IJO International Journal of Oncology 1019-6439 1791-2423 D.A. Spandidos 10.3892/ijo.2018.4301 ijo-52-05-1539 Articles Frequent downregulation of LRRC26 by epigenetic alterations is involved in the malignant progression of triple-negative breast cancer MiyagawaYoshimasa12* MatsushitaYosuke1* SuzukiHiromu3 KomatsuMasato1 YoshimaruTetsuro1 KimuraRyuichiro1 YanaiAyako12 HondaJunko4 TangokuAkira5 SasaMitsunori6 MiyoshiYasuo2 KatagiriToyomasa1 Division of Genome Medicine, Institute for Genome Research, Tokushima University, Tokushima 770-8503 Department of Surgery, Division of Breast and Endocrine Surgery, Hyogo College of Medicine, Nishinomiya, Hyogo 663-8501 Department of Molecular Biology, Sapporo Medical University, Sapporo, Hokkaido 060-8556 Department of Surgery, National Hospital Organization Higashitokushima Medical Center, Tokushima 779-0193 Department of Thoracic and Endocrine Surgery and Oncology, Institute of Health Biosciences, The University of Tokushima Graduate School, Tokushima 770-8503 Department of Surgery, Tokushima Breast Care Clinic, Tokushima 770-0052, Japan Correspondence to: Dr Toyomasa Katagiri, Division of Genome Medicine, Institute for Genome Research, Tokushima University, 3-18-15 Kuramoto-cho, Tokushima 770-8503, Japan, E-mail: tkatagi@genome.tokushima-u.ac.jp

Contributed equally

 05 2018 05 03 2018 52 5 1539 1558 13 09 2017 21 02 2018 Copyright © 2018, Spandidos Publications 2018

Triple-negative breast cancer (TNBC), defined as breast cancer lacking estrogen- and progesterone-receptor expression and human epidermal growth factor receptor 2 (HER2) amplification, is a heterogeneous disease. RNA-sequencing analysis of 15 TNBC specimens and The Cancer Genome Atlas-TNBC dataset analysis identified the frequent downregulation of leucine-rich repeat-containing 26 (LRRC26), which negatively regulates nuclear factor-κB (NF-κB) signaling, in TNBC tissues. Quantitative polymerase chain reaction and bisulfite pyrosequencing analyses revealed that LRRC26 was frequently silenced in TNBC tissues and cell lines as a result of promoter methylation. LRRC26 expression was restored by 5-aza-2′-deoxycytidine (5′-aza-dC) treatment in HCC1937 TNBC cells, which lack LRRC26 expression. Notably, small interfering RNA-mediated knockdown of LRRC26 expression significantly enhanced the anchorage-independent growth, invasion and migration of HCC70 cells, whereas ectopic overexpression of LRRC26 in BT20 cells suppressed their invasion and migration. Conversely, neither knockdown nor overexpression of LRRC26 had an effect on cell viability in the absence of tumor necrosis factor-α (TNF-α) stimulation. Meanwhile, overexpression of LRRC26 caused the reduction of TNF-α-mediated NF-κB luciferase reporter activity, whereas depleting LRRC26 expression resulted in the upregulation of TNF-α-mediated NF-κB downstream genes [interleukin-6 (IL-6), IL-8 and C-X-C motif chemokine ligand-1]. Taken together, these findings demonstrate that LRRC26 is frequently downregulated in TNBC due to DNA methylation and that it suppresses the TNF-α-independent anchorage-independent growth, invasion and migration of TNBC cells. Loss of LRRC26 function may be a critical event in the aggressiveness of TNBC cells through a TNF-α/NF-κB-independent mechanism.

 LRRC26 triple-negative breast cancer tumor suppressor hypermethylation Introduction

Triple-negative breast cancer (TNBC), defined as a clinical breast cancer subtype that is negative for estrogen receptor (ER) and progesterone receptor (PgR) expression and human epidermal growth factor receptor 2 (HER2) gene amplification, accounts for 15% of all invasive breast cancer cases. TNBC comprises a heterogeneous group of tumors with different histological and molecular characteristics. Clinically, as TNBC patients do not benefit from endocrine therapies (selective estrogen receptor modulators, selective estrogen receptor downregulators and aromatase inhibitors) (1–3) or anti-HER2 drugs (trastuzumab, lapatinib, pertuzumab and trastuzumab emtansine) (4) due to a lack of targeted therapeutic receptors (5,6), these therapies are not recommended in National Comprehensive Cancer Network guidelines (7). Therefore, chemotherapy using conventional cytotoxic agents, including anthracyclines, cyclophosphamides, taxanes, platinum agents and eribulin (8,9), is currently the mainstay of systemic treatment, although patients with TNBC have worse outcomes following chemotherapy than patients with breast cancer of other subtypes, including hormone receptor-positive and HER2-positive breast cancer (5,6,10). Thus, since there is no optimized standard chemotherapy protocol for TNBC, detailed subtyping of TNBC is necessary to identify more effective molecular-targeted therapies.

Current omics-based studies, such as genomics and transcriptomics, can provide data that can be used to categorize TNBC. Recent gene expression profiling-based cluster analysis using a dataset consisting of 587 TNBC cases from 21 independent datasets identified six subtypes, including two basal-like subtypes, as well as an immunomodulatory, a mesenchymal, a mesenchymal stem-like and a luminal androgen receptor subtype (11). Moreover, next generation sequencing (NGS)-based studies detected tumor protein p53 and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit α mutations in 80 and 9% of TNBC cases, respectively (12), highlighting these gene mutations as key genetic events in this subtype. Notably, additional NGS studies led to the identification of actionable molecular characteristics, including 'BRCAness', defined as a defect in homologous recombination repair due to BRCA1 DNA repair associated (BRCA1) or BRCA2 mutation, in TNBC (13,14). Recently, poly(ADP-ribose) polymerase inhibitors were shown to take advantage of synthetic lethality in targeting TNBC with BRCAness (15,16). Furthermore, the nuclear factor-κB (NF-κB) signaling pathway is constitutively activated in the basal-like subtype of breast cancer cells, ~80% of which include TNBC (17). However, the underlying causes of NF-κB signaling activation have remained poorly understood.

To characterize the molecular features of TNBC, RNA-sequencing (RNA-seq) analysis was performed in the present study and it was found that leucine-rich repeat (LRR)-containing 26 (LRRC26), a member of the LRR super-family, was frequently downregulated in patients with TNBC. LRRC26, also known as CAPC, is reported to act as a negative regulator of NF-κB activity, and to inhibit cancer cell proliferation and migration (18). However, the pathophysiological role of LRRC26 in carcinogenesis and TNBC progression, particularly the mechanisms regulating LRRC26 expression, has not yet been elucidated.

The present study aimed to characterize the molecular mechanism of LRRC26 downregulation in TNBC.

 Materials and methods Cell lines and clinical specimens

The human breast cancer cell lines, MDA-MB-231, HCC1143, BT-20, BT-549, HCC1395, HCC1937, MDA-MB-157, HCC38, HCC70, MDA-MB-468, BT-474, SK-BR-3, T-47D and ZR-75-1, were purchased from the American Type Culture Collection (Rockville, MD, USA). MCF-7 cells were obtained from the Health Science Research Resources Bank (Osaka, Japan). 293T cells and MDA-MB-453 cells were provided by the RIKEN BioResource Center (Tsukuba, Japan). KPL-3C cells were kindly provided by Dr Junichi Kurebayashi (Kawasaki Medical School, Kurashiki, Okayama, Japan) (19). Each cell line was cultured according to optimal conditions recommended by their respective depositors (Table I). No Mycoplasma contamination was detected in any of the cultures using a Mycoplasma Detection kit (Takara Bio, Inc., Otsu, Japan). A total of 26 TNBC samples and 26 normal mammary tissues were surgically resected with informed consent from patients who were treated at the Tokushima Breast Care Clinic (Tokushima, Japan), as previously described (20) (Table II). Samples were immediately embedded in TissueTek OCT compound (Sakura, Tokyo, Japan), frozen and stored at −80°C.

The present study, as well as the use of all clinical materials aforementioned, was approved by the Ethics Committee of Tokushima University (Tokushima, Japan).

 RNA-seq analysis

Total RNA was extracted from frozen tumors and adjacent normal breast tissues from the 15 out of 26 TNBC samples that could produce a large enough amount of RNA for RNA seq analysis using the Nucleospin RNA II system (Takara Bio, Inc.) according to the manufacturer's protocols. Whole-transcriptome RNAs seq analysis was performed using the SureSelect strand-specific RNA library preparation kit (Agilent Technologies, Inc., Santa Clara, CA, USA) according to the manufacturer's protocols, followed by paired-end 100-bp sequencing on an Illumina HiSeq 1500 platform (Illumina, Inc., San Diego, CA, USA). All primary sequence data files are deposited in the DNA Data Bank of Japan (accession no. JGAS00000000116; http://www.ddbj.nig.ac.jp/). Data were analyzed using CLC Biomedical Genomics Workbench version 4.0 (Qiagen GmbH, Hilden, Germany) with default parameters. Transcript abundance was calculated as transcript per million.

 Quantitative PCR (qPCR) and semi-quantitative PCR

Total RNA extracted from clinical breast cancer samples and breast cancer cell lines using the NucleoSpin RNA II system (Takara Bio, Inc.) and the poly A-RNAs of a normal human mammary gland (Clontech Laboratories, Inc., Mountainview, CA, USA) were reverse transcribed using SuperScript II (Life Technologies; Thermo Fisher Scientific, Inc., Waltham, MA, USA). qPCR analysis using the ABI PRISM 7500 Real-Time PCR system was performed with SYBR® Premix Ex Taq (both from Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were 10 min at 94°C, followed by 45 cycles of denaturation at 94°C for 15 sec, 1 min annealing and extension at 60°C, and reading of the fluorescence. Following threshold-dependent cycling, melting curve analysis was performed from 60 to 94°C. The quantitative calculation was analyzed using 2−ΔΔCq (21). Semi-quantitative PCR analysis was performed as described previously (22,23). Gene-specific primers used for qPCR and semi-quantitative PCR were as follows: LRRC26 forward, 5′-CTGCTGCTGGACCACAACC-3′ and reverse, 5′-AGAAGGCTCGCACATGCAC-3′; interleukin-6 (IL-6) forward, 5′-GGGCATTCCTTCTTCTGG-3′ and reverse, 5′-ACTGCATAGCCACTTTCCA-3′; IL-8 forward, 5′-GCAAAATTGAGGCCAAGG-3′ and reverse, 5′-GGCACAGTGGAACAAGGA-3′; and C-X-C motif chemokine ligand-1 (CXCL-1) forward, 5′-GCTCTTCCGCTCCTCTCACA-3′ and reverse, 5′-GCTTCCTCCTCCCTTCTGGT-3′. The β-actin primer sequences used as quantitative controls were as follows: Forward, 5′-ATTGCCGACAGGATGCAG-3′ and reverse, 5′-CTCAGGAGGAGCAATGATCTT-3′ for qPCR; and forward, 5′-GAGGTGATAGCATTGCTTTCG-3′ and reverse, 5′-CAAGTCAGTGTACAGGTAAGC-3′ for semi-quantitative PCR.

