MicroRNA (miR)-145 has been reported to induce cancer stem cell (CSC) differentiation through downregulation of the stem cell transcription factors (TFs) that maintain CSC pluripotency. High expression of miR-145 indicates a good prognosis in cancer patients, but its role in cervical cancer stem cells (CCSCs) is not known. We show that expression of miR-145 and core stem cell transcription factors, Sox2, Nanog and Oct4, are associated with the pluripotency of CCSCs, with increased expression of miR-145 after cervical tumor-sphere (CT) differentiation. miR-145 overexpression inhibited expression of core TFs, as well as decreasing tumor invasion and colony formation, whereas miR-145 knockdown led to the opposite effects. Injection of adenovirus-miR-145 significantly reduced tumor growth in nude mice. High miR-145 expression predicted a better prognosis compared with that in patients with low miR-145 expression after analyses of The Cancer Genome Atlas (TCGA) data. These results suggest that miR-145 is able to induce CT differentiation through enzymolyzing TFs and might be a therapeutic target for cervical carcinoma.
Cervical cancer (CC) is the most common cancer in females and the second most common cause of cancer-related mortality in China (
Previously, miR-145 was reported to induce differentiation of human embryonic stem cells through enzymolysis of the core stem cell transcription factors Oct4, Sox2, and KLF4 (
This study protocol was approved by the Medical Ethics Committees of Xi'an Jiaotong University of Medicine (no. H34-32-1, Xi'an, China). All investigations were conducted in accordance with the Declaration of Helsinki. All the patients involving this study provided a written informed consent. The nude mice used in this study were treated in accordance with the institutional guidelines of the Animal Ethics Committee for the care and use of animals in Xi'an Jiaotong University of Medicine, China. We confirm that all methods were carried out in accordance with relevant guidelines and regulations of Xi'an Jiaotong University of Medicine.
We previously described the method of CT culture (
All Ad-vectors had comparable titers of 108–109 transducing units/ml. Virus suspensions were stored at −80°C until use. Suspensions were centrifuged briefly and kept on ice immediately before use. For transduction, 2×104 dissociated tumorsphere cells were transduced 1 day after initial seeding of cells with a multiplicity of infection (MOI) of 25. Cells were incubated in stem cell medium containing adenovirus particles and 4
A colony formation assay was carried out as previously described (
Dissociated tumorsphere cells or adenovirus vector-transfected cells were grown in 6-well plates and collected. Cells were resuspended in PBS containing 2% fetal bovine serum (FBS) and 0.1% sodium azide, and then analyzed by a FACScalibur system (BD Biosciences). Acquisition was set for 10,000 events per sample. Data were analyzed using FACS v4.1.2 (BD Biosciences). Triplicate samples were analyzed in each experiment.
Total RNA was extracted from cells using TRIzol® (Invitrogen). miRNA levels were assayed using Taqman® probes and primer sets (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. Briefly, first-strand cDNA was generated using a reverse transcription system kit (Promega, Madison, WI, USA) with random primers of miR-145. Realtime PCR was carried out using power SYBR Green PCR master mix (Applied Biosystems) in a StepOnePlus® system (Applied Biosystems). The level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was used as the control for internal normalization. For exact quantification of gene copies per cell, reverse-transcribed miR-145 cDNA was used as a template to formulate standard curves. Then, the exact number of copies of miR-145 per cell was calculated according to their molecular weight and cell counts. Primer sequences are presented in
After dissociation of tumorspheres and tumorsphere-derived differentiated cells from 21 cervical cancer patients in a non-enzymatic cell-dissociation solution, cells were washed in serum-free Hank's balanced salt solution (HBSS). Then, cells were suspended in a 1:1 (v/v) mixture of serum-free DMEM/F12, and 1×105 cells were injected (s.c.) into the right (differentiated cells) or left (tumorsphere cells) mid-abdominal area of nude mice using a 23-G needle. Animals were subjected to necropsy 28 days after implantation, and tumor growth assessed by measuring volume using the formula: V = 1/2 × (L × W2). In the silenced-miR-145 group, mice were sacrificed at 14 days after injection to avoid necrosis in transplanted tumors. Sequences of primary miR-145 or silent miR-145 are shown in
Lysates were extracted from tumorspheres or cells. Proteins (20
Cervical cancer samples were fixed in phosphate-buffered 10% formalin (pH 7.2), embedded in paraffin, and cut into sections (4
The complementary DNAs of Sox2, Nanog and Oct4 were purchased from Shanghai Yingji Biological Company (Shanghai, China). Mutated constructs containing the 6 bp point mutations in the core TF seed sequence predicted to be the miR-145 target sequence were synthesized using a QuikChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA). The primers were designed by Stratagene using their own software (
Titers of virus stocks were checked using TCID50 methods. High-titer stocks were stored at −70°C until use. Two weeks after injection of tumorspheres into nude mice, the tumors became palpable and each tumor site was injected with 5.8×105 pfu of Ad-miR-145 and Ad-Mock with gadolinium (1:1) (Sigma-Aldrich). Tumor size was measured each week.
