PGPIPN was provided by Shanghai Sangon Biological Engineering Technology (Shanghai, China), and the purity was confirmed by RP-HPLC to be >99.5%. RPMI-1640 culture medium (RPMI: Roswell Park Memorial Institute) was purchased from Gibco BRL Co., Ltd., USA. Fetal bovine serum (FBS) was purchased from Sijiqing Co., Ltd. (Hangzhou, China). DDP was purchased from Qilu Pharmaceutical Co., Ltd. (Jinan, China). Matrigel (artificial reconstituted basement membrane) was purchased from Becton-Dickinson Co. (Franklin Lakes, NJ, USA). Transwell chamber with 8-μm pore was purchased from Coster Company (Santa Fe Springs, CA, USA).

Mouse monoclonal antibodies of MTA1, NM23H and β-actin were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). The horseradish peroxidase conjugated secondary antibody (goat anti-mouse IgG) and Super Signal West Pico Trial kit (ECL chromogenic reagent kit) were purchased from Pierce, USA. BCA kit for protein quantitative assay was purchased from Shanghai Sangon Biological Engineering Technology. The other common biochemical reagents were purchased from Shanghai Biotechnology Co., Ltd.

Human ovarian cancer cell line SKOV₃ (ovarian serous papillary cystadenocarcinoma) was originally purchased from ATCC (American Type Culture Collection, USA) and preserved by the Biochemistry and Molecular Biology Laboratory of Anhui Medical University. Human ovarian cancer cell line SKOV₃ was cultured in RPMI-1640 medium with 10% FBS in 5% CO₂ at 37ºC, and then digested with 0.4% trypsin after growing to the logarithm for the next experiment.

For primary ovarian cancer cell culture, fresh primary ovarian tumor tissues, which were assessed and classified as serous ovarian adenocarcinoma (III–IV grade) according to WHO criteria, were obtained from 37 patients with ovarian cancer at initial debulking surgery between January 2014 and March 2015 at the first affiliated hospital of Anhui Medical University. The patients had not received adjuvant therapies such as chemotherapy or radiotherapy before surgery. All the patients signed a written consent documenting donation of their tissue for research purpose according to the Declaration of Helsinki before tissue deposition. The fresh ovarian cancer tissues were washed with PBS 2–3 times to remove the blood, surrounding fats, necrosis tissues and non-tumor tissues, then cut into small pieces ~1 mm³ and again rinsed with PBS two times. The pieces of tumor tissues were digested with 0.4% trypsin in sterile centrifuge tube at 37ºC for 30 min, shaken once every 5 min. To obtain the single suspension cells, the above digested tissues were filtered with 100 μm cell strainer. After centrifuged at 1,000 rpm for 5 min, the cell pellet was re-suspended in RPMI-1640 medium containing 0.1 mg/l epidermal growth factor (EGF), 0.1 mg/l insulin-like growth factor (IGF) and 0.1 mg/l β-estradiol with 10% FBS, which were subsequently cultured in 5% CO₂ at 37ºC. Once cells reached 70–80% confluence, cell culture medium was drained from the flask, and cells were digested with 0.25% collagenase II until ~1/3 of the cells fell to the bottom of the dish as evaluated using a microscope. Due to their initial shedding, most fibroblasts were eliminated by collagenase digestion. The remaining cells were continually cultured in 5% CO₂ at 37ºC. A portion of these cells were placed on the cell slide and identified by using anti-cytokeratin 7-FITC (FITC: fluorescein isothiocyanate, a green fluorescent dye) for cytokeratin 7 of ovarian cancer cells and Hoechst 33258 (blue fluorescent dye for the nuclei) to assay their purity.

The Transwell assay was conducted to study cell invasion. The cells in the logarithmic growth were pretreated with PGPIPN at 0 (as control), 1×10⁻⁵, 1×10⁻⁴, 1×10⁻³ and 1×10⁻² g/l respectively for 30 min. In addition, DDP at 1×10⁻⁴ g/l was added in the same plate as positive control. Then the above cells at a density of 3×10⁵ cells/ml in sextuplicate were respectively seeded in the upper insert (8-μm pore) using 200 μl RPMI-1640 medium without FBS, which contained the above concentrations of PGPIPN or 1×10⁻⁴ g/l DDP. In addition, the fitted culture dishes contained 500 μl RPMI-1640 medium with 10% FBS. After 30, 36 and 42 h (30 and 36 h for SKOV₃ cells; 36 and 42 h for primary ovarian cancer cells) respectively, the chambers were removed from the plates, fixed, and the migrated cells were stained with hematoxylin and eosin. For each well five representative ×100 images were quantified. Each experiment was performed in two independent sets. Invasion inhibition rate (%) = (1 − invasive cell number of experimental group/that of control group) × 100%.

