Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), and antibiotics (penicillin and streptomycin) were purchased from Invitrogen-Life Technologies (Carlsbad, CA, USA). Antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA). Oxymatrine was obtained from Shanghai Chemical Technology Co., Ltd., (Shanghai, China) and dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA) at a stock concentration of 500 mg/ml; it was then diluted further in culture medium. Each experiment was repeated at least three times and new dilutions were prepared for each experiment. Thiazolyl blue tetrazolium bromide (MTT) was obtained from Sigma-Aldrich.

Human lung carcinoma cell lines A549 and NCI-H1299 were purchased from the Shanghai Cell Institute Country Cell Bank (Shanghai, China). The A549 and NCI-H1299 cell lines were cultured in DMEM or RIPM-1640 and supplemented with 10% heat-inactivated FBS, 100 U/ml penicillin G and 100 μg/ml streptomycin at 37°C in a humidified 5% CO₂ atmosphere.

To construct shRNA-expressing lentiviral vectors for silencing of APE1, the targeting sequence 5′-TGACAAAGAGGCAGCAGGA-3′ and stable short hairpin RNA (shRNA) expression cassettes were cloned into the RNAi-Ready pSIREN-RetroQ vector containing puromycin as a screening marker, which was purchased from Clontech Laboratories, Inc. (Mountain View, CA, USA). The primer sequences were as follows: forward, 5′-GATCCGTGACAAA GAGGCAGCAGGATTCAAGAGATCCTGCTGCCTCTTT GTCATTTTTTG-3′ and reverse, 5′-AATTCAAAAAATGA CAAAGAGGCAGCAGGATCTCTTGAATCCTGCTGCCT CTTTGTCACG-3′. The APE1 gene was amplified from cDNA isolated from K562 cells using polymerase chain reaction (PCR), and was then cloned into pOZN-HA vector using the primers: APE1-Xho1-forward, 5′-CGTTCGTACTCGAGATG CCGAAGCGTGGGAAAAAG-3′ and APE1-Not1-reverse, 5′-CTTTTCCTTTTGCGGCCGCTCACAGTGCTAGGTAT AGGG-3′.

Recombinant replicationdeficient VSV lentiviruses were used and were propagated and purified and the titer was determined. A549 cells were then infected by collected virus supernatant. A549 cell infections were carried out at MOIs of 100 and 200 for 16 h, and the transfected cells with APE1^shRNA were screened with puromycin for 2–5 days. The transfected cells with pOZN-HA-APE1 were screened by IL-2 receptor magnetic activated cell sorting. To determine the effect of APE1 knock-down in APE1^shRNA or overexpression in APE1^OE cells, western blotting was used to measure APE1 expression levels. Lentivirus production and cell infections were performed according to the manufacturer’s instructions.

Cells grown on coverslips were fixed in 4% paraformaldehyde, permeabilized with PBS containing 0.1% Triton X-100, and blocked in 3% normal donkey serum in PBS for 30 min at room temperature. Rabbit anti-human 8-OHDG (dilution 1:1,000) and p-H2AX (dilution 1:1,000) antibodies were diluted in 3% normal donkey serum in PBS and applied at 4°C overnight. After rinsing three times with PBS and incubating for 1 h with donkey anti-rabbit secondary antibody (dilution 1:1,000), slides were washed three times in PBS and the cell nuclei were stained with DAPI for 10 min at room temperature. Images were acquired on a Leica TCS SP5 confocal fluorescence microscope.

Terminal deoxynucleotidyl dUTP nick end labelling (TUNEL) assays were performed to measure apoptosis in cultured cells using the DeadEnd colorimetric TUNEL system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Briefly, cells were grown on coverslips in 6-well plates after oxymatrine treatment; the coverslips were then removed from the media at the designated time points, fixed and permeabilized. The cells were incubated in rTdT reaction mixture for 60 min at 37°C. The slides were stained with 4′,6-diamidino-2-phenylindole (DAPI) and mounted using anti-fade solution with a coverslip and nail polish. Images were captured using a confocal laser microscope (TCS SP5; Leica Microsystems, Wetzlar, Germany).

Cells were treated with different concentrations of oxymatrine (2, 4 and 6 mg/ml) for 48 h, and washed twice with cold 1X PBS. The cells were then lysed using a Teflon-glass homogenizer in lysis buffer containing 0.25 M sucrose, 10 mM Tris-HCl (pH 7.5), 3 mM MgCl₂, 0.1 mM EDTA, 0.05% NP40, and a mix of protease and phosphatase inhibitors (Beyotime Institute of Biotechnology, Shanghai, China). The homogenates were centrifuged at 1,000 × g for 10 min at 4°C, and the supernatants were retained for protein quantitation and western blotting. For localization studies the total cellular extracts were fractionated into nuclear and cytosolic fractions using a nuclear protein extraction kit (Beyotime Institute of Biotechnology).

