This study acquired Institutional Review Board approval from Fudan University Shanghai Cancer Center (Shanghai, China). Written informed consent was obtained from all subjects. The methods were carried out in accordance with the approved guidelines.

Pathologically confirmed thyroid cancer tissues, were obtained from 130 patients who received thyroidectomy between 2012 and 2015 at the Department of Head and Neck Surgery, Fudan University Shanghai Cancer Center. For the TCGA cohort, SIRT gene expression and clinical data of TCGA database are available from the website of Cancer Genomics Browser of University of California Santa Cruz (UCSC) (https://genome-cancer.ucsc.edu/). A total number of 7 members of the SIRT family are included in the database. Patients who had PTC as the only malignancy or the first of multiple malignancies and received surgical therapy were included. Other inclusion criteria were: patients with no pre-treatment, with sufficient description of primary tumors and intact recurrence-free survival (RFS)/overall survival (OS) information. Follow-up was completed on December 21, 2014. The patients were excluded if with: insufficient data or unknown clinicopathologic profile, undetermined histology, other types of thyroid cancer (follicular thyroid cancer, medullary thyroid cancer and anaplastic thyroid cancer), or secondary tumor. The following variables were used for the analysis: gender, age at diagnosis, maximal tumor size, bilateral lesions, multifocal lesions, and lymph node status. Patients were staged using the latest 7th AJCC TNM staging system according to the final pathology reports. The primary tumor and nodal status were assessed in (or by) the final pathology. Demographic and clinicopathological characteristics of enrolled patients were obtained from electronic records and summarized in Table I.

X-tile software (version 3.6.1, Yale University School of Medicine, Newhaven, CT, USA) was used to divide the TCGA cohort according to SIRT6 expression into 3 subsets: low, middle and high. X-tile plots were generated for assessment of SIRT6 expression and RFS, optimization of cut-points and correction by the use of minimum p statistics.

Microarray data discussed in this study have been deposited in the Gene Expression Omnibus (GEO) of U.S. National Center for Biotechnology Information (NCBI; Bethesda, MD, USA; http://www.ncbi.nlm.nih.gov/geo). The results of the microarray experiment are accessible through GEO series accession number GSE33630.

We hybridized 45 PTC tissues and the corresponding para tumor tissues onto Affymetrix U133 Plus 2.0 arrays. Paired RNA samples of PTCs and non-tumor thyroid tissues were obtained from Ukraine via the Chernobyl Tissue Bank (www.chernobyltissuebank.com). Diagnoses were confirmed by the members of the International Pathology Panel of the Chernobyl Tissue Bank.

IHC staining was carried out according to the manufacturer's instruction. Briefly, formalin-fixed and paraffin-embedded tissue sections were deparaffinized in xylene and hydrated with decreasing concentrations of ethanol (100, 95, 80 and 75%). The slices were then soaked in 10% BSA to inhibit endogenous peroxidase activity and incubated with SIRT6 rabbit polyclonal antibody (working dilution 1:50; Proteintech Group Inc., Chicago, IL, USA) at 4°C overnight. A horseradish peroxidase-conjugated rabbit secondary antibody was added for 60 min at room temperature; then, 3,3′-diaminobenzidine (DAB) development (DAB Substrate Chromogen System; Dako, Glostrup, Denmark) and hematoxylin staining were performed according to standard protocols. Slides were fixed and images were obtained through an Olympus IX71 inverted microscope with a DP2-BSW Olympus image acquisition software system. The sections were read separately by two experienced pathologists blinded to the clinicopathologic data. The sections were scored on the basis of the extent of staining (0, no staining; 1, ≤10%; 2, 10–50%; and 3, >50%) and the staining intensity (0, negative; 1, weak; 2, moderate; and 3, strong). These scores were multiplied to calculate an immunoreactivity score (IS) for each case.

Two human PTC cell lines (TPC-1 and K1) were used in this study. TPC-1 cell line was kindly provided by Professor Haixia Guan from China Medical University (Shenyang, China). K1 cell line was purchased from University of Colorado Cancer Center Cell Bank. All cells were cultured in RPMI-1640 medium supplemented with 10% FBS (Invitrogen, Carlsbad, CA, USA) at 37°C with 5% CO₂.

