.

The chromatin immunoprecipitation (ChIP) assay was performed according to the manufacturer’s instruction using cells at ~80% confluent post Rg3 treatment for 24 h. In brief, 1% paraformaldehyde was added to the cell-culture medium and incubated at room temperature for 10 min to cross-link. The cells were then washed twice in cold phosphate-buffered saline, scraped and lysed in SDS lysis buffer containing protease inhibitor cocktail for 10 min at 4°C. The lysates were sonicated five times for 15 sec each time, and the debris was removed by centrifugation. A total of 10 μl of the supernatant was used as an input sample, and the remaining of the lysate were diluted 10-fold with a dilution buffer containing protease inhibitor cocktail followed by incubation with antibodies against specific transactivators or a non-immune rabbit IgG control overnight at 4°C. Immunoprecipitated complexes were collected using protein A/G plus agarose beads. The precipitates were extensively washed and incubated in an elution buffer at room temperature for 20 min. Cross-linking of protein-DNA complexes were reversed at 65°C for 5 h, followed by treatment with 100 mg/ml Proteinase K for 2 h at 45°C. DNA was extracted three times with phenol/chloroform and precipitated with ethanol. The pellets were resuspended in TE buffer and subjected to PCR amplification using specific FUT4 promoter primers (forward primer, CCATTCCCAGCACTGTCTATTTC and reverse primer, CCTACGGGTTGAATTTGAATTTCT. The resulting product of FUT4 was separated by 1.0% agarose gel electrophoresis.

Male nude mice (Balb/c-nu/nu, 4–6 weeks old) were obtained from the Animal Center (Dalian Medical University) and maintained under sterile conditions during the entire experimental period. Mice were divided into two groups (n=8/group) based on the treatment. A375P cells (2×10⁶) suspended in 0.2 ml PBS were injected subcutaneously into the right flank. After 7 days of tumor inoculation, mice were treated with Rg3 (20 mg/kg of body weight) or its vehicle control subcutaneously for 3 weeks with time interval of 48 h. Tumor volume was measured by Vernier calipers every other day after tumor was palpable. The tumor volume was calculated according to the formula (volume=1/2 length × width²). At the end of the experiment (at day 30), the tumor was removed and weighed.

Each experiment was repeated 3 times and results are presented as the mean ± SEM. Unpaired Student’s t-tests were used to analyze differences between groups. P<0.05 was considered to be significant. The statistical software SPSS ver. 17 was used for analyzing the data.

To evaluate the effect of Rg3 on melanoma cell proliferation, we first treated various melanoma cells with different concentrations of Rg3 (0, 25, 50, 75 and 100 μg/ml) for 24 h. CCK-8 proliferation assay showed that Rg3 treatment significantly inhibited cell proliferation/viability in all cell lines tested (Fig. 1A). The IC₅₀ values are in the range of 57–83 μg/ml. The sensitivity of the cell responses to Rg3 was C8161>A375P>A375M>SKMEL-28>Mevo. We selected the most sensitive cell lines, A375P and C8161, for further study. Colony forming assay revealed that Rg3 treatment led to a significant decrease in the number of colonies (P<0.05) (Fig. 1B). The effect of Rg3 on cell growth was dose-dependent. These results indicate that Rg3 has a cytotoxic effect on melanoma cells and inhibits cell growth.

We investigated whether the observed Rg3 antitumor effect in human melanoma cells correlates with its effect on cell apoptosis. Human melanoma cell lines A375P and C8161 were treated with different concentrations of Rg3 for 24 h, followed by flow cytometric analysis after staining with Annexin V-FITC/PI. The results showed that treatment with Rg3 (0, 25, 50, 75 and 100 μg/ml) for 24 h led to concentration-dependent increases in apoptotic cells in both A375P and C8161 cells, from 3.28 and 4.41% in untreated control groups to 3.98 and 6.23% (25 μg/ml), 4.24 and 12.89% (50 μg/ml), 24.04 and 66.05% (75 μg/ml), and 57.75 and 86.51% (100 μg/ml), respectively (Fig. 2A). We further examined the expression of apoptotic marker proteins. As shown in Fig. 2B, Rg3 treatment effectively activated the expression of pro-apoptotic proteins (caspase-3, -8, -9 and Bax), decreased the expression of anti-apoptosis proteins (Bcl-2 and survivin) in a dose-dependent manner (Fig. 2B). In addition, Rg3 also activated PARP, a marker of apoptosis (Fig. 2B, top row). These results indicate that Rg3 induces human melanoma cells apoptosis.

