Adult Sprague Dawley (SD) rats weighing 250–275 g, aged 6 months (n=5 per group), were provided by the Experimental Animal Center at the Chengdu Military General Hospital (Chengdu, China) and maintained with a 12 h light/dark cycle and ad libitum access to food and water. All procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals (National Institutes of Health, Bethesda, MD, USA) and were approved by the Administration Committee of Experimental Animals of Sichuan Province, China. All efforts were made to minimise the number of animals used and their suffering during the experiments.

Primary cultures of Schwann cells were obtained from the sciatic nerves of 3-day-old SD rats using the method previously described by Fei et al (13). Schwann cells were then maintained in complete Dulbecco's modified Eagle's medium (DMEM) at 37°C and 5% CO₂. The purity and viability of cultured primary rat Schwann cells were determined by flow cytometry with FITC-anti-S100 antibody (1:1,000; ab76749; Abcam, Cambridge, MA, USA) for Schwann cells and 7-aminoactinomycin D (BioLegend, San Diego, CA, USA) for cell viability.

In Schwann cells in vitro proliferation assays, cells were cultured (1×10⁶ cells/ml for 48 h) in 5% fetal bovine serum in triplicate in 96-well flat-bottom microtiter plates and treated with FA (Sigma-Aldrich, St. Louis, MO, USA). Cell proliferation was determined by cell counting kit-8 (CCK-8) assay (Dojindo Molecular Technologies, Inc., Kumamoto, Japan), as previously described (14). In ³H-methyl-thymidine proliferation experiments, cells were pulsed with 0.25 µCi ³H-methyl-thymidine (Shenggong Trade Co., Shanghai, China) at the last 16 h of cell culture and cell proliferation was expressed as the average counts per minute of ³H-thymidine uptake, as previously described (15).

Total RNA of Schwann cells and sciatic nerves was isolated using TRIzol LS reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and reverse transcribed into cDNA using NCode™ miRNA First-Strand cDNA Synthesis kit (Invitrogen; Thermo Fisher Scientific, Inc.). The resulting cDNA was used to quantitatively measure the expression of genes using Power SYBR^® Green Master Mix (Invitrogen; Thermo Fisher Scientific, Inc.). Primers (Wuhanboshide, China) used to measure gene expression levels were as follows: GAPDH sense, GACATGCCGCCTGGAGAAAC, and antisense, AGCCCAGGATGCCCTTTAGT; MAG sense, ACAGCGTCCTGGACATCATCAACA, and antisense, ATGCAGCTGACCTCTACTTCCGTT; MBP sense, TTGACTCCATCGGGCGCTTCTTTA, and antisense, GCTGTGCCACATGTACAAGGACTCA.

Similarly to the cell culturing in the proliferation assay, the Schwann cells were treated with FA in the absence or presence of PD98059 (Sigma-Aldrich). Schwann cells and sciatic nerves were lysed in ice-cold radioimmunoprecipitation assay buffer (Shenggong Trade Co.). The lysed cells were centrifuged (12,000 × g, 25 min, 4°C) and the supernatants were collected. A standard western blotting protocol was used, as previously described (16). Next, the samples were incubated with primary antibodies at 4°C overnight, including MAG (1:500; sc-15324), MBP (1:500; sc-809), MEK1 (1:1,000; sc-219), ERK1/2 (1:1,000; sc-292838), phosphorylated (p)-MEK1 (1:500; sc-293106), p-ERK1/2 (1:500; sc-101760), which were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA), as well as GAPDH (1:500; AB-P-R 001), from Goodhere Biotechnology Co., Ltd. (Hangzhou, China). Subsequently, the samples were incubated with the horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody (1:500; A0208), obtained from Beyotime Institute of Biotechnology (Haimen, China). The blots were then detected by chemiluminescence using enhanced chemiluminescence reagent (BeyoECL Plus; Beyotime Institute of Biotechnology). Images of the blots were captured by Carestream Image Station 4000MM (Carestream Health Inc., Woodbridge, CT, USA), and the band density was detected by Quantity One (version 4.6.2; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Crush injury of rat sciatic nerves was performed according to the method previously described by Varejão et al (17), with minor modifications. Briefly, rats were anaesthetised, and the right sciatic nerve was carefully exposed through the gluteal-splitting approach and then crushed with a haemostatic clamp at a standardised force at moderate level for 30 sec. Animals in the treatment group (n=5) received FA (50 mg/kg, intraperitoneal injection) daily for 7 days after the injury, while the control group rats (n=5) received the same amount of phosphate-buffered saline (PBS) injection at the same time periods. At 2 or 4 weeks after the beginning of the experiments, rats were euthanised and the right sciatic nerve segment distal to the lesion was removed and stored. Schwann cells in sciatic nerves were harvested using a rat Schwann cell isolation kit from Miltenyi Biotec GmbH (Bergisch Gladbach, Germany). The cell proliferation of isolated Schwann cells was determined by flow cytometry with a proliferation marker PE-conjugated anti-Ki-67 antibody from eBioscience Inc. (1:200; cat. no. 12-5698; San Diego, CA, USA).