 Methylation analysis using bisulfite pyrosequencing and bisulfite sequencing

Genomic DNA (1 µg) extracted from clinical samples and cell lines was modified with sodium bisulfite using an EpiTect Bisulfite kit (Qiagen GmbH), subsequent to which bisulfite pyrosequencing was performed as previously described (24). The methylation ratio (%) of LRRC26 in each sample was analyzed using PyroMark Q96 software version 2.5.8 (Qiagen GmbH). For bisulfite sequencing, thermocycling conditions were 10 min at 94°C, followed by 45 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 10 min. Amplified PCR products were cloned into the pCR2.1-TOPO vector (Thermo Fisher Scientific, Inc.), and 11 clones from HCC1937, 12 clones from BT-20 and 15 clones from HCC70 were sequenced using an ABI3130x automated sequencer (Thermo Fisher Scientific, Inc.). Primer sequences and PCR product sizes are listed in Table III.

 5′-aza-dC treatment

To restore epigenetically silenced LRRC26 gene expression, HCC1937 cells were plated onto 6-well dishes at a density of 3.5×105 cells/well and treated with several concentrations (0, 1, 2.5, 5 and 10 µM) of 5′-aza-dC (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 5 days, replacing the reagent and RPMI-1640 (Sigma-Aldrich; Merck KGaA) medium every 24 h. LRRC26 gene expression following treatment with 5′-aza-dC was monitored by semi-quantitative PCR as aforementioned.

 Small interfering RNA (siRNA)-mediated gene silencing

ON-TARGETplus siRNA-SMARTpool (4 types of siRNA; catalog no. L-029447-01-0005; GE Healthcare Dharmacon, Inc., Lafayette, CO, USA) was used to knockdown LRRC26 expression in the HCC70 cells, with siRNA against enhanced green fluorescent protein (si-EGFP) used as a control. HCC70 cells were plated in 6-well dishes at 1.0×105 cells/well. Transfection of 10 nM ON-TARGETplus siRNAs was performed using Lipofectamine RNAiMax (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. Knockdown efficiency was evaluated by qPCR using the aforementioned protocol at 48, 72, 96 and 120 h post-transfection. Cell proliferation assays were performed using Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) as previously described (20). All experiments were performed in triplicate.

 Soft agar colony formation assay

Anchorage-independent growth was assessed by the soft agar assay. HCC70 cells were transfected with 10 nM ON-TARGETplus siRNAs for 36 h, and 2.5×103 cells were plated in triplicate in 5 ml RPMI-1640 medium containing 0.4% soft agarose, overlaid on 5 ml 0.72% agarose in 6-cm dishes and cultured at 37°C for 11 days. Colonies per well were counted on a Power IX71 microscope (Olympus Corporation, Tokyo, Japan).

 Migration assay

BD Falcon Cell Culture Inserts (24 wells, 8-µm pore size; BD Biosciences, Franklin Lakes, NJ, USA) were rehydrated with serum-free RPMI-1640 at 37°C in a 5% CO2 incubator for 2 h. Following rehydration, the medium was removed and 0.5 ml RPMI-1640 was added to the upper chamber, and 0.5 ml RPMI-1640 with 10% fetal bovine serum (FBS) was added to the lower chamber. RPMI/FBS medium (0.5 ml) containing 2.5×104 HCC70 cells previously transfected with siRNA for 36 h was added to each insert. The HCC70 cells in the migration chamber underwent incubation at 37°C for 48 h. Following incubation, the chamber inserts were fixed (4% paraformaldehyde for 10 min) prior to being stained with 1% Giemsa at room temperature for 2 days. The total number of migrated cells for each treatment was calculated from five random fields for each insert counted on a Power IX71 microscope (Olympus Corporation) at ×40 magnification. The number of migrated cells per well for each treatment was averaged from duplicate samples and expressed as the mean ± standard deviation.

 Invasion assay

Matrigel invasion chambers (24 wells, 8-µm pore size; Corning Inc., Corning, NY, USA) were rehydrated with serum-free RPMI at 37°C in a 5% CO2 incubator for 2 h. Following rehydration, the medium was removed and 0.5 ml RPMI-1640 was added to the upper chamber, and 0.5 ml RPMI-1640 plus 10% FBS was added to the lower chamber. RPMI/FBS medium (0.5 ml) containing 2.5×104 HCC70 cells previously transfected with siRNA for 36 h was added to each insert. The HCC70 cells in the invasion chamber were incubated at 37°C for 48 h. Following incubation, chamber inserts were fixed with 4% paraformaldehyde for 10 min prior to being stained with 1% Giemsa at room temperature for 2 days. The total number of migrated cells for each treatment was calculated from five random fields for each insert counted on a Power IX71 microscope (Olympus Corporation) at ×40 magnification. The number of invaded cells per well for each treatment was averaged from duplicate samples and expressed as the mean ± standard deviation.

 Construction of expression vectors

pCAGGSSnHC and pCAGGSn3FC, in which an HA-tag and a 3xFLAG-tag, respectively, are inserted in the C-terminus of the cloning sites of pCAGGS vector, were constructed and gifted by Dr Yusuke Nakamura (University of Tokyo, Tokyo, Japan). Briefly, to construct the LRRC26 and B cell receptor associated protein 31 (BAP31) expression vectors, the entire coding sequences of LRRC26 and BAP31 cDNAs were amplified by PCR using KOD-Plus DNA polymerase (Toyobo, Osaka, Japan) with the following primers: LRRC26 forward, 5′-GGAATTCATGCGGGGCCCTTCCTGGTCG-3′ and reverse, 5′-CCGCTCGAGGGCTTGGGCGGCAGCGGCGG-3′; and BAP31 forward, 5′-CGGAATTCACCATGGGTGCCGAGGCGTC CTC-3′ and reverse, 5′-CCGCTCGAGCTCTTCCTTCTTGTCCATGGGAC-3′ (bold indicates the restriction enzyme sites). The thermocycling conditions were as follows: For LRRC26, an initial denaturation of 2 min at 94°C, followed by 35 cycles of denaturation at 94°C for 15 sec, annealing at 62°C for 30 sec and elongation at 68°C for 80 sec; for BAP31, an initial denaturation of 2 min at 94°C, followed by 30 cycles of denaturation at 94°C for 15 sec, annealing at 52°C for 30 sec and elongation at 68°C for 1 min. BAP31 is an a transmembrane protein associated with the endoplasmic reticulum (ER) and ER-Golgi intermediates, and has been involved in apoptosis and protein trafficking (25,26). Each PCR product was inserted into the EcoRI and XhoI sites of pCAGGSnHA in frame with the C-terminal HA-tag (pCAGGSSnHC-LRRC26) and pCAGGSn3FC in frame with the C-terminal FLAG-tag (pCAGGSSn3FC-BAP31), respectively. To construct the pGL3-NF-κB expression vector for the luciferase reporter assay as described next, the oligonucleotides for NF-κB-U (5′-CTGGGGACTTTCCGCTGGGGACTTTCCGCTGGGGACTTTCCGCTGGGGACTTTCCGCTATATAC-3′) and NF-κB-L (5′-TCGAGTATATAGCGGAAAGTCCCCAGCGGAAAGTCCCCAGCGGAAAGTCCCCAGCGGAAAGTCCCCAGGTAC-3′) (bold font indicates restriction enzyme sites and underlining indicates 4× NF-κB binding sites) was annealed, and cloned into the KpnI and XhoI sites of pGL3-basic (Promega Corporation, Madison, WI, USA). The DNA sequence of all constructs were confirmed by DNA sequencing (ABI3500xL; Thermo Fisher Scientific, Inc.).

 Luciferase reporter assay

293T cells (2.0×105 cells/well in 6-well plates) were co-transfected with 200 ng pGL3-NF-κB in combination with 1.0 µg pCAGGSnHC-LRRC26 or the mock vector using Fugene 6 (Promega Corporation). pRL-TK (Promega Corporation) was used as an internal control. After 24 h, the cells were treated with TNF-α (40 ng/ml; Sigma-Aldrich; Merck KGaA) for 0, 4, 8 and 12 h. Next, the cells were harvested and analyzed for Firefly luciferase and Renilla luciferase activity using the PicaGene Dual Sea Pansy Luminescence kit (Wako Pure Chemical Industries, Ltd., Osaka, Japan) according to the manufacturer's protocols. Data are expressed as the fold increase over mock-transfected cells (set at 1.0) and represented as the mean ± standard error of two independent experiments.

 Analysis of public database of RNA expression and methylation in breast cancer

Publicly available gene expression and methylation data from The Cancer Genome Atlas (TCGA; http://cancergenome.nih.gov/) were downloaded. Differential expression (by fold-change value) between breast cancer and the adjacent normal breast tissues was calculated according to the normalized gene expression value of each sample.

 Microarray analysis

HCC70 cells were seeded at a density of 2×105 cells/well onto 6-well plates, followed by transfection with 10 nM siEGFP (Sigma-Aldrich; Merck KGaA) or siLRRC26 (GE Heathcare Dharmacon, Inc.) using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. After 48 and 72 h of siRNA transfection, total RNA was extracted using a NucleoSpin RNA kit (Takara Bio, Inc.) according to the manufacturer's protocols. A total of 100 ng total RNA from each sample was amplified and Cy3-labeled. Next, 0.825 µg Cy3-labeled cRNA was fragmented, hybridized onto the Agilent SurePrint G3 Hmn GE 8×60K Ver 2.0 platform (Agilent Technologies, Inc.) and then incubated with rotation at 65°C for 17 h. Data were analyzed using GeneSpring software version 13.0 (Agilent Technologies, Inc.) as previously described (20). To identify genes that were significantly altered between siLRRC26-treated cells and siEGFP-treated cells, the mean signal intensity values in each analysis were compared. The extent and direction of the differential expression between 48 and 72 h were determined by calculating the fold-change value. Data from this microarray analysis have been submitted to the NCBI Gene Expression Omnibus archive as series GSE90582.

 Functional gene annotation clustering

The Database for Annotation, Visualization and Integrated Discovery (DAVID 6.8) was approved to detect functional gene annotation clusters based on gene expression profiling by gene annotation enrichment analysis (http://david.abcc.ncifcrf.gov/) (27,28). The clusters from the gene annotation enrichment analysis were selected in this study based on a previous study (29).