Previous studies have demonstrated that NF-κB plays a critical role in apoptosis and cell survival, it is possible that NF-κB pathway might also be involved in Rg3-induced apoptosis in human melanoma cells. As shown in Fig. 3A, treatment with Rg3 (75 μg/ml) for 24 h led to a significant decrease in the phosphorylation of NF-κB/p65, IκBα and IKKα/β in both A375P and C8161 cells. Similarly, we also observed a decrease in the basal level of NF-κB/p65, IκBα and IKKα/β after Rg3 treatment (Fig. 3A). Moreover, Rg3 decreased the nuclear level of NF-κB/p65 and its phosphorylation (Fig. 3B), suggesting Rg3 also inhibited the nuclear translocation of NF-κB/p65. Subsequently, we investigated the effect of Rg3 on DNA-binding activity of NF-κB/p65. By EMSA assays, we found dramatically reduced NF-κB DNA binding in Rg3 (75 μg/ml) treated cells (Fig. 3C). To further investigate the effects of Rg3 on NF-κB activity, NF-κB-Luc was transfected into A375P and C8161 cells and the luciferase activity was measured. As shown in Fig. 3D, preincubation with Rg3 (50 and 75 μg/ml) significantly suppressed the NF-κB transcription activity (P<0.05 or <0.01). These results demonstrate the inhibitory effects of Rg3 on the NF-κB signaling pathway and the NF-κB DNA binding/transcription activities.

A previous study showed that FUT4 was an anti-apoptosis protein. Increased expression of FUT4 inhibited cyclophosphamide-induced apoptosis in A431 cells (21). To examine whether the effect of Rg3-induced apoptosis was related to decreased expression of FUT4. A375P and C8161 cells were treated with Rg3 (75 μg/ml) for 24 h and FUT4 expression was examined. Results showed that treatment with Rg3 suppressed FUT4 expression in both protein (Fig. 4A) and mRNA (Fig. 4B) levels. These results suggest that Rg3 downregulates the expression of FUT4. To examine whether FUT4 expression is regulated by NF-κB signaling pathway, NF-κB signaling was disrupted by either knocking down p65 or treatment with NF-κB inhibitor, Bay 11-7082 (10 μM). Results showed that disrupting NF-κB downregulated the expression of FUT4 at both mRNA (Fig. 4C) and protein (Fig. 4D) levels. We further evaluated the effect of Rg3 on the binding activities of NF-κB to FUT4 promoter by ChIP assay. Results showed that treatment of cells with Rg3 for 24 h markedly inhibited the binding of NF-κB p65 subunits to the FUT4 chromatin structure as compared with the control (Fig. 4E). These results suggest that the inhibition of FUT4 expression by Rg3 was modulated by the NF-κB/p65 signaling pathway and FUT4 is a possible downstream target of NF-κB.

To determine the role of NF-κB signaling pathway and the FUT4 expression in Rg3-induced apoptosis, A375P cells were incubated with Rg3 (75 μg/ml), FUT4 siRNA and Bay 11-7082 (10 μM) for 24 h, or preincubated with FUT4 siRNA 48 h, Bay 11-7082 (10 μM) 24 h, followed by Rg3 (75 μg/ml) treatment for 24 h. As shown in Fig. 5, treatment with Rg3, FUT4 siRNA and NF-κB inhibitor resulted in the increased expression of cleavage of caspase-3 by 2.0-, 2.5-and 1.2-fold, and decreased the expression of anti-apoptosis proteins Bcl-2 and survivin. While Rg3 combined with FUT4 siRNA and Bay 11-7082 showed higher effect on the expression of apoptosis-related proteins than either of them alone. This result suggested that Rg3-induced melanoma cell apoptosis was augmented by FUT4 siRNA and disrupted the NF-κB signaling pathway with FUT4 downregulation. Moreover, NF-κB signaling pathway blockage and FUT4 downregulation could be an effective approach in sensitization of the antitumor efficacy of Rg3 in human melanoma cells.

The anticancer activity of Rg3 was further evaluated in A375P melanoma cell xenograft mouse model. As showed in Fig. 6A, treatment with Rg3 led to a significant inhibition of tumor growth by 53.56% (P<0.05). Tumor weight in groups treated with Rg3 (20 mg/kg) decreased by 52.86% compared with the control group (Fig. 6B, P<0.01). All animals survived during the experimental period, treatment with Rg3 (20 mg/kg) was well tolerated and there was no significant loss of body weight or any observable toxic effect in mice treated with Rg3 in comparison with the control (Fig. 6C). The regulation of apoptosis-related proteins in the xenograft tumor specimens was also assessed. As shown in Fig. 6D, Rg3 treatment led to a significantly increased expression of cleavage of caspase-3, and decreased expression of the anti-apoptosis proteins Bcl-2 and survivin in comparison to controls. Moreover, by western blot analysis and immunohistochemical staining, we found that the expression levels of FUT4 and p65 were significantly decreased with Rg3 treatment as compared with the control group (Fig. 6E and F).