Cancer tissue specimens were obtained from 40 osteosarcoma patients aged from 13 to 46 years who had undergone resection at the Orthopaedics Department of First Affliated Hospital, Third Military Medical University between 2014 and 2016. Clinical information of all the patients was collected and shown in Table I. This study was approved by the ethics committee of First Affliated Hospital, Third Military Medical University, and all patients provided informed consent.

All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. All animal experiments were carried out strictly in accordance with international ethical guidelines and the National Institutes of Health Guide concerning the Care and Use of Laboratory Animals. The experiments were approved by Medical Ethics Committee of the Southwest Hospital and the First Affiliated Hospital of the Third Military Medical University.

Two human osteosarcoma cell lines MG-63 and SaOS-2 [American Type Culture Collection (ATCC), Manassas, VA, USA] were maintained in DMEM high glucose media (PAA Laboratories, Pasching, Austria) supplemented with 10% (v/v) fetal bovine serum (PAA Laboratories, Pasching, Austria) at 37°C and 5% CO₂. Culture medium was changed twice a week, and splitting of the cell culture was done every ten days at confluency of 70–80%. Cells were kept in a 5% CO₂ atmosphere at 37°C before analyzing.

The acute cytotoxic effects of cisplatin (1.5, 3, 4.5, 6, 8 and 4 µM, 8, 12 and 16 µM) on cell viability were measured in confluent monolayers in 96-well plates, using the CCK8 kit (Sigma-Aldrich) according to the standard method. Briefly, cells were allowed to grow in a 75-cm² cell culture flask (TPP Techno Plastic Products, Trasadingen, Switzerland) until 95% confluent. The cells were then seeded into each well and incubated for 24 h at 37°C in an atmosphere of 7.5% CO₂ in air. In the last hour of incubation, 100 µl CCK8 solution (Dojindo, Japan) was added to each well for 1 h, and the absorbance was read at 450 nm on the BioTek FL600^® fluorescence/absorbance plate reader (BioTek Instruments Inc., Winooski, VT, USA). Control groups consisted of cells in media (minus chemical) which were processed identically and incubated simultaneously as treated groups. Parallel sets of wells without cells were incubated as process blanks. Calculation of inhibitory concentration 50 (IC₅₀) value was determined from the absorbance versus concentration curve for each chemical based on a minimum of 3 experiments performed at separate times.

A monoclonal strain was separated by dilution culture method. MG-63 and SaOS-2 were derived by incubation with stepwise increasing cisplatin concentrations (from 1.5 to 16 µM). Cells were seeded in a 24-well dish at 100 cells/well and allowed to adhere for 24 h in an incubator after which the cisplatin (Sigma, USA) was added. Cells were replaced with fresh DMEM media after 24-h incubation. After each treatment, the survival cells re-expanded and were conventionally propagated for four generations in cisplatin-free media. Each individual experiment was performed in triplicate and repeated three times.

Total RNA (2 µg) was extracted using an RNeasy Mini kit (Qiagen, Germany). RNA purity and concentration were estimated with an ND-1000 spectrophotometer (NanoDrop Technologies, Thermo Scientific, UK). Total messenger RNA was reverse-transcribed into cDNA using the Verso™ cDNA synthesis kit (Thermo Fisher Scientific) as described by the manufacturer. Each forward and reverse validated primer (5 µM) (Sigma-Aldrich, UK) is listed in Table II. Each reaction contained 50 ng cDNA and was carried out using SYBR^® green RT-PCR master mix (Life Technologies). PCR reactions with 50 ng/µl of the cDNA samples per 10 µl final reaction volume, were performed using standard cycling parameters (stage 1, 50°C for 2 min, stage 2, 95°C for 10 min then 40 cycles of 95°C for 15 sec and 60°C for 1 min) on an ABI 7900HT sequence detection system. Normalization was performed using GAPDH as the internal control, and relative gene expression was calculated by the comparative 2^−ΔΔCt method using SDS 2.2 software (Applied Biosystems).