 Scratch wound cell migration and invasion assays by IncuCyte

BT20 cells (2.0×105 cells/well in 6-well plates) were transfected with 2.0 µg pCAGGSnHC-LRRC26 or the mock vector. For migration assay, after 48 h, cells (2.5×104 cells/well) were re-seeded onto the 96-well ImageLock™ plate (Essen BioScience, Ann Arbor, MI, USA), which was coated with Matrigel (100 µg/ml) prior to seeding the cells. After 4 h, the wound area was created in the cell monolayer with a 96-well WoundMaker™ (Essen BioScience). The plate was washed with phosphate-buffered saline (PBS) (−) to remove detached cells, and 100 µl fresh medium was added. For the invasion assay, the cells were covered with 50 µl Matrigel solution (8 mg/ml) and incubated for 30 min. Next, 100 µl of additional culture media was added to each well and the plates were placed into the IncuCyte ZOOM (Essen Bioscience). The two plate types were scanned every 2 h for 72 h. Data were analyzed using ZOOM software version 2016B (Essen BioScience) according to the manufacturer's protocols. Cell migration and invasion were expressed as relative wound density.

 Immunocytochemical staining analysis

To examine the subcellular localization of the LRRC26 protein in TNBC cells, BT20 cells (2.0×105 cells/well in 6-well plates) were transfected with 2.0 µg pCAGGSnHC-LRRC26 or the mock vector using FuGENE HD transfection regent (Roche Diagnostics GmbH, Mannheim, Germany). In addition, BT-20 cells were co-transfected with 2.0 µg pCAGGSnHC-LRRC26 and pCAGGSn3FC-BAP31 or the empty vector (Mock). At 48 h post-transfection, BT-20 cells (2.0×104 cells/well) were plated onto an 8-well glass slide chamber (Thermo Fisher Scientific, Inc.). After 24 h of incubation, the cells were fixed with 4% paraformaldehyde for 30 min at 4°C and then peameabilized with 0.1% Triton X-100 for 2 min at room temperature. Next, the cells were covered with 3% bovine serum albumin for 1 h at room temperature and then incubated with anti-HA antibody (1:1,000 dilution; cat. no. 1867423; Roche Diagnostics GmbH) and anti-FLAG M2 (1:1,000 dilution; cat. no. F-3165; Sigma-Aldrich; Merck KGaA) or anti-78-kDa glucose-regulated protein (GRP78; 1:200 dilution; cat. no. ab108615; Abcam, Cambridge, UK) antibodies overnight at 4°C. Subsequent to washing with PBS (−), the cells were stained with Alexa 488-conjugated anti-rat (cat. no. A-21210) and Alexa 594-conjugated anti-mouse (cat. no. A-11032) or anti-rabbit (cat. no. A-11037) antibodies (1:1,000 dilution; Molecular Probes; Thermo Fisher Scientific, Inc.) at room temperature for 1 h, respectively. The nuclei were stained with 4′,6′-diamidine-2′-phenylindole dihydrochloride. Fluorescence was observed was obtained using an IX71 microscope (Olympus Corporation). Scale bars indicate 20 µm.

 Immunoblotting analyses

Immunoblotting analyses were conducted as previously described (30). Briefly, cell lysates were prepared with lysis buffer at 48 h post-transfection. The lysates were electrophoresed, transferred to a nitrocellulose membrane and blocked with 4% BlockAce solution (Dainippon Sumimoto Pharma Co., Ltd., Osaka, Japan) for 1 h. Subsequently, the membrane were incubated with anti-HA (1:3,000 dilution; cat. no. 1867423) and anti-α/β-Tubulin antibodies (1:1,000 dilution; cat. no. 2148) (Cell Signaling Technology, Inc., Danvers, MA, USA) at 4°C overnight, respectively. Following incubation with a horseradish peroxidase-conjugated secondary antibody (1:5,000 dilution; catalog no. sc-2006 for anti-rat antibody; catalog no. sc-2004 for anti-rabbit antibody; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) at room temperature for 1 h, the membranes were developed with an enhanced chemiluminescence system (GE Healthcare Life Sciences, Little Chalfont, UK) and were scanned using an Image Reader LAS-3000 mini (Fujifilm, Tokyo, Japan).

 Statistical analysis

Statistical significance was calculated using the Kruskal-Wallis test and Dunnett's post-hoc test with SPSS version 20.0 software (IBM, Armonk, NY, USA) for the comparison between the gene expression and methylation levels from the TCGA dataset. For multiple comparisons of Figs. 1D and 2B, a one-way analysis of variance with Dunnett's and Tukey's post hoc tests, respectively, were performed. Wilcoxon signed rank test was performed using JMP 12.1.0 (SAS Institute Japan, Ltd., Tokyo, Japan) to assess methylation levels between tumor and paired normal tissues. The χ2 test was performed using Microsoft® Excel 2016 to assess the associations between the expression of the LRRC26 gene and patient characteristics. Student's two-sided t-test was performed using Microsoft® Excel 2016 to calculate statistical significance in experiments for the gene expression, methylation status, colony formation, migration, invasion and luciferase activity. P<0.05 was considered to indicate a statistically significant difference.

 Results LRRC26 is specifically downregulated in TNBC clinical specimens and cell lines due to methylation of CpG islands

To characterize the molecular features of TNBC, RNA-seq analysis was first performed and it was found that LRRC26 expression was downregulated in 10 out of 15 patients with TNBC, but upregulated in 4 (no regulation change in 1 patient) (Fig. 1A). Subsequent qPCR confirmed that LRRC26 was significantly downregulated in 16 out of the 26 patients with TNBC (6 of the 15 patients who also underwent RNA-Seq) compared with that in paired normal breast tissues (Fig. 1B), which was consistent with the RNA-seq results. Subsequently, statistical analysis of the association between LRRC26 expression level and clinicopathological features, including the tumor stage or grade of TNBC cases used for qPCR, was performed, and it was found that LRRC26 downregulation was significantly associated with increased histοlogical grade in patients with TNBC (P=0.017; χ2 test) (Table IV). Furthermore, the expression of the LRRC26 gene was examined by the analysis of TCGA dataset, including a much larger number of TNBC cases and normal controls, and it was found that the LRRC26 gene was significantly downregulated in 123 TNBC cases compared with that in 113 normal controls (Fig. 1C). These results suggested the possibility that the downregulation of LRRC26 may be associated with the carcinogenesis of TNBC. Accordingly, the present study focused on understanding the mechanism of LRRC26 downregulation in TNBC, although further analysis of the mechanism of LRRC26 upregulation in breast cancer will be necessary. Next, to determine whether LRRC26 downregulation is associated with CpG hypermethylation in its promoter region, bisulfite pyrosequencing analysis was performed using a set of 12 TNBC clinical tissues and adjacent normal breast tissues. LRRC26 methylation levels were quantitatively measured at two CpG islands containing 'Seq.1' and 'Seq.2′, located 206 and 158 bp upstream of the transcription start site, respectively (Fig. 1D). The average methylation levels of 'Seq.1' in the tumor and normal tissues was 43.63% (range, 18.37–62.89%) and 26.55% (range, 18.47–40.09%), respectively, and that of 'Seq.2′ in the tumor and normal tissues was 18.79% (range, 8.52–23.15%) and 11.63% (range, 8.86–15.32%), respectively (Fig. 1D). Accordingly, the methylation levels of the two CpG islands were significantly higher in 11 out of 12 tumor tissues compared with those in adjacent normal mammary gland tissues (Fig. 1D; Wilcoxon signed-rank test: Seq.1, P=0.0015 and Seq.2, P=0.0024, respectively) (Fig. 1D). To further validate this result, LRRC26 expression levels were analyzed in breast cancer cell lines by qPCR. LRRC26 expression was significantly downregulated in 8 out of 10 TNBC cell lines compared with that in normal mammary glands (Fig. 1E), whereas its expression level was extremely high in all HER2-positive and ER-positive/HER2-negative cell lines (Fig. 1E). Furthermore, LRRC26 methylation status was analyzed in TNBC cell lines, and it was observed that high levels of methylation at the two CpG island sites in LRRC26 were in agreement with LRRC26 expression levels in 4 out of 6 TNBC cell lines (Fig. 1E and F). Low levels of methylation at the two CpG island sites were in agreement with high levels of LRRC26 expression in the two HER2-positive cell lines, BT-474 and MDA-MB453. Of the remaining TNBC cell lines, LRRC26 was expressed in HCC70, whereas high DNA methylation levels (>60%) were detected at Seq.1 and low levels at Seq.2. Conversely, LRRC26 was downregulated in MDA-MB-231, which displayed high DNA methylation levels at Seq.1 and moderate levels at Seq.2 (Fig. 1E and F). These results indicated that a different mechanism, such as histone modification or the existence of other critical CpG sites in the LRRC26 promoter region, may underlie LRRC26 silencing in these cells.

 LRRC26 downregulation and hypermethylation occur exclusively in TNBC

To clarify the detailed methylation status, bisulfite sequencing was performed using TNBC cell lines HCC1937, BT20 and HCC70. It was found that the 200 bp upstream of the transcription initiation site, including Seq.1 and Seq.2 CpG islands, in LRRC26 were densely methylated in HCC1937, but not in HCC70, although the Seq.1 CpG island was methylated (Fig. 2A). Moreover, the same regions in LRRC26 were partially methylated in BT20, indicating that the methylation levels at the LRRC26 promoter region were in agreement with the level of LRRC26 expression in all three cell lines. Notably, LRRC26 expression was restored in a dose-dependent manner following treatment with 5′-aza-dC in HCC1937 (Fig. 2B). Moreover, the methylation level of LRRC26 was also significantly reduced in HCC1937 cells following treatment with 5′-aza-dC (Fig. 2B).

Subsequently, RNA-seq analysis of 919 breast cancer cases from TCGA dataset revealed that LRRC26 gene expression in TNBC cases was significantly lower than that in other subtypes, such as ER(+)/HER2(−), ER(±)/HER2(+) (Fig. 2C), whereas LRRC26 gene methylation analysis of 625 cases on the same dataset was significantly higher in TNBC cases than in other subtypes (Fig. 2D). Furthermore, bisulfite pyrosequencing analysis was performed using a set of 12 TNBC clinical tissues and adjacent normal breast tissues to analyze the methylation level of LRRC26 at seqTCGA located 373 bp upstream of the transcriptional start site (Fig. 2E). The results showed that the methylation level of the seqTCGA CpG island was significantly higher in all tumor tissues than that in the adjacent normal mammary gland tissues (Wilcoxon signed-rank test: P=0.002) (Fig. 2E). These data strongly suggested that low LRRC26 expression due to hypermethylation in its promoter region is exclusive to TNBC cases.