The data are expressed as the mean ± standard error of the mean. The Mann-Whitney U test was performed to determine statistically significant differences between FA-treated and non-treated groups. GraphPad Prism version 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA) was used to perform statistical analysis. Statistically significant differences were determined at P<0.05.

Primary rat Schwann cells were successfully isolated and cultured, as demonstrated by flow cytometric analysis (Fig. 2A). In order to study the influence of FA on Schwann cells proliferation in vitro, Schwann cells were treated with various concentrations of FA (0, 25, 50 and 100 µM) and cultured in 5% serum DMEM for 0, 24, 48 or 72 h. As shown in Fig. 2B, Schwann cell viability was greatly increased following FA treatment compared with that in the control cells, as demonstrated by CCK-8 assay (P<0.05). Subsequently, the radioactive ³H-thymidine incorporation assessment was applied in order to precisely determine the effects of FA on Schwann cell proliferation. The results demonstrated that FA significantly induced Schwann cell proliferation in a dose-dependent manner (Fig. 2C). These results confirmed that FA is involved in the induction of a cell proliferative reaction of Schwann cells.

MAG and MBP are important myelin proteins in peripheral nerves that are expressed by Schwann cells (18). The present study detected the MAG and MBP expression levels of cultured Schwann cells following treatment with FA by RT-qPCR and western blotting. As shown in Fig. 3, Schwann cells directly subjected to FA treatment showed an increase in their MAG and MBP mRNA expression levels (Fig. 3A and B). Furthermore, Schwann cells were subjected to FA at a therapeutic concentration (50 µΜ) for different time periods, and the results demonstrated an upregulation of MAG and MBP mRNA expression levels subsequent to FA exposure for 24, 48 and 72 h (Fig. 3C and D). In accordance with the RT-qPCR results, the western blotting results also demonstrated that the protein expression levels of MAG and MBP in Schwann cells were directly promoted by FA in a concentration-dependent (Fig. 4A) and time-dependent (Fig. 4B) manner. Therefore, these data revealed that FA, beside its ability to promote Schwann cell proliferation, was also capable of inducing Schwann cell differentiation in vitro.

The critical role of ERK signalling pathway in Schwann cells has been previously demonstrated (19). Therefore, the present study attempted to determine whether MEK1/ERK1/2 is also activated in Schwann cells by FA. Schwann cells treated with 100 µM FA (as a result of previous results shown in Fig. 2B) were harvested and analysed by western blotting. As shown in Fig. 5A and B, p-MEK1 and p-ERK1/2 expression was induced following incubation with FA for 15, 30 and 60 min. Furthermore, when co-cultured with 20 µM PD98059, a chemical inhibitor of MEK1, p-MEK1 and p-ERK1/2 expression levels in Schwann cells induced by FA were significantly inhibited (Fig. 5C and D). These results indicated that MEK1/ERK1/2 signalling in Schwann cells can be activated by FA treatment.

Furthermore, in order to determine the role of MEK1/ERK1/2 activation in FA-induced Schwann cell differentiation and proliferation, cells were incubated with 100 µM FA in the presence of 20 µM PD98059. The results indicated that the FA-induced Schwann cell proliferation (Fig. 6A) and expression of MAG and MBP (Fig. 6B and C) were significantly reduced in the presence of PD98059 (P<0.05). These findings suggested that FA induced Schwann cell proliferation and differentiation mainly through the MEK1/ERK1/2 signalling pathway.

Since proliferation and differentiation of Schwann cells was induced by FA in vitro, it was suggested that FA may exert similar nerve remyelination effects in vivo. Rats with sciatic nerve crush were intraperitoneally treated with FA or PBS daily for a total of 7 days. The results demonstrates that, at 4 weeks post-injury, Schwann cells isolated from FA-treated nerves showed 1-fold increase in MAG expression and 2-fold increase in MBP expression when compared with the expression levels in the PBS group (P<0.05; Fig. 7A and B). Furthermore, Ki-67, a cell proliferation marker was used to determine the proliferation of sciatic nerve-derived Schwann cells. As shown in Fig. 7C, 35% of Schwann cells from PBS-treated sciatic nerves were Ki-67-positive, whereas this proportion was increased to 53% in FA-treated sciatic nerves, indicating that FA also exerts cell proliferation effects on Schwann cells in vivo. The expression levels of MAG and MBP in the sciatic nerve was also detected 4 weeks after crush injury. Compared with the control, FA treatment induced a 3-fold increase of MAG and 4-fold increase of MBP expression in sciatic nerves (P<0.05; Fig. 7D and E).