Cell invasion was evaluated using 24-well Transwell® culture chambers, as previously described (
The protocol followed that previously described (
Data are shown as the mean ± standard error of the mean. Comparison between groups were performed using analysis of variance, Fisher's exact test or two-tailed Student's t-test. P<0.05 was considered to indicate a statistically significant difference.
Our results showed that cervical cancer tissues were immunopositive for Nanog (20/21), Oct4 (19/21) and Sox2 (20/21), and 19/21 samples were positive for all three TFs. Staining for these TFs was visible in the cytoplasm and nuclei of a few (but not all) cancer cells, and we could detect that most cervical cancer cells expressed these TFs (18/21) (
Next, we examined expression of miR-145 and core TFs according to tumorsphere stages. First, we assessed expression of miR-145 in cells cultured under tumorsphere conditions or differentiated conditions [removal of basic fibroblast growth factor (bFGF) from the stem cell medium]. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) showed that the protein levels of core TFs decreased, whereas miR-145 level increased, at different time points and underwent dynamic changes (
Next, we investigated the role of miR-145 in cervical cancer. Ad-miR-145-GFP was transduced into tumorspheres or their differentiated cells to increase miR-145 expression. Flow cytometric analyses showed that there were 91±1.9% GFP-positive cells in the overexpressed Ad-miR-145-GFP group and 91±2.3% in the adenovirus-scrambled sequence-GFP (Ad-scr) group with no homology to the human genome, which acted as the control group among transfected tumorsphere cells. The miR-145 level was increased 4.5-fold in the overexpressed Ad-miR-145-GFP group compared with its control (
Next, we transfected the Ad-silence-miR-145 (Ad-si-miR-145-GFP) vector or its control (Ad-scr-GFP) into CTs. Flow cytometric analyses showed that there were 90±1.4% GFP-positive cells in the Ad-si-miR-145-GFP group and 88±3.2% in the Ad-scr-GFP group. The miR-145 level was decreased fourfold compared with the control (
miR-145 seed sequences were predicted within Oct4, Sox2 3′-untranslated regions (UTR) and Nanog coding sequence (CDS) by the software miRanda after mutation of miR-145 target sequences (6 bp deletion of the miR-145 target site) in these core transcription factors (
We further addressed the dependence of the reported repression of Oct4, Sox2 UTR reporter, and Nanog CDS reporter on the level of miR-145. After depletion of miR-145 by antisense inhibitor, locked nuclei acid (LNA) in CT completely abolished the differential regulation between the mutant and WT 3′-UTR reporters in Oct4 and Sox2 (
Tumor cells were dissociated from tumorspheres and injected into null mice. The resulting tumors were visible or palpable 2 weeks after injection. Next, we injected 5.8×105 pfu of Ad-miR145 or Ad-Mock with gadolinium combination into tumors three times a week (
To ascertain the clinical relevance of miR-145 and these core stem cell transcripts in the prognosis of CC patients, we evaluated the TCGA dataset. We found that high expression of miR-145 indicated a better prognosis compared with low expression of miR-145 (
Cervical cancer is caused by human papillomavirus infection (HPV) (
Wang
Recently, unmodified miR-145 delivered by peptide-based vectors applied through a system or location in a mouse model of colon carcinoma resulted in a 40 or 60% decrease in tumor growth, with concomitant repression of ERK5 and c-Myc protein levels compared with negative controls, respectively (
This project was supported by the Natural Science Foundation of Shanxi Province, China (grant no. 2013JM4012) and the Key projects of Hubei Provincial Department of Education (grant no. 20162103), Natural Science Foundation of Hubei Province, China (grant no. 2016CFB409).
miR-145 expression is increased after differentiation of cervical tumorspheres. (A)
Overexpression of miR-145 induces CT differentiation and inhibits CT invasion and tumor formation. miR-145 level increased (A), while core TF levels (B) and colony formation (C) tumorsphere invasion (D) decreased after miR-145 overexpression. P<0.05 before and after transfection with Ad-pri-miR-145 (pri-miR-145), n=3. (E) Tumor formation of CTs harboring AD-pri-miR-145 or its control in nude mice, P=0.02, n=5.
Knockdown of miR-145 maintains CT pluripotency and increases CT invasion and tumor formation. miR-145 level decreased (A), while core TF levels (B), colony formation (C) and tumorspheres (D) increased after knockdown of miR-145. P<0.05 before and after transfection with Ad-silence-miR-145 (si-miR-145), n=3. (E) Tumor formation increased after knockdown of miR-145. P<0.03 before and after transfection with Ad-Silence-miR-145, n=5.