 LRRC26 as a tumor suppressor in TNBC cells

To investigate the impact of LRRC26 on cell growth in HCC70 TNBC cells, standard cell proliferation assays were performed. First, the knockdown of LRRC26 expression was confirmed in HCC70 cells, in which LRRC26 was highly expressed, as determined by qPCR (Fig. 3A), and it was found that LRRC26 silencing did not affect cell proliferation (Fig. 3A), consistent with the findings of a previous study using LNCaP prostate cancer cells (18). Next, to further assess the tumor suppressive function of LRRC26 on the development and progression of TNBC cells, soft agar colony formation, invasion and migration assays were performed to evaluate metastatic properties. Knocking down LRRC26 expression significantly increased the number of colonies in the soft agar (Fig. 3B), suggesting a critical role for LRRC26 in anchorage-independent growth. Subsequent Matrigel invasion and migration assays also revealed that siRNA-mediated depletion of LRRC26 expression led to significant facilitation of HCC70 cell invasion and migration compared with that in siEGFP-transfected cells (Fig. 3C and D). Furthermore, the effects of LRRC26 overexpression on migration, invasion and cell proliferation in BT-20 cells, which express LRRC26 at a low level, were examined. The results showed that LRRC26 overexpression led to a reduction in the migration and invasion and abilities (Fig. 3F and G) of the cells, but did not effect cell viability (Fig. 3H). Taken together, these findings strongly suggest that LRRC26 suppresses the aggressive behavior of TNBC cells.

 LRRC26 expression negatively regulates the TNF-α-induced NF-κB pathway

LRRC26 has been reported to negatively regulate NF-κB signaling in prostate cancer LNCaP cells (18). Therefore, the effect of LRRC26 on NF-κB activity was examined in the present study using a luciferase reporter assay and qPCR analysis. A significant time-dependent decrease in luciferase activity was observed in the presence of TNF-α stimulation with ectopic LRRC26 expression compared with that in the mock control vector in 293T cells (Fig. 4A). qPCR analysis showed that siRNA-mediated LRRC26-knockdown significantly increased the TNF-α-induced expression of the NF-κB target genes IL-6, IL-8 and CXCL1 in HCC70 cells (Fig. 4B). These results suggested that LRRC26 negatively regulates TNF-α-induced NF-κB activity.

 Functional gene annotation clustering analysis

To further clarify the biological role of LRRC26 in the progression or development of TNBC cells, the present study attempted to identify the processes or pathways associated with LRRC26 in TNBC cells. siLRRC26, or siEGFP as a control, was transfected into HCC70 cells, which highly express LRRC26, and alterations in gene expression were measured using DNA microarray analysis. To identify genes associated with LRRC26, genes were selected using the following criterion: Expression level was decreased or increased by >3-fold in siLRRC26-transfected cells compared with that in siEGFP-transfected cells. This approach identified 230 genes that were altered upon LRRC26-knockdown (Table V). Among them, the downregulation of olfactory receptor family 5 subfamily M member 1 (OR5M1) and OR5T1 genes, which encode members of olfactory GPCR protein, was verified in LRRC26-depleted cells, as determined by qPCR (Fig. 5A). Notably, OR5T1 protein is predicted to be N-glycosylated at Asn17, suggesting the possibility that LRRC26 downregulation may be important for ORT51 glycosylation. To further identify significantly overrepresented Gene Ontology terms affected by LRRC26 expression in HCC70 cells, these upregulated or downregulated genes were analyzed using the DAVID algorithm (27,31). The most prominent cluster (annotation cluster 1; gene enrichment score, 3.12) was identified, which contained features related to 'glycoprotein', 'signal peptide', 'secreted' and 'N-linked glycoprotein (GlcNAc)' (Table VI). Furthermore, the immunocytochemical staining experiments showed that exogenous HA-LRRC26 was found to be partially co-localized with endogenous GRP78, a molecular chaperone localized in the endoplasmic reticulum (Fig. 5B), and exogenous FLAG-tagged BAP31, an integral membrane protein of the endoplasmic reticulum, in BT20 cells (Fig. 5C), indicating the possibility that LRRC26 may function in the endoplasmic reticulum of TNBC cells. These findings suggested the possibility that LRRC26 downregulation may affect the secretory pathway from the Golgi apparatus to the cell surface or vesicle transport from the endoplasmic reticulum to the Golgi apparatus in TNBC cells.

 Discussion

Genetic and epigenetic inactivation involving DNA methylation and histone modifications of tumor suppressor genes serve a crucial role in the progression and development of breast cancer (20,32). Notably, aberrant promoter hypermethylation of tumor suppressor genes is commonly observed in breast cancer and is the predominant mechanism for loss of function. In the present study, it was demonstrated that LRRC26 downregulation contributes to the progression and development of TNBC, although further analysis of understanding of the mechanism of LRRC26 upregulation in breast cancer, particularly ER- and HER2-positive breast cancer, will be necessary. Although RNA-seq and public TCGA database analyses identified no somatic mutations of the LRRC26 mRNA in the TNBC tissues and cell lines, the frequent downregulation of LRRC26 due to promoter hypermethylation at Seq.1 and Seq.2 in TNBC tissues and cell lines was observed (Fig. 1B–E). Notably, LRRC26 was highly expressed in HCC70 cells, but not in MDA-MB-231 cells, whereas LRRC26 methylation levels at the two CpG sites were similar between HCC70 and MDA-MB-231 cells (Fig. 1D and E). This discrepancy implies the existence of other critical CpG sites in the LRRC26 promoter region that may be responsible for gene silencing. In fact, the methylation level of the seqTCGA CpG island, located 373 bp upstream of the transcriptional start site, was significantly higher in all tumor tissues compared with that in adjacent normal mammary gland tissues (Fig. 2E). By contrast, LRRC26 was also not methylated in other CpG islands within 200 bp of the transcription initiation site, particularly around the transcription initiation site of the LRRC26 gene in HCC70 cells. Notably, miRDB, an online database for miRNA target prediction (33), predicted LRRC26 as a target of hsa-miR-1275. hsa-miR-1275 is reported to be upregulated in young women (<35 years old) with breast cancer compared with that in older women (>65 and 45–65 years old) (34), as well as in MDA-MB-231 TNBC cells (35), suggesting the possibility that epigenetic and miRNA-mediated inactivation may contribute to LRRC26 downregulation.

By analyzing TCGA RNA-seq public databases in the present study, it was found that LRRC26 gene expression was significantly lower in TNBC cases than in ER-positive/HER2-negative and ER-negative/HER2-positive breast cancer cases (Fig. 2C and D), suggesting that hypermethylation-mediated LRRC26 inactivation may be a TNBC-specific event in the progression and development of cancer cells. Further statistical analysis demonstrated that LRRC26 downregulation was significantly associated with increased histological grade in patients with TNBC (P=0.017; χ2 test) (Table IV), whereas Kaplan-Meier analysis revealed no significant association between LRRC26 downregulation and the overall survival of patients with TNBC (data not shown). These findings suggested that LRRC26 downregulation may be involved in the aggressiveness of TNBC, but that in addition to LRRC26 downregulation, other factors may also be necessary to drive malignacy. Further analysis of the association between LRRC26 downregulation and prognosis using a large number of TNBC samples will also be necessary. Furthermore, LRRC26 has been reported to suppress tumor growth by negatively regulating NF-κB signaling in LNCaP and MDA-MB-231 cells (18). However, in the present study, the upregulation of NF-κB-target genes in the absence of TNF-α stimulation was not observed in LRRC26-depleted HCC70 cells (data not shown), although the upregulation of NF-κB-target genes in the presence of TNF-α stimulation was observed in these cells (Fig. 4B). These results suggest that LRRC26 downregulation may be important for TNF-α-mediated NF-κB activation in TNBC cells. Furthermore, LRRC26 expression has been reported to promote anchorage-independent growth in MDA-MB231 cells (18). The present study also found that knocking down LRRC26 increased not only anchorage-independent growth, but also invasion and migration in HCC70 cells; however, it did not promote proliferation in the absence of TNF-α stimulation, suggesting that LRRC26 downregulation is critical for the TNF-α-mediated NF-κB-independent progression of TNBC.

To investigate biological roles of LRRC26 distinct from the NF-κB pathway in TNBC cells, DNA microarray analysis was performed using siLRRC26-transfected HCC70 cells. Functional annotation clustering revealed that upregulated and downregulated genes in LRRC26-depleted HCC70 cells are functionally associated with protein secretion and N-linked glycosylation. These findings suggest the possibility that LRRC26 downregulation may affect the secretory pathway from the Golgi apparatus to the cell surface or vesicle transport from the endoplasmic reticulum to the Golgi apparatus.

LRRC26 protein, a member of the LRR superfamily, has been reported to act as a big potassium (BK) channel auxiliary subunit, whereas the regulation of NF-κB activation by LRRC26 is independent of BK channels (36). Notably, LRRC26 is also predicted to be present on the endoplasmic reticulum membrane via its N-terminal LRR domain, as LRRC26 is N-glycosylated at an Asn147 site in the endoplasmic reticulum (36). LRRC26 has been reported to localize in the endoplasmic reticulum (36). In fact, the present study demonstrated that LRRC26 was observed to be co-localized with GRP78 and BAP31 in the endoplasmic reticulum of TNBC cells (Fig. 5B and C). Moreover, N-linked glycoproteins are composed of a polypeptide glycosylated in the endoplasmic reticulum with several carbonate chains via asparagine residues, and have critical roles in cell-cell interaction and cell adhesion for invasive and metastatic behaviors in breast cancer. These results strongly suggest that LRRC26 may serve a role in breast cancer progression (37–40). However, further analyses are required to elucidate the effects of LRRC26 downregulation on N-linked glycosylation in TNBC cells.

In summary, the present study demonstrated that the methylation-mediated inactivation of LRRC26 resulted in enhancement of anchorage-independent growth-, invasion- and migration-associated metastatic behavior. Notably, frequent methylation-mediated inactivation of LRRC26 is a TNBC-specific event that may be a potential diagnostic biomarker.

 Acknowledgments

The authors would like to thank Dr Junichi Kurebayashi (Kawasaki Medical School, Kurashiki, Okayama, Japan) for gifting the KPL-3C breast cancer cell line, and Ms. Hinako Koseki and Ms. Hitomi Kawakami (Division of Genome Medicine, Institute for Genome Research, Tokushima University, Tokushima, Japan) for providing excellent technical support.

Funding

This research was supported by the Tailor-Made Medical Treatment with the BBJ Project (grant no. 13418656) and Practical Research for Innovative Cancer Control (grant no. 12103129) from the Japan Agency for Medical Research and Development.