Two separate sequences (GCAGTCTTCCAGTGTGGTGTT and GCTGGGTAC ATCGCTGCAGAT) of shRNA targeting SIRT6 gene were designed and cloned into a pLKO.1 TRC (Addgene plasmid 10878) cloning vector. Scramble RNA (Addgene plasmid 1864) was used as control vector. Knockdown of SIRT6 in TPC-1 and K1 cells was accomplished by lentiviral infection. All these plasmids were transfected into PTC cells using Lipofectamine^® 2000 under the instruction of the product manual (Invitrogen). The knockout of SIRT6 was confirmed by western blotting.

Total RNA was extracted from 130 pairs of surgically treated, pathologically diagnosed PTC tissues and cultured PTC cells using TRIzol Reagent (Invitrogen). cDNA was then obtained through reverse transcription using 1 µg of total RNA with a PrimeScript™ RT reagent kit (Takara Bio, Inc., Otsu, Japan). The SIRT6 expression status was assessed by Real-time PCR, which was carried out in triplicate by a SYBR Premix Ex Taq™ kit (Takara Bio) and ABI 7900HT Real-Time PCR system (Applied Biosystems Life Technologies, Foster City, CA, USA). The SIRT6 primers used in qPCR are as follows: Forward: 5′-ACTCGCCGATGAGGCCAGCAGGAA-3′; reverse: 5′-ATGCGGAGGTCAGCATGGCGGTCGT-3′. β-actin was used as an internal control for mRNA assays. The comparative cycle threshold values (2^−ΔΔCt) were adopted to analyze the final results.

TPC-1 and K1 cells were digested and were seeded at 200 cells per well in a 6-well plate. After incubation for 5 days, colonies were fixed in methanol and stained with 0.1% crystal violet solution for 30 min. The cells were then washed three times with PBS and clones were counted under an inverted microscope. Clones were defined as colonies of ≥50 cells. Three different fields were counted for each cell culture and the average was calculated.

PTC cell proliferation was determined using the ATPLite luminescent assay (PerkinElmer, Inc., Waltham, MA, USA) according to the manufacturer's instructions. Cells were incubated in 96-well plates for 120 h before testing.

Cell lysates were obtained from 1×10⁶ cells with RIPA lysis buffer (containing 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% SDS, 1 mM EDTA, 1% Triton X-100, 1 mM PMSF, and 1 mM Protease Inhibitor Cocktail). Approximately 20 µg protein was extracted from each sample and separated by 10% SDS-PAGE gels. Proteins were then transferred to nitrocellulose membranes (0.45 mm; Solarbio, Beijing, China). After blocking the membrane with 5% non-fat milk, it was immunoblotted with primary antibodies: SIRT6 rabbit polyclonal antibody (Proteintech Group Inc.) and GAPDH (1:5,000; Abcam, Cambridge, MA, USA). The bands were visualized with 1-step™ NBT/BCIP reagents (Thermo Fisher Scientific, Rockford, IL, USA) and developed by Alpha Imager (Alpha Innotech, San Leandro, CA, USA).

Cell migration and invasion were analyzed by a transwell plate (24-well insert, 8 µm pore size; BD Biosciences, Bedford, MA, USA). The filters (Corning Inc., Acton, MA, USA) were coated with (invasion) or without (migration) 40 µl Matrigel (1:8 dilution; BD Biosciences). SIRT6-silenced TPC-1 and SIRT6-silenced K1 cells were used in these assays. For migration assays, 3×10⁴ cells were suspended in 100 µl serum-free medium and seeded into the Matrigel-uncoated upper chambers. A total of 600 µl of medium containing 10% serum was added to the lower chamber as a chemoattractant. After incubation at 37°C for 72 h, non-invading cells were wiped off the upper surface with a cotton swab. The membranes were fixed with 4% formaldehyde for 20 min and stained with 0.1% crystal violet at room temperature. For invasion assays, 1×10⁵ cells were used with an incubation time of 48 h. The rest of the protocol was identical to that described above. The cells were counted and photographed under an inverted microscope over 10 different fields of each triplicate filter.