Cells were harvested and re-suspended in an SDS buffer (Beyotime Institute of Biotechnology) for preparation of total protein extracts. Western blot analysis was performed according to the antibody (Cell Signaling Technology) and to the manufacturer’s protocols.

Cell lines were seeded into 96-well plates at a density of 3×10³ cells/well, incubated overnight at 37°C in 5% CO₂, and treated with oxymatrine (0, 2, 4 and 6 mg/ml) for indicated time (24, 48 and 72 h). Cell viability was determined using MTT assays (Sigma-Aldrich). Briefly, MTT (5 mg/ml) was added and the plates were incubated at 37°C for 4 h in the dark. The absorbance was measured at a wavelength of 490 nm using a microplate reader (FluoDia T70; Photon Technology International, Lawrenceville, NJ, USA).

A549 cells (500 cells/well) were seeded into a 60-mm plate in triplicate. After incubation for 10 days the plates were washed gently with PBS and stained with 0.1% crystal violet. Colonies containing >50 cells were counted manually. The plating efficiency was calculated by dividing the number of colonies formed in the treated group by that in the control group.

Cells were seeded in 6-well plates (1.5×10⁵ cells/well), treated with different concentrations (0, 2, 4 or 6 mg/ml) of oxymatrine for 48 h, harvested and washed with cold PBS. The amount of cell surface phosphatidylserine in apoptotic cells was estimated quantitatively using an Annexin V-APC/7-AAD or Annexin V/PI double staining apoptosis detection kit (Liankebio, Shanghai, China) according to the manufacturer’s instructions. The percentage of apoptotic cells was analyzed using flow cytometry. Triplicate experiments with triplicate samples were performed.

To assess the ability of oxymatrine to inhibit AP endonuclease activity an oligonucleotide cleavage assay was designed. The pair of oligonucleotides used in the fluorescence-based AP endonuclease assay was 890-FAM GGAAGGCCGCTGACAGTTT TTCTGTCAGCGG and its complementary oligonucleotide. If APE1 cleaves the DNA at the abasic site at position 7 from the 5′ end the 6mer fluorescein-containing molecule can dissociate from the complementary strand by thermal melting. As a result, the quenching effect of 3′-dabcyl (which absorbs the fluorescence emitted by fluorescein when in close proximity) is lost, and APE1 activity can be measured indirectly as an increase in fluorescence signal.

For fluorescence-based AP endonuclease assays the single-stranded oligonucleotides (10 M) were dissolved and annealed in annealing buffer (25 mM Tris, pH 7.5, 1 mM EDTA and 50 mM NaCl) at 95°C for 5 min at a 1:1 ratio and allowed to cool to room temperature overnight. The DNA was diluted as appropriate with assay buffer (20 mM HEPES-KOH, 0.5 mM MgCl₂, 50 mM KCl, 0.1 mg/ml BSA), aliquoted, and stored at −20°C (15). The protein samples (8 ng/μl) and 20 μl/well hAPE1 standard (diluted to 0.05 ng/μl with assay buffer; recombinant human APE1; Sino Biological, Inc., North Wales, PA, USA) were added to each well followed by 20 μl oligonucleotide probe (500 nM) and then mixed. Fluorescence readings were taken continuously during 30-min incubation at 37°C using a LB-940 microporous multifunction analyzer in kinetic mode with excitation at 495 nm and emission at 530 nm.

Genomic DNA was purified from cells treated with oxymatrine using a Takara, MiniBest Universal Genomic DNA Extraction kit ver. 5.0 (Takara, Shiga, Japan). The abasic (AP) sites in genomic DNA were identified using Nucleostain-DNA Damage Quantification kit-AP Site Counting (Dojindo Molecular Technologies, Kumamoto, Japan) following the manufacturer’s instructions (15).

Each experiment was repeated at least three times and the new dilutions were prepared for each experiment. The results are presented as means ± standard error of the mean (SEM). Differences between means were analyzed using Student’s t-test and were considered statistically significant at P<0.05. When more than one group was compared with control, significance was evaluated according to one-way analysis of variance (ANOVA). All statistical analysis was performed using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA).

Oxymatrine is a promising anticancer drug that inhibits the proliferation and growth of various cancer cells in vitro and in vivo (16–18). To investigate the effects of oxymatrine on the viability of lung cancer cells, A549 and H1299 cells were treated with different concentrations of oxymatrine (0, 2, 4 or 6 mg/ml) for the indicated times (24, 48 or 72 h). Compared with the PBS group (0 mg/ml, 0 h), treatment with 4 and 6 mg/ml oxymatrine inhibited the viability of A549 and H1299 cells, significantly (P<0.05 or P<0.01; Fig. 1A and B). Next, Annexin V-APC/7-AAD staining and flow cytometry was performed to quantify cellular apoptosis. Forty-eight hours after treatment, apoptosis was significantly higher in the oxymatrine group compared with the control group (P<0.05) (Fig. 1C and D). These observations were confirmed by investigating whether oxymatrine promoted A549 cell death using TUNEL staining. The number of TUNEL-positive cells was significantly higher in the 4 and 6 mg/ml oxymatrine groups than in 0 and 2 mg/ml oxymatrine groups (P<0.05; Fig. 1E and F). These results suggest that oxymatrine induced apoptosis in lung cancer cells.