Before employing a set of phospho-specific antibodies, lysis buffer (12.5 ml Tris-HCl, 2 g SDS, 10 ml glycerol, 67.5 ml distilled water) was used to harvest whole-cell lysates, followed by sonication. The concentration of protein in the cell lysates was estimated by using a bicinchoninic acid (BCA) assay. Novex^® 4–20% Tris-glycine 12-well polyacrylamide gradient gels (Invitrogen, UK) were used to separate proteins. Subsequently, proteins were transferred onto a nitrocellulose membrane (GE Healthcare, Little Chalfont, UK) via the Protean Mini Cell system (Bio-Rad, München, Germany). After blocking in 5% non-fat milk in TBS/0.1% Tween-20 (Merck, Darmstadt, Germany) (2 h, RT), the membrane was incubated with the corresponding primary antibody (overnight, 4°C). After washing with TBS/0.1% Tween-20 the secondary (peroxidase-conjugated) antibody was added (1:10,000, 2 h, RT). For visualization of the bound antibodies the Fusion FX7 imaging system (PeqLab, Erlangen, Germany) was used. All antibodies were diluted in 5% milk/1X TBS-Tween (w/v). Enhanced chemiluminescence (GE Life Sciences) and X-ray film (Fujifilm) were finally used to visualize the proteins. Sections were incubated with the primary antibody, anti-human LPAATβ polyclonal antibody (1:10,000; Santa Cruz), anti-human P-gp polyclonal antibody (1:10,000; Abcam), anti-human MRP1 polyclonal antibody (1:4,000; Abcam), anti-human GST polyclonal antibody (1:4,000; Abcam), anti-human Bcl-2 polyclonal antibody (1:4,000; Santa Cruz); anti-human Akt1/2 polyclonal antibody (1:4,000; Santa Cruz), anti-human Akt1/2 polyclonal antibody (1:4,000; Santa Cruz), anti-human mTOR polyclonal antibody (1:5,000; Santa Cruz) and anti-human PIK3CA polyclonal antibody (1:10,000; Santa Cruz), respectively, at 4°C overnight.

We detected the expression of LPAATβ in tissue samples and phospho-mTOR in tumor samples by immunohistochemisty in nude mice. Samples were carefully digested and fixed overnight in 4% paraformaldehyde with a 0.1 M phosphate buffer solution (pH 7.4). Then cells were embedded in paraffin and sliced into 5-µm-thick serial sections using a Microtome (Leica Microsystems Inc., Buffalo Grove, IL, USA). The sections were deparaffinized and fixed after hydration. Sections were incubated with the primary antibody, anti-human LPAATβ polyclonal antibody (1:100; Abcam), anti-mouse phospho-mTOR polyclonal antibody (1:50; Abcam), respectively. at 4°C overnight. The photographs of the identified adjacent areas were taken under high magnification (×400).

To further prove the importance of LPAATβ in the process of cisplatin resistance, small intering RNA (siRNA GCCGGACGGUGGAGAACAUGA) transfection was performed using three sequences designed to target LPAATβ which were designed by the Invitrogen RNAi design tool (http://www.invitrogen.com) and synthesized by Invitrogen, Ltd. Non-targeting negative control of siRNA (control TTCTCCGAACGTGTCACGTTTC) was also synthesized. The oligonucleotides were annealed and inserted into the pLKO.1 siRNA expression vector. The LPAATβ-interference cell lines MG-63 and SaOS-2 were established using lentivirus transfection and puromycin selection with the second sequence. For lentivirus-mediated RNAi, the 293T cells were selected for transfection with two kinds of auxiliary packaging vector plasmids (LPAATβ-siRNA-pLKO.1 and pLKO.1) respectively with polyethylenimine (PEI). The supernatant was collected, and MG-63, MG-63-CR, SaOS-2 and SaOS-2-CR cells were infected for 5 h with polybrene. To obtain the stable cell line, puromycin selection was performed. The efficiency of LPAATβ inhibition was evaluated by RT-PCR.