To evaluate the effect of silenced SIRT6 on PTC cell cycle progression, cell cycle distribution was detected by flow cytometry in TPC-1 and K1 cells after lentivirus transduction. Briefly, 1.0×10⁶ cells of each sample were harvested, fixed in 70% ethanol, and stored at 4°C overnight. Cells were then stained with NaCl/Pi staining solution (50 µg/ml PI and 100 µg/ml RNase A) for 1 h in the dark at room temperature followed by flow cytometry (FACSCalibur; BD Biosciences, San Jose, CA, USA) analysis. The fractions of the cells in G1, S, and G2/phases were calculated with dedicated software (BD Biosciences).

All statistical analysis was performed using SPSS software (version 19.0, IBM Corp., Armonk, NY, USA). Independent t-tests (for continuous variables) and Pearson's χ² tests (for categorical variables) were used. Continuous variables were categorized using certain cut-offs. The age of 45 was used as the cut-off point to divide all patients into two groups: younger patients (≤45 years old) and older patients (>45 years old). The odds ratio (OR) for relationships between clinicopathological factors, SIRT gene expression and regional node metastasis were calculated using binary logistic regression. For the survival analysis, patients who were alive and did not relapse were censored at the date of their last follow-up visit. Neck or distant RFS was defined as the time between the date of initial surgery and the first adverse event or death. OS was defined as the time between the date of initial surgery and death (all causes or cancer-specific). Survival rates were estimated by the Kaplan-Meier method. The hazard ratio (HR) for relationships between each variable and recurrence were calculated using binary Cox regression model. P<0.05 was considered to indicate a statistically significant difference.

We identified 391 eligible patients with PTC in TCGA cohort. There were 108 (27.6%) males and 283 (72.4%) females. The mean age was 47.0 years (range from 15 to 89 years). Of these patients, 275 (70.3%) had been confirmed as classical/usual papillary variant histologically, while follicular and tall cell variants were found in 85 (21.8%) and 31 (7.9%) patients, respectively. Combined with the size and extrathyroidal-extensional status of primary tumor, 105 cases (26.9%) were classified as T1 stage, 139 (35.5%) were T2 stage, 129 (33.0%) were T3 stage, and only 18 (1.6%) were T4 stage. According to the pathology, 174 (44.5%) patients had lymph node metastasis involving either the central compartment (N1a) or both central and lateral compartment (N1b). Using the latest 7^th AJCC TNM staging system, there were 220 patients (56.3%) with PTC stage I, 43 (11.0%) with stage II, 86 (22.0%) with stage III, and 42 (10.7%) with stage IV. The other clinicopathological characteristics, such as first degree relative history, the primary tumor focus, the coexistent Hashimoto's thyroiditis, and the surgical completeness (residual tumor) of all patients are summarized in Table I.

The median follow-up duration was 574 days (range 1–4,780 months). During this time, 9 patients (2.3%) died from a specific cancer cause. Disease recurrence occurred in 26 patients (6.6%), including neck and distant recurrence. The OS rates were 92.0% at 1,854 days (approximately 5 years) and 88.0% at 2,973 days (approximately 8 years) in this cohort. On the other hand, the RFS rates were 86.1% at 1,785 days (approximately 5 years) and 83.9% at 2,093 days (approximately 6 years) in this cohort.

The Pearson's χ² tests was used to analyze the influences of clinicopathologic variables and genes expression on regional node metastasis. The results showed that the risk of nodal metastasis was significantly increased by classical papillary variant (compared to follicular or tall cell variant), advanced T stage, and higher expression of SIRT6. Instead of limiting the multivariate analysis to the significant terms from the univariate analysis, we included all variables because these factors had been previously demonstrated to be important in predicting disease recurrence in adult PTC patients. The results are presented in Table II. The risk of nodal metastasis still increased with the independent variables identified by univariate analysis. In particular, the expressions of SIRT6 [OR=1.794, 95% confidence interval (CI): 1.256–1.920, p=0.012] was an independent biomarker predictor of nodal metastasis (Table II).