Migration of cells in logarithmic growth was examined using a scratch assay. The cells in sextuplicate were cultured in a 12-well plate at 5×10⁴ cells/well until a confluent monolayer was formed. A 200-μl pipette tip was used to scratch the wells. The wells were sequentially rinsed with PBS and cultured in RPMI-1640 medium with 10% FBS. The wells were treated with 0 (as control), 1×10⁻⁴, 1×10⁻³ and 1×10⁻² g/l PGPIPN respectively, and DDP at 1×10⁻⁴ g/l was added in the same plate as positive control. The images of the scratch test were taken by microscopy. The cell migration was measured by Image J software (version 1.48, National Institutes of Health, USA) with contrasting quantification of pixels in the area of scratch at 0, 12 and 24 h. Each experiment was performed in two independent sets. Migration inhibition rate (%) = (1 − experimental group pixels/control group pixels) × 100%.

The cells in logarithmic phase were digested by trypsin, resuspended, and counted. The cells in sextuplicate were seeded in 6-well plates at 1,000 cells/well (500 μl), in which RPMI-1640 medium with 10% FBS contained 0 (as control), 1×10⁻⁵, 1×10⁻⁴, 1×10⁻³ and 1×10⁻² g/l PGPIPN respectively, and DDP at 1×10⁻⁴ g/l was added in the same plate as positive control. The fresh media were replaced once every 2 days. Cells were cultured in 5% CO₂ at 37ºC for 12 days, the numbers of colonies were counted. A colony containing >30 cells was defined as positive, and counted. The inhibition rate of colony formation was calculated as follows. Each experiment was performed in two independent sets. Colony inhibition rate (%) = (1 − colony number of experimental group/that of control group) × 100%.

An optimized RT-PCR protocol was employed to analyze the mRNA levels of NM23H1 (metastasis-associated gene-1) and MTA1 (metastatic tumor antigen 1). β-actin was used as a housekeeping gene. According to primer sequences of NM23H1, MTA1 and β-actin genes retrieved from Primer-Bank, primers were designed with Primer 5.0 software, which were synthesized by Shanghai Sangon Biological Engineering Technology. These primer sequences are as follows: NM23H1 forward, CTTTAGGGATCGTCTTTCAAGG; reverse, TGCCAACTTGTATGCAGAAGTC 399 bp; MTA1 forward, TGGCAGATAAAGGAGAGATTCG; reverse, TGTCGTAGATGTTCTTGTGGAGA 312 bp; β-actin forward, TGACGTGGACATCCGCAAAG; reverse, CTGGAAGGTGGACAGCGAGG 205 bp.

SKOV₃ cells or primary ovarian cancer cells were harvested after PGPIPN treatment (sextuplicate) at different doses for 48 h, respectively. The total RNAs in cells were extracted according to the TRIzol kit manufacturer's instructions, and the purity and concentration were determined by ultraviolet spectrophotometry. The reverse transcription reaction conditions were 42ºC, 15 min and 95ºC, 5 min. After the reaction, the reverse-transcribed cDNAs were diluted with RNase-free water to a final volume of 60 μl and preserved at 80ºC. Real-time PCR adopts Takara SYBR Green as real-time PCR Master Mix in ABI7500 fluorescent real-time PCR instrument. The reaction conditions were as follows: 95ºC×30 sec (1 cycle); 95ºC×5 sec, 60ºC×34 sec (40 cycles). The ABI SDS software (Applied Biosystems) was used to determine a critical threshold (C_t), which was defined as the cycle number where the linear phase for each sample crossed the threshold level. The mRNAs of target gene expression were denoted by ΔC_t (ΔC_t = target gene C_t − β-actin C_t value). Finally, the relative mRNA expression of all samples were calculated using the 2^−ΔΔCt method (15). All reactions were performed in triplicate, and a mixture lacking a complementary DNA template (NTC) was used as the negative control.

The cells were harvested after PGPIPN treatment (sextuplicate) at different doses for 48 h, respectively. Proteins from the above cells were separated by SDS-PAGE and transferred to PVDF membrane based on the method described by Green and Sambrook (16). After blocking with 5% (w/v) dry skim milk, membranes were incubated with primary antibodies (mouse monoclonal NM23H1, MTA1 and β-actin antibodies, 1:1,000) and then incubated with horseradish peroxidase conjugated secondary antibody (goat anti-mouse IgG, 1:8,000). The proteins were detected with the enhanced chemiluminescence (ECL) system followed by exposure to X-ray film. β-actin was used as a loading control. Digital images were captured by Gel Doc™ gel documentation system (Bio-Rad, USA) and intensities were quantified using Quantity-One software version 4.62 (Bio-Rad).