Availability of data and materials

The assessed TCGA data set was from the TCGA portal (http://cancergenome.nih.gov/). The RNA-Seq data (accession no. JGAS00000000116) used in Fig. 1A were deposit in the DNA DataBank of Japan (http://www.ddbj.nig.ac.jp/). The microarray data (GSE90582) were submitted to the NCBI Gene Expression Omnibus archive (https://www.ncbi.nlm.nih.gov/geo/).

Authors' contributions

YMiyagawa performed all experiments, interpreted all data and prepared the draft of the manuscript. YMatsushita performed the analyses for LRRC26 expression, invasion, migration assay by Incucyte and immunocytochemical staining, interpreted all data and prepared the draft and final version of the manuscript. HS performed the methylation of LRRC26 and analyses for TCGA data sets. MK and TY provided the interpretation of LRRC26 expression and function. RK performed the analyses for the luciferase assay. AY and AT provided the interpretation of the clinical association data. JH and MS prepared the clinical specimens and provided the interpretation of the clinical association data. YMiyoshi discussed the interpretation of all data. TK was involved in the conception and design of all studies, the interpretation of the data, and the preparation of the draft and final version of the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study, as well as the use of all clinical materials aforementioned, was approved by the Ethics Committee of Tokushima University (permission no. H29-15 for expression profile analysis and permission no. H29-14 for RNA-seq analysis).

Consent for publication

Clinical specimens were obtained with informed consent from patients who were treated at the Tokushima Breast Care Clinic (Tokushima, Japan), as previously described (20), with permission to publish their data.

Competing interests

The authors declare that they have no competing interests.

 References FisherBAndersonSTan-ChiuEWolmarkNWickerhamDLFisherERDimitrovNVAtkinsJNAbramsonNMerajverSTamoxifen and chemotherapy for axillary node-negative, estrogen receptor-negative breast cancer: Findings from National Surgical Adjuvant Breast and Bowel Project B-23J Clin Oncol19931942200110.1200/JCO.2001.19.4.93111181655 ColleoniMGelberSGoldhirschAAebiSCastiglione-GertschMPriceKNCoatesASGelberRDInternational Breast Cancer Study GroupTamoxifen after adjuvant chemotherapy for premenopausal women with lymph node-positive breast cancer: International Breast Cancer Study Group Trial 13-93J Clin Oncol2413321341200610.1200/JCO.2005.03.078316505417 MerglenAVerkooijenHMFiorettaGNeyroud-CasparIVinh-HungVVlastosGChappuisPOCastiglioneMRapitiEBouchardyCHormonal therapy for oestrogen receptor-negative breast cancer is associated with higher disease-specific mortalityAnn Oncol20857861200910.1093/annonc/mdn68819150951 HusznoJNowaraECurrent therapeutic strategies of anti-HER2 treatment in advanced breast cancer patientsContemp Oncol (Pozn)20172016 FoulkesWDSmithIEReis-FilhoJSTriple-negative breast cancerN Engl J Med36319381948201010.1056/NEJMra100138921067385 LiedtkeCMazouniCHessKRAndréFTordaiAMejiaJASymmansWFGonzalez-AnguloAMHennessyBGreenMResponse to neoadjuvant therapy and long-term survival in patients with triple-negative breast cancerJ Clin Oncol2612751281200810.1200/JCO.2007.14.414718250347 GradisharWJAndersonBOBalassanianRBlairSLBursteinHJCyrAEliasADFarrarWBForeroAGiordanoSHInvasive Breast Cancer Version 1.2016, NCCN Clinical Practice Guidelines in OncologyJ Natl Compr Canc Netw14324354201610.6004/jnccn.2016.0037 CortesJO'ShaughnessyJLoeschDBlumJLVahdatLTPetrakovaKCholletPManikasADiérasVDelozierTEMBRACE (Eisai Metastatic Breast Cancer Study Assessing Physician's Choice Versus E7389) investigatorsEribulin mono-therapy versus treatment of physician's choice in patients with metastatic breast cancer (EMBRACE): A phase 3 open-label randomised studyLancet377914923201110.1016/S0140-6736(11)60070-621376385 DenkertCLiedtkeCTuttAvon MinckwitzGMolecular alterations in triple-negative breast cancer-the road to new treatment strategiesLancet38924302442201710.1016/S0140-6736(16)32454-0 KimJEAhnHJAhnJHYoonDHKimSBJungKHGongGYKimMJSonBHAhnSHImpact of triple-negative breast cancer phenotype on prognosis in patients with stage I breast cancerJ Breast Cancer15197202201210.4048/jbc.2012.15.2.197228079373395743 LehmannBDBauerJAChenXSandersMEChakravarthyABShyrYPietenpolJAIdentification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapiesJ Clin Invest12127502767201110.1172/JCI45014216331663127435 Cancer Genome Atlas NCancer Genome Atlas NetworkComprehensive molecular portraits of human breast tumoursNature4906170201210.1038/nature11412230008973465532 PereiraBChinSFRuedaOMVollanHKProvenzanoEBardwellHAPughMJonesLRussellRSammutSJThe somatic mutation profiles of 2,433 breast cancers refines their genomic and transcriptomic landscapesNat Commun711479201610.1038/ncomms11479271614914866047 ShahSPRothAGoyaROloumiAHaGZhaoYTurashviliGDingJTseKHaffariGThe clonal and mutational evolution spectrum of primary triple-negative breast cancersNature4863953992012224953143863681 O'ShaughnessyJOsborneCPippenJEYoffeMPattDRochaCKooICShermanBMBradleyCIniparib plus chemotherapy in metastatic triple-negative breast cancerN Engl J Med364205214201110.1056/NEJMoa101141821208101 TuttARobsonMGarberJEDomchekSMAudehMWWeitzelJNFriedlanderMArunBLomanNSchmutzlerRKOral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: A proof-of-concept trialLancet376235244201010.1016/S0140-6736(10)60892-620609467 YamaguchiNItoTAzumaSItoEHonmaRYanagisawaYNishikawaAKawamuraMImaiJWatanabeSConstitutive activation of nuclear factor-kappaB is preferentially involved in the proliferation of basal-like subtype breast cancer cell linesCancer Sci10016681674200910.1111/j.1349-7006.2009.01228.x19538528 LiuXFXiangLZhangYBeckerKGBeraTKPastanICAPC negatively regulates NF-κB activation and suppresses tumor growth and metastasisOncogene3116731682201210.1038/onc.2011.355 KurebayashiJKurosumiMSonooHA new human breast cancer cell line, KPL-3C, secretes parathyroid hormone-related protein and produces tumours associated with microcalcifications in nude miceBr J Cancer74200207199610.1038/bjc.1996.33886883222074563 KomatsuMYoshimaruTMatsuoTKiyotaniKMiyoshiYTanahashiTRokutanKYamaguchiRSaitoAImotoSMolecular features of triple negative breast cancer cells by genome-wide gene expression profiling analysisInt J Oncol42478506201310.3892/ijo.2012.1744 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.1262 KimJWAkiyamaMParkJHLinMLShimoAUekiTDaigoYTsunodaTNishidateTNakamuraYActivation of an estrogen/estrogen receptor signaling by BIG3 through its inhibitory effect on nuclear transport of PHB2/REA in breast cancerCancer Sci10014681478200910.1111/j.1349-7006.2009.01209.x19496786 ParkJHLinMLNishidateTNakamuraYKatagiriTPDZ-binding kinase/T-LAK cell-originated protein kinase, a putative cancer/testis antigen with an oncogenic activity in breast cancerCancer Res6691869195200610.1158/0008-5472.CAN-06-160116982762 KamimaeSYamamotoEKaiMNiinumaTYamanoHONojimaMYoshikawaKKimuraTTakagiRHaradaEEpigenetic silencing of NTSR1 is associated with lateral and noninvasive growth of colorectal tumorsOncotarget62997529990201510.18632/oncotarget.5034263345934745776 NgFWNguyenMKwanTBrantonPENicholsonDWCromlishJAShoreGCp28 Bap31, a Bcl-2/Bcl-XL- and procaspase-8-associated protein in the endoplasmic reticulumJ Cell Biol139327338199710.1083/jcb.139.2.32793343382139787 AnnaertWGBeckerBKistnerURethMJahnRExport of cellubrevin from the endoplasmic reticulum is controlled by BAP31J Cell Biol13913971410199710.1083/jcb.139.6.1397 HuangWShermanBTLempickiRASystematic and integrative analysis of large gene lists using DAVID bioinformatics resourcesNat Protoc44457200910.1038/nprot.2008.211 HuangWShermanBTLempickiRABioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene listsNucleic Acids Res37113200910.1093/nar/gkn9232615629 HaoJMChenJZSuiHMSi-MaXQLiGQLiuCLiJLDingYQLiJMA five-gene signature as a potential predictor of metastasis and survival in colorectal cancerJ Pathol220475489201020077526 YoshimaruTKomatsuMMatsuoTChenYAMurakamiYMizuguchiKMizohataEInoueTAkiyamaMYamaguchiRTargeting BIG3-PHB2 interaction to overcome tamoxifen resistance in breast cancer cellsNat Commun42443201310.1038/ncomms3443240514373791465 KajiuraKMasudaKNarutoTKohmotoTWatabnabeMTsuboiMTakizawaHKondoKTangokuAImotoIFrequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinomaOncotarget828902905201710.18632/oncotarget.137615356850 LockeWJClarkSJEpigenome remodelling in breast cancer: Insights from an early in vitro model of carcinogenesisBreast Cancer Res14215201210.1186/bcr3237231682664053120 WangXmiRDB: A microRNA target prediction and functional annotation database with a wiki interfaceRNA1410121017200810.1261/rna.965408184269182390791 Peña-ChiletMMartínezMTPérez-FidalgoJAPeiró-ChovaLOltraSSTormoEAlonso-YusteEMartinez-DelgadoBErolesPClimentJMicroRNA profile in very young women with breast cancerBMC Cancer14529201410.1186/1471-2407-14-529250470874223555 NguyenHTLiCLinZZhuangYFlemingtonEKBurowMELinYIShanBThe microRNA expression associated with morphogenesis of breast cancer cells in three-dimensional organotypic cultureOncol Rep281171262012225767993991116 YanJAldrichRWBK potassium channel modulation by leucine-rich repeat-containing proteinsProc Natl Acad Sci USA10979177922201210.1073/pnas.1205435109225478003356614 CarvalhoSOliveiraTBartelsMFMiyoshiEPierceMTaniguchiNCarneiroFSerucaRReisCAStrahlSO-mannosylation and N-glycosylation: Two coordinated mechanisms regulating the tumour suppressor functions of E-cadherin in cancerOncotarget76523165246201610.18632/oncotarget.11245275334525323151 CouldreyCGreenJEMetastases: The glycan connectionBreast Cancer Res2321323200010.1186/bcr75 Dall'OlioFMalagoliniNTrincheraMChiricoloMMechanisms of cancer-associated glycosylation changesFront Biosci (Landmark Ed)17670699201210.2741/3951 PinhoSSReisCAGlycosylation in cancer: Mechanisms and clinical implicationsNat Rev Cancer15540555201510.1038/nrc398226289314 WolffACHammondMEHicksDGDowsettMMcShaneLMAllisonKHAllredDCBartlettJMBilousMFitzgibbonsPAmerican Society of Clinical OncologyCollege of American PathologistsRecommendations for human epidermal growth factor receptor 2 testing in breast cancer: American Society of Clinical Oncology/College of American Pathologists clinical practice guideline updateJ Clin Oncol3139974013201310.1200/JCO.2013.50.998424101045 SobinLGospodarowiczMWittekindCTNM Classification of Malignant TumorsJohn Wiley & Sons, IncHoboken, NJ2010