The Kaplan-Meier method and log-rank test showed that higher expression of SIRT6 was an independent predictor for disease recurrence, while none of the clinicopathological characteristics was significantly associated (Table III). However, multivariate analysis after adjustment for all the potential prognostic factors demonstrated that the expression of SIRT6 (HR=1.466, 95% CI: 1.195–1.913, p=0.086) lacked significance as an independent predictor of RFS (Table III).

To further explore the relationship between SIRT6 expression and RFS, we used X-tile software to calculate the cutoff values on TCGA cohort. According to their SIRT6 expression, we divided the cohort into three subpopulations: low, middle and high. X-tile plots were generated accordingly and the maximum of χ² log-rank values was produced (Fig. 1). The low-middle cut-point was −0.4 and the middle-high cut-point was 1.3, individually. The three subsets displayed a significant difference on Kaplan-Meier plot, which showed that the patients with the highest expression of SIRT6 had the worst RFS and those who possessed lowest expression of the gene had the best RFS.

Microarray data (GSE33630) was used to evaluate SIRT6 gene expression in PTC. A total number of 45 pairs of PTC tissues and their corresponding para-tumor tissues were analyzed. The expression of SIRT6 was significantly higher in tumor compared to non-tumor tissues (p=0.029; Fig. 2A). IHC was also adapted to analyze the protein level of SIRT6 expression and subcellular localization. As is shown in Fig. 2B, SIRT6 was expressed in the nuclei of cells and was higher in PTC tumor tissues.

Tissues from 130 patients who were surgically treated and pathologically diagnosed as PTC were obtained to verify SIRT6 expression. The upregulation of SIRT6 was observed in tumor tissues at both mRNA (p=0.011; Fig. 2C) and protein levels (Fig. 2D).

To investigate the role of SIRT6 on PTC cell proliferation, we generated SIRT6-silenced TPC-1 and SIRT6-silenced K1 cells. The two shRNAs against SIRT6 decreased gene expression in PTC cells, which was confirmed by qRT-PCR (Fig. 3A) and western blotting (Fig. 3B). Colony formation assay showed that silencing of SIRT6 resulted in significant decrease of cloning capacity of PTC cells in vitro (Fig. 3C). Cell viability test was then performed by using ATPlite luminescence assay, which displayed that the ATP-lite unit of each experiment group (siSIRT6-1 and siSIRT6-2) was lower than the control group in both cell lines (Fig. 3D). Combined, these results demonstrated that SIRT6 may promote the proliferation in TPC-1 and K1 cells.

Transwell assays were performed on SIRT6-silenced TPC-1 and SIRT6-silenced K1 cells to determine the influence of silenced SIRT6 on PTC cell migration and invasion, respectively. The migration assays showed a significant decrease in the number of migrated cells in both cell lines (Fig. 4A). Similarly, the invasion assays also revealed a huge decrease of cells invaded in K1 and TPC-1 cell (Fig. 4B). These results pointed out that SIRT6 stimulated cell migration and invasion in vitro.

To further investigate whether silenced SIRT6 alters PTC cell cycle distribution, flow cytometry analysis was conducted in TPC-1 and K1 cells. Results unveiled that SIRT6-1 silenced K1 cells possessed a significant increase in the proportion of cells in G1 phase compared to the control group. However, there was only slightly elevated number of cells in G1 phase of SIRT6-2 silenced K1 cells. As for TPC-1 cells, the proportion of cells in G1 phase decreased in both SIRT6-1 and SIRT6-2 silenced TPC-1 cells (Fig. 5). The inconsistency in the outcome indicated that SIRT6 had a rather complicated role in regulating cell cycle distribution.

Western blot analysis was performed to determine if SIRT6 is involved in BRAF/ERK/Mcl-1 signaling pathway. Apoptosis related proteins including NF-κB and C-PARP were also tested. The protein expression of SIRT6, NF-κB, C-PARP, phosphorylated ERK and Mcl-1 were analyzed in control and SIRT6-silenced K1 cells, separately. Silencing SIRT6 was accompanied by downregulation of phosphorylated ERK and the apoptosis associated protein Mcl-1, while the expression of NF-κB and C-PARP were enhanced (Fig. 6).