Cells were plated onto coverslips in MEM medium with 10% FBS for 24 h before being transfected with lentivirus-mediated siRNA or negative control. At 48 h after transfection, the cells were fixed with 4% paraformaldehyde for 20 min, incubated in 0.3% Triton X-100-PBS for 10 min at room temperature, followed by blocking with 5% goat serum at 37°C for 30 min. The cells were then incubated with the primary antibody at 4°C overnight; mouse anti-phospho-mTOR IgG (1:200, Santa Cruz). The samples were soaked in goat anti-human IgG conjugated to Cy3 (1:400; Jackson ImmunoResearch) at 37°C for 1 h. Subsequently, the nuclei were counter stained with DAPI (1:1,000; Sigma-Aldrich, Inc., MO, USA). Images were obtained using an inverted fluorescence microscope (Olympus). The primary antibody was replaced with PBS as the negative control.

Divided into 4 groups (n=32), right flank of SCID mice were inoculated subcutaneously with cisplatin-resistant MG-63-CR-LV3-siRNA (1×10⁷ cells) and SaOS-2-CR-LV3-siRNA (1×10⁷ cells), respectively, at day 0, followed by intraperitoneal injection of cisplatin (4 mg/kg) when the tumor volume reached 100 mm³. In addition, MG-63-CR-LV3 (1×10⁷ cells) and SaOS-2-CR-LV3 (1×10⁷ cells) were employed for in vivo experiments as control vector groups. All mice were monitored for tumor growth for 40 days before sacrifice. The tumor size in these tumor-bearing mice was measured and tumor volumes were calculated as: length × width² × 0.45.

Tumor samples from nude mice were collected at the indicated time-points and fixed in 10% formalin solution for 48 h, and then embedded in paraffin for the 5-µm-thick sections. Serial sections of the embedded specimens were stained with hematoxylin and eosin (H&E) using standard pathology procedures and evaluated by a pathologist.

The differences between each group are expressed as the mean ± SD. Statistical significance was assessed by Student's t-test and one-way ANOVA followed by a Tukey post hoc test. Differences were considered statistically significant at P-value of <0.05.

Immunohistochemical detection was performed in tissue samples of both cohorts. As Fig. 1A shown, LPAATβ in cisplatin-resistant osteosarcoma patients was stained as brown in cell membrane and nuclear while in osteosarcoma patients was very weak, similar to the control group (Fig. 1A). The cell membrane and nuclear LPAATβ protein expression of mature and new born tumor cells was observed in the nuclear of nascent tumor cells at various differentiation states, compared to control group.

Two human osteosarcoma cell lines were subjected to treatment with 7 different concentrations of cisplatin, ranging from 0.05 to 2 µM for 24, 48 and 72 h. Cytotoxicity of cisplatin in control and drug-resistant pairs (MG-63 and MG-63-CR; SaOS-2 and SaOS-2-CR) were measured by CCK8 assays. Examples of resulting volumes are shown in Fig. 1B and C. As shown in Fig. 1B, MG-63-CR cells displayed enhanced cisplatin IC₅₀ value after cisplatin treatment, compared with those of parental cells. The IC₅₀ value at 24 h was the highest compared to 48 and 72 h. The same result is shown as Fig. 1C, SaOS-2-CR cells displayed the highest cisplatin IC₅₀ value after cisplatin treatment for 24 h, compared with those of parental cells. In order to extend our findings, we measured LPAATβ level in these cell lines. LPAATβ mRNA level and protein level were significantly increased in drug-resistant cell lines, compared with those of control parental cells, which were positively correlated with cisplatin IC₅₀ (Fig. 1D and E).