LRRC26 expression and methylation in TNBC. (A) LRRC26 expression determined by RNA-seq analysis of 15 TNBC cases. (B) Relative LRRC26 gene expression in 26 TNBC clinical specimens and paired normal tissues by qPCR. The data represent the mean ± standard deviation of each condition (*P<0.05 and **P<0.01; two-sided Student's t-test). (C) Expression levels in 123 TNBC patients and 113 normal tissues obtained from TCGA RNA-seq datasets. The box plot shows the expression level between TNBC and normal tissue. Two-sided Student's t-test revealed a significant difference (***P<0.001 vs. normal tissues). (D) Diagram of the CpG sites of the LRRC26 gene. The two regions (Seq.1 and Seq.2) analyzed using bisulfite pyrosequencing are shown (upper panel). Bisulfite pyrosequencing analysis of two LRRC26 CpG sites (Seq.1 and Seq.2) in 12 TNBC clinical specimens and paired normal breast tissues (lower panel) (Wilcoxon signed-rank test). (E) Relative expression of LRRC26 gene in 17 breast cancer cell lines, including 10 TNBC, 3 HER2(+) and 4 ER(+) HER2(−) cell lines, compared with that in normal mammary glands, as determined by qPCR. The data represent the mean ± standard deviation of each condition (*P<0.05 and **P<0.01; analysis of variance with Dunnett's post hoc test). (F) Bisulfite pyrosequencing analysis of 2 LRRC26 CpG sites (Seq.1 and Seq.2) in indicated breast cancer cell lines. The data represent the mean ± standard deviation of each condition. TNBC, triple-negative breast cancer; TPM, transcript per million; LRRC26, leucine-rich repeat-containing 26; RNA-seq, RNA sequencing; T, clinical tumor specimens; N, normal tissue; ER, estrogen receptor; HER2, human epidermal growth factor receptor 2; qPCR, quantitative polymerase chain reaction.

LRRC26 downregulation and hypermethylation are exclusive to TNBC. (A) Bisulfite sequencing analysis of two LRRC26 CpG sites in HCC1937, BT20 and HCC70 cells. Open and filled circles represent unmethylated and methylated CpG sites, respectively. The arrow indicates the region analyzed via bisulfite pyrosequencing. (B) Bisulfite pyrosequencing (bar graph) and semi-quantitative PCR results (bottom panel) for LRRC26 in HCC1937 cells treated with varying doses of 5′-aza-dC for 120 h. Mean methylation levels (%) of LRRC26 were measured as aforementioned. The data represent the mean ± standard deviation of methylation levels of each CpG island. (**P<0.01 vs. 5′-aza-dC (0 µM) in Seq.1; ##P<0.01 vs. 5′-aza-dC (0 µM) in Seq.2; analysis of variance with Tukey's post hoc test). (C) LRRC26 gene expression in 3 subtypes [ER(+)HER2(−), ER(±)HER2(+) and TNBC) for cases with TCGA RNA-seq datasets. The Kruskal-Wallis test revealed a significant difference, followed by Dunnett's post hoc test. (D) Methylation levels in 625 breast cancer patients obtained from TCGA datasets. The box plot shows the percent methylation between three breast cancer subtypes classified by ER status and HER2 expression. The Kruskal-Wallis test revealed a significant difference, followed by Dunnett's post hoc test. (E) Bisulfite pyrosequencing analysis at CpG island SeqTCGA (the CpG island located 373 bp upstream of the transcription start site) in 12 TNBC clinical specimens and paired normal breast tissues (righ panel) (Wilcoxon signed-rank test). The CpG island SeqTCGA site in the LRRC26 gene is also shown (left panel) (Wilcoxon signed-rank test). 5′-aza-dC, 5-aza-2′-deoxycytidine; TNBC, triple-negative breast cancer; LRRC26, leucine-rich repeat-containing 26; ACTB, β-actin; RNA-seq, RNA sequencing; ER, estrogen receptor; HER2, human epidermal growth factor receptor 2; T, clinical tumor specimens; N, normal tissue; qPCR, quantitative polymerase chain reaction.

Functional analysis of LRRC26 in HCC70 triple-negative breast cancer cells. (A) qPCR analysis of LRRC26 in HCC70 cells transfected with siLRRC26 (ON-TARGETplus siRNA) and siEGFP as a control for 48, 72, 96 and 120 h (left panel). (A) Cell proliferation assay was performed to evaluate the growth suppressing effect of LRRC26 in HCC70 cells (right panel). (B) Soft agar colony formation assays were performed for 36 h to evaluate anchorage-independent growth of LRRC26 in HCC70 cells (right panel) 11 days after siLRRC26 treatment. qPCR analysis was performed for LRRC26 in HCC70 cells transfected with siLRRC26 (ON-TARGETplus siRNA) and siEGFP as a control for 36 h (left panel). (C) Cell invasion assay with HCC70 using BD Falcon Cell Culture Inserts at 48 h after siLRRC26 treatment for 36 h. Representative images of invasion assays are shown (left panel). (D) Cell migration assay with HCC70 using Corning Matrigel Invasion Chambers at 48 h after siLRRC26 treatment for 36 h. Representative images of migration assays are shown (left panel). The data represent the mean ± standard deviation of each condition (*P<0.05 and **P<0.01; two-sided Student's t-test). (E) Immunoblotting analysis of LRRC26-HA expression in BT20 cells transfected with LRRC26-HA and an empty vector (Mock) as a control for 48 h. (F) Cell migration of BT20 cells transfected with LRRC26-HA or an empty vector (Mock) were measured using the Incucyte for 72 h after 48 h of transfection. (G) Cell invasion of BT20 cells transfected with LRRC26-HA or an empty vector (Mock) were measured using Incucyte for 72 h after 48 h of transfection. (H) An MTT assay was performed to evaluate the growth suppressing effect of LRRC26 overexpression in BT20 cells. LRRC26, leucine-rich repeat-containing 26; siEGFP, small interfering enhanced green fluorescent protein; qPCR, quantitative polymerase chain reaction.

LRRC26 negatively regulates the NF-κB pathway. (A) Luciferase assay using lysates of 293T cells co-transfected with a luciferase reporter plasmid for NF-κB and a LRRC26 gene plasmid following stimulation with TNF-α (40 ng/ml) for 0, 4, 8 and 12 h, respectively. (B) Quantitative polymerase chain reaction analysis to evaluate the expression of NF-κB-target genes, including IL-6, IL-8 and CXCL1, following TNF-α (40 ng/ml) stimulation in siLRRC26-transfected HCC70 cells. The data represent the mean ± standard deviation of each condition (n=3, *P<0.05 and **P<0.01; two-sided Student's t-test). LRRC26, leucine-rich repeat-containing 26; EGFP, enhanced green fluorescent protein; NF-κB, nuclear factor-κB; si, small interfering; IL, interleukin; CXCL1, C-X-C motif chemokine ligand-1; TNF-α, tumor necrosis factor-α.

LRRC26 potentially functions in the endoplasmic reticulum in TNBC cells. (A) Verification of downregulation of OR5M1 and OR5T1 in LRRC26-depleted cells by quantitative polymerase chain reaction. (B) Exogenous LRRC26-HA was partially merged with endogenous GRP78 in the endoplasmic reticulum of BT20 cells, and immunostained with anti-HA (red) or anti-GRP78 (green) antibodies, and DAPI (blue) to discriminate the nucleus. (C) Co-localization of exogenous LRRC26-HA and BAP31-FLAG in the endoplasmic reticulum of BT20 cells, and immunostained with anti-HA (red) or anti-FLAG (green) antibodies, and DAPI (blue) to discriminate the nucleus. LRRC26, leucine-rich repeat-containing 26; OR5M1, olfactory receptor family 5 subfamily M member 1; si, small interfering; EGFP, enhanced green fluorescent protein; BAP31, B cell receptor associated protein 31.

A usage list of the breast cancer cell lines.

Cell line Temperature(°C) Atmosphere Media + supplements Analyses performed
MDA-MB-231 37 Air, 100% Leibovitz's L-15 + 10% FBS with 1% Ab qPCR, pyrosequencing
HCC1143 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR, pyrosequencing
BT-20 37 Air, 95%; CO2, 5% MEM + 10% FBS with 1% Ab qPCR, pyrosequencing, bisulfite-sequencing
BT-549 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR
HCC1395 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR
HCC1937 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR, pyrosequencing, bisulfite-sequencing
MDA-MB-157 37 Air, 100% Leibovitz's L-15 + 10% FBS with 1% Ab qPCR, pyrosequencing
HCC38 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR
HCC70 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR, pyrosequencing, bisulfite-sequencing
MDA-MB-468 37 Air, 100% Leibovitz's L-15 + 10% FBS with 1% Ab qPCR
BT-474 37 Air, 95%; CO2, 5% MEM + 10% FBS with 1% Ab qPCR, pyrosequencing
MDA-MB-453 37 Air, 100% Leibovitz's L-15 + 10% FBS with 1% Ab qPCR, pyrosequencing
SK-BR3 37 Air, 95%; CO2, 5% McCoy's 5a + 10% FBS with 1% Ab qPCR
T-47D 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR
ZR-75-1 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR
KPL-3C 37 Air, 95%; CO2, 5% RPMI-1640 + 10% FBS with 1% Ab qPCR
MCF-7 37 Air, 95%; CO2, 5% MEM + 10% FBS with 1% Ab, 0.1 mM NEAA, 1 mM sodium pyruvate and 10 µg/ml insulin qPCR

RPMI-1640 medium, FBS and insulin were obtained from Sigma-Aldrich; Merck KGaA (Darmstadt, Germany). Leibovitz's L-15, MEM, McCoy's 5a, NEAA and sodium pyruvate were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Ab-antimycotic (Thermo Fisher Scientific, Inc.) included penicillin, streptomycin and amphotericin B. FBS, fetal bovine serum; MEM, minimal essential medium; NEAA, Non-Essential Amino Acids; Ab, antibody; qPCR, quantitative polymerase chain reaction.