Endogenous miR-145 represses the 3′-untranslated regions (UTRs) of Oct4, Sox2, and coding sequence (CDS) of Nanog in CTs. (A) The mutational sequences in the core TFs. (B) The 3′-UTR or CDS reporters in target validation. Luc, firefly luciferase; pA, polyadenylation signal; WT, wild-type. Mutation (mut) has a 6 bp deletion of the miR-145 target site. The relative luciferase level of 3′-UTR luciferase reporters of Sox2 (C), Oct4 (D), and CDS luciferase reports of Nanog (E) in CTs under self-renewal conditions at 24 or 48 h after transfection. Mut, mutant UTR or CDS with a 6 bp deletion of the miR-145 target sites; Control, the basal luciferase reporter without the UTR of Sox2 and Oct4, CDS of Nanog (n=3). The difference between 3′-UTR mutant and wild-type luciferase reporters of Oct4 (F), Sox2 (G), and CDS mutant and wild-type luciferase reporters of nanog (H) depends on miR-145 in CTs. On the y-axis, the mutant reporter level is normalized against the average of the wild-type reporter level to reflect the magnitude of repression.
Injection of AD-miR-145 into transplanted tumors inhibits tumor growth, expression of core TFs, colony formation, and tumorsphere invasion. Injection of AD-miR-145 (5.8×105 pfu) into transplanted tumors inhibited tumor growth (A, P=0.09), suppressed the expression of core TFs as shown by immunohistochemistry (B), decreased levels of core TFs (C, P=0.02), increased miR-145 level (D, P=0.04), and decreased colony formation (E, P=0.007) and cell invasion (F, P=0.012).
Survival curves were analyzed based on expression of miR-145 or core TFs in all SCC patients in the Cancer Genome Atlas (TCGA) dataset. (A) High levels of miR-145 suggests longer patient survival. A robust difference is seen when miR-145 is combined with the core stem cell transcription factors Nanog (B), Sox2 (C) and Oct4 (D).
Patient characteristics.
Sample no. | Age (years) | Diagnosis |
---|---|---|
1 | 36 | SCC, Stage IB |
2 | 41 | SCC, Stage IB |
3 | 49 | SCC, Stage IB |
4 | 47 | SCC, Stage IB |
5 | 56 | SCC, Stage IB |
6 | 54 | SCC, Stage IB |
7 | 57 | SCC, Stage IB |
8 | 68 | SCC, Stage IB |
9 | 56 | SCC, Stage IB |
10 | 53 | SCC, Stage IB |
11 | 36 | SCC, Stage IB |
12 | 39 | SCC, Stage IB |
13 | 49 | SCC, Stage IB |
14 | 52 | SCC, Stage IB |
15 | 61 | SCC, Stage IC |
16 | 46 | SCC, Stage IC |
17 | 67 | SCC, Stage IC |
18 | 38 | SCC, Stage IC |
19 | 66 | SCC, Stage IIA |
20 | 63 | SCC, Stage IIA |
21 | 69 | SCC, Stage IIA |
SCC, squamous cell carcinoma.
PCR primers and products.
Symbol | Primer | Product (bp) |
---|---|---|
Nanog | S: 5′-AATGGTGTGACGCAGAAG-3′ | 255 |
A: 5′-AGATTCCTCTCCACAGTTATAG-3′ | ||
Oct4 | S: 5′-AGCTGGAGAAGGAGAAGC-3′ | 194 |
A: 5′-AAAGCGGCAGATGGTCGT-3′ | ||
Sox2 | S: 5′-CAATAGCATGGCGAGCGG-3′ | 196 |
A: 5′-GTCGTAGCGGTGCATGGG-3′ | ||
GAPDH | S: 5′-AAGGCTGAGAATGGGAAAC-3′ | 254 |
A: 5′-TTCAGGGACTTGTCATACTTC-3′ |
S, sense; A, antisense.
Primers for overexpression of miR-145 or knocked down miR-145.
Symbol | Primer | Sequence |
---|---|---|
Pri-miR-145 | Sense | 5′-TGCTGGTCCAGTTTTCCCAGGAATCCCTGTTTTGGCCACTGACTGACAGGGATTCGGGAAAACTGGAC-3′ |
Antisense | 5′-CCTGGTCCAGTTTTCCCGAATCCCTGTCAGTCAGTGGCCAAAACAGGGATTCCTGGGAAAACTGGACC-3′ | |
Si-miR-145 | Abm | (Catalog number mh5195) |
Si-miR-145 control | Abm | (Catalog number m010) |
Primers for mutation miR-145 target sequence on Sox2, Nanog and Oct4.
Symbol | Primers |
---|---|
Oct4 | S: GGAGTCGGGGTGGAGAGCAACTCC |
A: CCTCAACGAGAGGTGGGGCTGAGG | |
Nanog | S: CTTTAGTTAATTCATACAATGTC |
A: GACATTGTATGAATTAACTAAAG | |
Sox2 | S: TCTCCCCCCTCGCTGTCCGGCCCT |
A: AGGGCCGGACAGCGAGGGGGGAGA |
S, sense; A, antisense.