To explore the mechanism responsible for oxymatrine-induced apoptosis, DNA damage was evaluated using 8-OHdG and p-H2AX immunofluorescent staining and western blotting in A549 and H1299 cells that had been treated with oxymatrine for 48 h. Fig. 2A shows markedly increased 8-OHdG-positive areas in cells treated with both 2 and 4 mg/ml oxymatrine compared with control cells (P<0.05; Fig. 2A and C).

The H2A histone family member X (H2AX) is a key factor in the repair of damaged DNA. The phosphorylation of H2AX is an early event during the formation of double-stranded DNA breaks and the response to DNA damage (19). Therefore, the expression of p-H2AX was detected by immunofluorescence staining and western blotting. The expression of p-H2AX was increased significantly in cells treated with both 2 and 4 mg/ml oxymatrine compared with control (P<0.05; Fig. 2B, D, E and H).

PARP is a nuclear enzyme that is activated by DNA damage. Following genotoxic stress PARP synthesizes a branched polymer of poly(ADP-ribose) or PAR that participates in the regulation of nuclear homeostasis (20–22). Many different cellular insults that cause DNA damage activate PARP and induce PARP-dependent cell death. As expected, treatment with oxymatrine induced the activation of PARP. H1299 and A549 cells were treated with different concentrations of oxymatrine for 48 h, and analysis revealed that oxymatrine induced PARP activation in a dose-dependent manner and oxymatrine can induced PARP cleavage in H1299 (Fig. 2E–G). This suggests that the activation of these proteins occurs as a result of apoptosis.

Human APE1 is an essential enzyme in the BER pathway, where it plays a role in repairing abasic sites. APE1 is responsible for 95% of the endonuclease activity in cells (23), and is a critical part of both the short-patch and long-patch BER pathways (24). Western blotting revealed that oxymatrine inhibited the expression of APE1 protein in both H1299 and A549 cells compared with control (Fig. 3A and B). The nuclear localization of APE1/Ref-1 was also decreased significantly by oxymatrine (6 mg/ml; P<0.05) in A549 cells (Fig. 3C).

A fluorescence-based AP endonuclease assay described by Madhusudan et al (25) was adapted. Oxymatrine inhibited APE1 and AP endonuclease activity in A549 cell nuclear cell extracts in a dose-dependent manner (Fig. 3D). These results suggest that oxymatrine is an inhibitor of the DNA repair activity of APE1/Ref-1 in lung cancer cell lines.

The reduction of APE1 protein expression by APE1 shRNA vector transfection in A549 cells (also called APE1^shRNA stable A549 cell lines) was confirmed by western blotting. Transfection with APE1 shRNA reduced APE1 expression by 47% compared with vector control transfected cells (control; Fig. 4A). In contrast, the expression of APE1 was increased markedly in A549 cells transfected with APE1-HA (also called APE1^OE stable A549 cell lines); HA was used as a fusion tag for detection. Specifically, the expression of APE1 was increased 4-fold in APE1^OE cells compared with control vector (Fig. 4B).

Oxymatrine treatment significantly reduced the proliferation of APE1^shRNA cells, as measured by MTT and colony formation assays after 48 h (P<0.001). Furthermore, APE1^shRNA alone inhibited cell growth by 20% (P<0.05). However, oxymatrine treatment did not induce a significant reduction in proliferation in APE^OE cells, suggesting that these cells are resistant to oxymatrine (Fig. 4C–E).

To determine if oxymatrine inhibits APE1 directly in APE1^shRNA and APE^OE cells, AP site formation was measured using ARP assays. A significant increase in the number of AP sites in APE1^shRNA cells were observed with oxymatrine. However, there was no significant change in AP sites in APE1^OE cells treated with oxymatrine compared with control. The assay was performed four times, each in triplicate, and the data presented show the mean of the four experiments with standard errors (Fig. 4F).

Compared with the APE^shRNA cells, oxymatrine treatment caused a significant increase in apoptosis using Annexin V/PI staining and flow cytometry. In contrast, APE^OE cells presented low apoptosis induction with statistically significant difference between the groups APE^shRNA oxymatrine-treated cells and APE^OE oxymatrine-treated cells (P<0.05) (Fig. 5A and B). Consistent with these results there were higher levels of PARP and phosphorylated H2AX^[Ser139] in oxymatrine-treated APE1^shRNA cells compared with untreated group (Fig. 5C–E). In contrast, these changes of phosphorylated H2AX^[Ser139] were not observed in oxymatrine-treated APE1^OE cells, but PARP expression decreased significantly. These results suggest that APE1 plays an important role in regulating oxymatrine-induced apoptosis.