Clinical and pathological features of 26 triple-negative breast cancer cases enrolled in RNA-seq and qPCR analyses.

Case_ID Age (years) Gender ER PgR HER2 Histology T-stage Node
10 57 F (−) (−) 1+ Papillotubular > scirrhous T2 +
19a 44 F (−) (−) 0 Papillotubular T1 −
36 50 F (−) (−) 0 Solid-tubular > papillotubular T2 +
53a 55 F (−) (−) 0 Papillotubular > scirrhous T1 −
54a 77 F (−) (−) 0 Solid-tubular T1 −
56a 58 F (−) (−) 0 Solid-tubular T1 +
101 60 F (−) (−) 0 Scirrhous > solid-tubular T2 +
110a 77 F (−) (−) 1+ Scirrhous > papillotubular T2 +
114a 76 F (−) (−) 0 Solid-tubular T2 +
133 50 F (−) (−) 0 Solid-tubular T1 −
150a 58 F (−) (−) 0 Papillotubular T2 −
159a 75 F (−) (−) 1+ Papillotubular T1 −
171 37 F (−) (−) 1+ Solid-tubular T1 +
179a 61 F (−) (−) 0 Solid-tubular T2 −
188 50 F (−) (−) 1+ Solid-tubular > scirrhous T1 −
192a 50 F (−) (−) 0 Solid-tubular T1 +
209a 50 F (−) (−) 0 Solid-tubular > scirrhous T2 +
242 58 F (−) (−) 0 Unknown (large cell) T3 +
270a 47 F <5 <5 0 Solid-tubular T1 −
272a 88 F <5 <5 0 Solid-tubular T2 −
284a 58 F (−) (−) 0 Papillotubular T2 +
292a 69 F <5 <5 0 Solid-tubular > scirrhous T2 +
306 83 F <5 <5 1+ Invasive lobular T2 −
320 70 F (−) (−) 0 Scirrhous > papillotubular T1 −
329 32 F <5 <5 0 Papillotubular T1 −
334 63 F <5 <5 0 Adenoid cystic T1 −

All cases were analyzed by qPCR.

Cases which also underwent RNA-Seq. The evaluation of HER2 protein expression was performed by immunohistochemistry assay of the invasive component of a breast cancer specimen (41). TNM classification was classified by General Rules for Clinical and Pathological Recording of Breast Cancer edited by the Japanese Breast Cancer Society that referred to the International Union Against Cancer (42). qPCR, quantitative polymerase chain reaction; RNA-Seq, RNA sequencing; ER, estrogen receptor; PgR, progesterone receptor; HER2, human epidermal growth factor receptor 2; F, female.

Primer sequences used for bisulfite pyrosequencing and bisulfite sequencing of LRRC26.

Primer Primer sequences Size (bp)
Bisulfite pyrosequence
 Forward primer (Seq.1–2) TGGGCGGTGTTTTGTTGTTTAGGTTA 119
 Reverse primer (Seq.1–2) Bio_AAAACTCCAAACTACTCTTAACTCAAC
 Forward primer (Seq.TCGA) AGGTTTTATTTAGTATGGGAATGGGATT 123
 Reverse primer (Seq.TCGA) Bio_AACCCAAAAATCCTACTCCTCACCC
 Sequencing primer (Seq.1) TTGTTTAGGTTAGGGTT
 Sequencing primer (Seq.2) GAGGTGGTTTTGATAG
 Sequencing primer (Seq.TCGA) GGAATGGGATTATTTTTG
 Sequence to analyze (Seq.1) CGGCGGGCG
 Sequence to analyze (Seq.2) CGTTGTGGTCGGCG
 Sequence to analyze (Seq.TCGA) CGTGGGGGTTATTTCGTATGTGTACG
Bisulfite sequence
 Forward primer (Seq.1–2) TGGGCGGTGTTTTGTTGTTTAGGTTA 343
 Reverse primer AACCCCGCATAAAAACAACCCCCC

Reverse primers of bisulfite pyrosequence are 5′-biotinylated. Underlining indicates a possible CpG site of LRRC26. LRRC26, leucine-rich repeat-containing 26.

Association between leucine-rich repeat-containing 26 downregulation in triple-negative breast cancer cases and patient characteristics.

Characteristic Total Expression of LRRC26 for tumor/normal tissue <1.0 Expression of LRRC26 for tumor/normal tissue ≥1.0 P-value (χ2 test)
Total, n 26 17 (65.4) 9 (34.6)
Age in years, n (%) 0.482
 ≥50 22 (84.6) 15 (57.7) 7 (26.9)
 <50 4 (15.4) 2 (7.7) 2 (7.7)
Menopause, n (%) 0.743
 Post 16 (61.5) 10 (38.5) 6 (23.0)
 Pre 8 (30.8) 6 (23.1) 2 (7.7)
 N/A 2 (7.7) 1 (3.85) 1 (3.85)
Histological grade, n (%) 0.017
 1 7 (26.9) 2 (7.7) 5 (19.2)
 ≥2 19 (73.1) 15 (57.7) 4 (15.4)
T, n (%) 0.216
 1 13 (50.0) 7 (27.0) 6 (23.0)
 ≥2 13 (50.0) 10 (38.5) 3 (11.5)
N, n (%) 0.340
 − 14 (53.9) 8 (30.8) 6 (23.1)
 + 12 (46.1) 9 (34.6) 3 (11.5)
M, n (%) N/A
 0 26 (100.0) 17 (65.4) 9 (34.6)
 1 0.0 0.0 0.0

TNM classification was judged according to the General Rules for Clinical and Pathological Recording of Breast Cancer (the Japanese Breast Cancer Society) that referred to the International Union Against Cancer (42). T, tumor stage; N, lymph node metastasis status; M, distant metastasis.

Genes that were altered upon leucine-rich repeat-containing 26-knockdown according to DNA microarray analysis (n=230).