In order to explore the effect of cisplatin in osteosarcoma, we harvested MG-63-CR and SaOS-2-CR after cisplatin treatment for 72 h, and then detected P-gp, MRP1, GST, Bcl-2 expression in mRNA level and protein level as Fig. 2 shows. The mRNA levels of P-gp, MRP1, GST, Bcl-2 in MG-63-CR and SaOS-2-CR were upregulated (Fig. 2A–D), compared to those of parental cells. Similar with results of mRNA level detection, protein levels of P-gp, MRP1, GST, Bcl-2 were increased significantly (Fig. 2E).

First we validated mRNA and protein levels of LPAATβ after effective siRNA mediated lentivirus transfection. As shown in Fig. 3A and B, mRNA level (Fig. 3A) and protein level (Fig. 3B) were both significantly inhibited after siRNA interference, compared to blank vector group.

To characterize the role of LPAATβ in cisplatin resistance, two pairs of LPAATβ knockdown cell lines from MG-63 and SaOS-2 were established, stably transfected with blank vector LV3 or effective LPAATβ siRNA. Cytotoxicity of cisplatin in control and LPAATβ knockdown pairs (MG-63-LV3 and MG-63-siRNA; MG-63-CR-LV3 and MG-63-CR-siRNA; SaOS-2-LV3 and SaOS-2-siRNA; SaOS-2-CR-LV3 and SaOS-2-CR-siRNA) were measured by CCK8 assays. We examined whether depletion of LPAATβ can re-sensitize cisplatin resistant cells, as shown in Fig. 3C–F, the drug-resistant cells depleted of LPAATβ displayed markedly reduced cisplatin IC₅₀, compared with blank vector trasnfection groups, which was lower than those of parental cells.

We monitored the change of P-gp, MRP1, GST, Bcl-2 expression at mRNA level and protein level after LPAATβ was silenced (Fig. 4), mRNA levels of P-gp, MRP1, GST and Bcl-2 in parental and drug-resistant cells were downregulated (Fig. 4A–D), which is similar with result of protein level detection (Fig. 4E), compared to blank vector transfection groups.

We also harvested cells after lentivirus treatment, and then detected expression of PI3K/Akt/mTOR signaling pathway relevant proteins (Fig. 5). The mRNA levels of PIK3CA, Akt1/2 and mTOR in MG-63-CR-siRNA and SaOS-2-CR-siRNA were downregulated (Fig. 5A–D), compared to those of NC group. Similar with results of mRNA level detection, protein levels of PIK3CA, p-PIK3CA, Akt1/2, p-Akt1/2, mTOR and p-mTOR were decreased significantly (Fig. 5E).

Immunofluorescence results showed that phospho-mTOR expression at 48 h was increased significantly in MG-63-CR cells (Fig. 6A) and SaOS-2-CR cells (Fig. 6B) compared to their parental cell lines, which were downregulated in MG-63-CR cells (Fig. 6A) and SaOS-2-CR cells (Fig. 6B) transfected with siRNA mediated by lentivirus compared with negative control.

Using a nude mouse model, it was found that mice with subcutaneous LPAATβ-depleted cell line derived tumors had smaller tumor burden, with consequent enhanced survival benefit (Fig. 7A and B). Interestingly, we monitored the tumor volumn after cells implantation for 40 days and found that tumor volume in MG-63/SaOS-2-siRNA group was significantly inhibited with respect of MG-63-LV3/SaOS-2-LV3 group, based on pair comparison at every time-point (Fig. 7C). Moreover, extensive tubular necrosis was observed in the nude mice with implantation of drug re-sensitive cancer cells by lentivirus-mediated siRNA insertion using histopathological examinations (Fig. 7D). Immunohistochemical detection displayed phospho-mTOR expression alteration in both cisplatin-resistant cells and cisplatin re-sensitive cells. As Fig. 7E shows, phospho-mTOR in cisplatin-resistant osteosarcoma cells (MG-63-CR-LV3 group and SaOS-2-CR-LV3 group) was stained brown in cell membrane and nuclear while in cisplatin re-sensitive cells was very weak (MG-63-CR-siRNA group and SaOS-2-CR-RNA group).