All statistical analyses were performed with SPSS version 16.0. The effect of the treatment on each parameter was analyzed by one-way analysis of variance (ANOVA). Results are shown by mean ± SD, and P<0.05 was considered to be statistically significant.

The primary ovarian cancer cells from fresh ovarian tumor tissues, which were assessed and classified as serous ovarian adenocarcinoma (III–IV grade) according to WHO criteria (Fig. 1A), were cultured (Fig. 1B). By immunofluorescence through cytokeratin 7 (CK7), the purities of these primary ovarian cancer cells were identified using anti-cytokeratin 7-FITC and Hoechst 33258 (Fig. 1C and D), their average purity reached 84.5%.

The effect of PGPIPN on the invasive ability of ovarian cancer cells was assayed by Transwell. PGPIPN significantly decreased the invasive ability of the SKOV₃ cells (Fig. 2A and B) and primary ovarian cancer cells (Fig. 2C and D), in which the maximum inhibition ratios were (28.86±3.01)% in SKOV₃ line cells and (27.14±2.14)% in primary ovarian cancer cells. The inhibition effect of PGPIPN showed a dose-dependent manner (Fig. 2B and D). However, the inhibitory effect of the peptide was less than that of clinical anticancer drug-DDP. The invasion inhibition of DDP at 1×10⁻⁴ g/l already exceeded 40% on both ovarian cancer SKOV₃ cells and the primary ovarian cancer cells at 30–42 h.

Cell scratch assay was used to detect the effect of PGPIPN on human ovarian cancer cell migration. PGPIPN was found to attenuate cell migrations of both SKOV₃ (Fig. 3A and B) and the primary ovarian cancer cells (Fig. 3C and D). PGPIPN significantly attenuated gap closure after 12 and 24 h (Fig. 3). Hence, PGPIPN can significantly inhibit the migration of ovarian cancer cells, which was dose-dependent within the dose range of 1×10⁻⁴–1×10⁻³ g/l (Fig. 3). The effect of the peptide on primary ovarian cancer cells is much better than that of the SKOV₃ cells. The inhibitory effects of the peptide to human ovarian cancer cells were similar to that of DDP at 12–24 h.

We examined the colony formation capacity of SKOV₃ cells treated with different concentrations of PGPIPN. The cells were allowed to grow for 12 days to form colonies. PGPIPN can significantly inhibit cell colony formation of ovarian cancer SKOV₃ cells (Fig. 4). Our results revealed that PGPIPN could significantly suppress the colony formation capacity of ovarian cancer cells. However, the inhibition effect was slightly less than that of the same concentration of DDP, and the inhibition rate of 1×10⁻⁴ g/l DDP was 39.78±7.8%.

Real-time PCR experiments were performed using MTA1 and NM23H1-specific primers to assess their relative mRNA expression (2^−ΔΔCt) in human ovarian cancer cells treated with PGPIPN for 48 h (Fig. 5). The changes of MTA1 and NM23H1 mRNAs in SKOV₃ cells are displayed in Fig. 5A. PGPIPN significantly decreased the mRNA level of MTA1 gene and increased the mRNA level of NM23H1 gene in contrast. The effect of PGPIPN on mRNA expression levels of MTA1 and NM23H1 genes were dose-dependent.

The PGPIPN also reduced mRNA levels of MTA1 and NM23H1 genes in primary ovarian cancer cells similarly to SKOV₃ cells (Fig. 5B). Compared with the cell line SKOV₃, the effects of PGPIPN on primary ovarian cancer cells were more obvious.

Western blotting was used to analyze MTA1 and NM23H1 protein levels of human ovarian cancer cells treated with PGPIPN at different concentrations for 48 h (Fig. 6). NM23H1 in SKOV₃ cells was elevated in PGPIPN-treated groups compared to control group, while MTA1 protein gradually decreased with increasing drug concentration (Fig. 6A and B). Notably, PGPIPN-mediated effects on protein levels were significant at the concentration of ≥1×10⁻⁴ g/l (P<0.05 or P<0.01) (Fig. 6B).

PGPIPN also affected NM23H1 and MTA1 protein levels in primary ovarian cancer cells after treatment for 48 h, which was similar to that of SKOV₃ cells (Fig. 6C and D).