Gene symbol Gene name Fold-change
Upregulation
 ANKRD30A Ankyrin repeat domain 30A 30.29
 MEPE Matrix extracellular phosphoglycoprotein 26.45
 DACT1 Dishevelled-binding antagonist of β-catenin 1 24.11
 MGAT5B Mannosyl (α-1,6-)-glycoprotein β-1,6-N-acetyl-glucosaminyltransferase, isozyme B 17.55
 PLCB4 Phospholipase C, β4 17.10
 NME8 NME/NM23 family member 8 14.79
 HMCN2 Hemicentin 2 13.61
 SLC2A7 Solute carrier family 2 (facilitated glucose transporter), member 7 13.57
 TSPAN11 Tetraspanin 11 11.90
 ACTG2 Actin, gamma 2, smooth muscle, enteric 11.76
 CCL11 Chemokine (C-C motif) ligand 11 11.26
 GCNT3 Glucosaminyl (N-acetyl) transferase 3, mucin type 10.82
 CCDC162P Coiled-coil domain containing 162, pseudogene 9.65
 EWSAT1 Ewing sarcoma associated transcript 1 9.18
 DPEP1 Dipeptidase 1 (renal) 9.01
 CAMP Cathelicidin antimicrobial peptide 8.96
 PPP1R42 Protein phosphatase 1, regulatory subunit 42 8.01
 COL24A1 Collagen, type XXIV, α1 7.82
 SCN5A Sodium channel, voltage gated, type Vα subunit 7.50
 TMEM236 Transmembrane protein 236 7.46
 ELF5 E74-like factor 5 (ets domain transcription factor) 7.23
 ITIH5 Inter-α-trypsin inhibitor heavy chain family, member 5 6.97
 NAT2 N-acetyltransferase 2 (arylamine N-acetyltransferase) 6.73
 DOCK2 Dedicator of cytokinesis 2 6.45
 CFAP61 Cilia and flagella-associated protein 61 6.10
 TRPA1 Transient receptor potential cation channel, subfamily A, member 1 6.07
 AZU1 Azurocidin 1 5.84
 CLNK Cytokine-dependent hematopoietic cell linker 5.83
 MORN3 MORN repeat containing 3 5.58
 ARSE Arylsulfatase E (chondrodysplasia punctata 1) 5.46
 FENDRR FOXF1 adjacent non-coding developmental regulatory RNA 5.27
 IZUMO4 IZUMO family member 4 5.09
 PHOX2B Paired-like homeobox 2b 4.99
 DKFZP434L187 Uncharacterized LOC26082 4.90
 WHAMMP3 WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3 4.84
 PHYHIP Phytanoyl-CoA 2-hydroxylase interacting protein 4.81
 GRIK2 Glutamate receptor, ionotropic, kainate 2 4.68
 CNOT2 CCR4-NOT transcription complex, subunit 2 4.59
 CCDC162P Coiled-coil domain containing 162, pseudogene 4.53
 TMEM236 Transmembrane protein 236 4.50
 MEGF11 Multiple EGF-like-domains 11 4.44
 TMEM35 Transmembrane protein 35 4.39
 LDLRAD1 Low density lipoprotein receptor class A domain-containing 1 4.38
 FRMD3 FERM domain containing 3 4.34
 FGG Fibrinogen γ chain 4.29
 GP6 Glycoprotein VI (platelet) 4.28
 C7orf69 Chromosome 7 open reading frame 69 4.21
 RNF17 Ring finger protein 17 4.20
 PECAM1 Platelet/endothelial cell adhesion molecule 1 4.19
 GRIK2 Glutamate receptor, ionotropic, kainate 2 4.16
 OR10V1 Olfactory receptor, family 10, subfamily V, member 1 4.11
 ASPDH Aspartate dehydrogenase domain containing 4.02
 BCAS1 Breast carcinoma amplified sequence 1 3.99
 ANKRD22 Ankyrin repeat domain 22 3.97
 ALKBH3-AS1 ALKBH3 antisense RNA 1 3.96
 TMEM215 Transmembrane protein 215 3.92
 CDSN Corneodesmosin 3.82
 PRR30 Proline rich 30 3.75
 CCDC8 Coiled-coil domain-containing 8 3.75
 GRAMD1B GRAM domain-containing 1B 3.70
 ANKRD20A12P Ankyrin repeat domain 20 family, member A12, pseudogene 3.68
 OR5D18 Olfactory receptor, family 5, subfamily D, member 18 3.59
 FAM209B Family with sequence similarity 209, member B 3.57
 CLEC1B C-type lectin domain family 1, member B 3.55
 USP17L8 Ubiquitin specific peptidase 17-like family member 8 3.54
 BMF Bcl-2 modifying factor 3.52
 ZFHX2 Zinc finger homeobox 2 3.52
 RBPMS RNA binding protein with multiple splicing 3.51
 TTC29 Tetratricopeptide repeat domain 29 3.49
 PCDH11Y Protocadherin 11 Y-linked 3.48
 EFHB EF-hand domain family, member B 3.44
 NBAT1 Neuroblastoma-associated transcript 1 3.41
 HEMGN Hemogen 3.41
 WNT3A Wingless-type MMTV integration site family, member 3A 3.32
 PARD6G Par-6 family cell polarity regulator γ 3.31
 KCTD8 Potassium channel tetramerization domain-containing 8 3.30
 MGC27382 Uncharacterized MGC27382 3.28
 P4HA3 Prolyl 4-hydroxylase, α polypeptide III 3.21
 SMIM9 Small integral membrane protein 9 3.19
 PTPRC Protein tyrosine phosphatase, receptor type, C 3.16
 KLB Klotho β 3.13
 CLDN19 Claudin 19 3.13
 MGC27382 Uncharacterized MGC27382 3.13
 ZP1 Zona pellucida glycoprotein 1 (sperm receptor) 3.13
 PTPRC Protein tyrosine phosphatase, receptor type, C 3.12
 C15orf32 Chromosome 15 open reading frame 32 3.11
 NLRP12 NLR family, pyrin domain containing 12 3.11
 POLH Polymerase (DNA directed), η 3.08
 KIAA1731NL KIAA1731 N-terminal like 3.06
 PRPS1 Phosphoribosyl pyrophosphate synthetase 1 3.05
Downregulation
 DCAF12L1 DDB1 and CUL4 associated factor 12-like 1 −31.73
 REG3A Regenerating islet-derived 3 α −29.34
 CXorf21 Chromosome X open reading frame 21 −23.23
 TAT Tyrosine aminotransferase −22.82
 MS4A12 Membrane-spanning 4-domains, subfamily A, member 12 −22.56
 OR5M1 Olfactory receptor, family 5, subfamily M, member 1 −20.76
 C10orf90 Chromosome 10 open reading frame 90 −19.70
 ADAM5 ADAM metallopeptidase domain 5 (pseudogene) −18.73
 HNRNPKP3 Heterogeneous nuclear ribonucleoprotein K pseudogene 3 −17.57
 BMP7 Bone morphogenetic protein 7 −17.32
 OR5T1 Olfactory receptor, family 5, subfamily T, member 1 −16.91
 AQP10 Aquaporin 10 −16.63
 NBAT1 Neuroblastoma associated transcript 1 −16.43
 OR1A1 Olfactory receptor, family 1, subfamily A, member 1 −16.24
 CALY Calcyon neuron-specific vesicular protein −15.47
 MAP3K13 Mitogen-activated protein kinase kinase kinase 13 −14.49
 NCRNA00249 Uncharacterized LOC101926947 −13.95
 SLC22A11 Solute carrier family 22 (organic anion/urate transporter), member 11 −13.81
 SNORD116-11 Small nucleolar RNA, C/D box 116-11 −13.67
 LILRB4 Leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 −13.62
 ERVV-2 Endogenous retrovirus group V, member 2 −13.31
 TTC24 Tetratricopeptide repeat domain 24 −12.83
 PCDHB15 Protocadherin β15 −11.64
 ZNF705G Zinc finger protein 705G −10.80
 FAM20A Family with sequence similarity 20, member A −10.79
 LILRA3 Leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 −10.65
 PALM2 Paralemmin 2 −10.33
 RSPH6A Radial spoke head 6 homolog A (Chlamydomonas) −10.25
 ANGPTL1 Angiopoietin-like 1 −10.14
 ATP8B2 ATPase, aminophospholipid transporter, class I, type 8B, member 2 −10.07
 FMO9P Flavin containing monooxygenase 9 pseudogene −9.60
 MEIS1-AS2 MEIS1 antisense RNA 2 −9.47
 PKDCC Protein kinase domain containing, cytoplasmic −9.20
 RBMY1B RNA binding motif protein, Y-linked, family 1, member B −9.19
 CFAP46 Cilia and flagella-associated protein 46 −9.06
 BIRC8 Baculoviral IAP repeat-containing 8 −8.96
 PENK Proenkephalin −8.95
 C9orf47 Chromosome 9 open reading frame 47 −8.73
 PRDM16 PR domain containing 16 −8.70
 FAM104B Family with sequence similarity 104, member B −8.54
 NLRP4 NLR family, pyrin domain containing 4 −8.51
 MOV10L1 Mov10 RISC complex RNA helicase like 1 −8.30
 SLAMF8 SLAM family member 8 −8.28
 C7orf71 Chromosome 7 open reading frame 71 −8.18
 SOGA3 SOGA family member 3 −8.16
 SLC2A1-AS1 SLC2A1 antisense RNA 1 −8.15
 TXNDC8 Thioredoxin domain-containing 8 (spermatozoa) −7.80
 PCLO Piccolo presynaptic cytomatrix protein −7.75
 RNF17 Ring finger protein 17 −7.69
 ACADL Acyl-CoA dehydrogenase, long chain −7.46
 GPR123 G protein-coupled receptor 123 −7.41
 RPS6KA2-AS1 RPS6KA2 antisense RNA 1 −7.26
 LRRC34 Leucine rich repeat containing 34 −7.21
 TMEM98 Transmembrane protein 98 −7.18
 DACT2 Dishevelled-binding antagonist of β-catenin 2 −6.94
 C20orf173 Chromosome 20 open reading frame 173 −6.85
 TBX18 T-box 18 −6.64
 ANKRD62 Ankyrin repeat domain 62 −6.43
 VAX1 Ventral anterior homeobox 1 −6.15
 PIP5K1B Phosphatidylinositol-4-phosphate 5-kinase, type I, β −6.07
 MZB1 Marginal zone B and B1 cell-specific protein −6.04
 MIR3663HG miR3663 host gene (non-protein coding) −6.03
 DEFB133 Defensin, β133 −5.99
 MMP13 Matrix metallopeptidase 13 (collagenase 3) −5.94
 ZFYVE28 Zinc finger, FYVE domain containing 28 −5.82
 DUX3 Double homeobox 3 −5.81
 IFNL3 Interferon λ3 −5.80
 MT1DP Metallothionein 1D, pseudogene (functional) −5.61
 TP53AIP1 Tumor protein p53 regulated apoptosis inducing protein 1 −5.50
 KCNMA1 Potassium channel, calcium activated large conductance subfamily Mα, member 1 −5.47
 MRPL23-AS1 MRPL23 antisense RNA 1 −5.41
 PCSK1 Proprotein convertase subtilisin/kexin type 1 −5.37
 IPW Imprinted in Prader-Willi syndrome (non-protein coding) −5.24
 UPK1A Uroplakin 1A −5.09
 NAIP NLR family, apoptosis inhibitory protein −4.84
 ABI3BP ABI family, member 3 (NESH) binding protein −4.79
 ENDOV Endonuclease V −4.66
 MAP2 Microtubule-associated protein 2 −4.66
 HMBOX1 Homeobox containing 1 −4.65
 CHIAP2 Chitinase, acidic pseudogene 2 −4.60
 BMS1P17 BMS1 pseudogene 17 −4.52
 SPOCK3 Sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 −4.51
 RASSF3 Ras association (RalGDS/AF-6) domain family member 3 −4.51
 SLC24A1 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 −4.47
 NR1H2 Nuclear receptor subfamily 1, group H, member 2 −4.46
 RBMY1B RNA binding motif protein, Y-linked, family 1, member B −4.42
 BPIFB4 BPI fold containing family B, member 4 −4.39
 RAG2 Recombination activating gene 2 −4.34
 RBMXL2 RNA binding motif protein, X-linked-like 2 −4.26
 MASP1 Mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) −4.25
 AIPL1 Aryl hydrocarbon receptor interacting protein-like 1 −4.16
 SGPP2 Sphingosine-1-phosphate phosphatase 2 −4.13
 PLGLB1 Plasminogen-like B1 −4.12
 NPAS3 Neuronal PAS domain protein 3 −4.09
 FLJ16734 Uncharacterized LOC641928 −4.06
 LRRTM4 Leucine rich repeat transmembrane neuronal 4 −4.04
 TPTE2 Transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 −3.95
 FLJ36777 Uncharacterized LOC730971 −3.91
 DNAI1 Dynein, axonemal, intermediate chain 1 −3.88
 ROBO4 Roundabout, axon guidance receptor, homolog 4 (Drosophila) −3.84
 ALOX15 Arachidonate 15-lipoxygenase −3.79
 OLIG3 Oligodendrocyte transcription factor 3 −3.78
 MON2 MON2 homolog (S. cerevisiae) −3.76
 MON2 MON2 homolog (S. cerevisiae) −3.75
 CASC11 Cancer susceptibility candidate 11 (non-protein coding) −3.68
 CRISP2 Cysteine-rich secretory protein 2 −3.68
 RAB41 RAB41, member RAS oncogene family −3.61
 ALS2CR12 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 −3.56
 GLYCTK Glycerate kinase −3.55
 NCRNA00250 Non-protein coding RNA 250 −3.51
 VCAM1 Vascular cell adhesion molecule 1 −3.44
 OPALIN Oligodendrocytic myelin paranodal and inner loop protein −3.41
 AKNAD1 AKNA domain containing 1 −3.40
 ATP1A2 ATPase, Na+/K+ transporting, α2 polypeptide −3.39
 OTOGL Otogelin-like −3.35
 MUC6 Mucin 6, oligomeric mucus/gel-forming −3.33
 FAM230A Family with sequence similarity 230, member A −3.32
 KRT6A Keratin 6A, type II −3.32
 SLC25A21-AS1 SLC25A21 antisense RNA 1 −3.31
 GLYCTK Glycerate kinase −3.29
 DRD2 Dopamine receptor D2 −3.29
 CECR6 Cat eye syndrome chromosome region, candidate 6 −3.29
 PRKCQ-AS1 PRKCQ antisense RNA 1 −3.28
 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif, 6 −3.27
 CCDC178 Coiled-coil domain containing 178 −3.26
 LTN1 Listerin E3 ubiquitin protein ligase 1 −3.25
 C10orf71-AS1 C10orf71 antisense RNA 1 −3.23
 SPDYE5 Speedy/RINGO cell cycle regulator family member E5 −3.21
 CD180 CD180 molecule −3.20
 DPY19L2 Dpy-19-like 2 (C. elegans) −3.20
 SCEL Sciellin −3.13
 PTGIR Prostaglandin I2 (prostacyclin) receptor (IP) −3.10
 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 −3.10
 ABCC2 ATP-binding cassette, sub-family C (CFTR/MRP), member 2 −3.09
 MYL10 Myosin, light chain 10, regulatory −3.07
 OR5M9 Olfactory receptor, family 5, subfamily M, member 9 −3.06
 APCDD1L-AS1 APCDD1L antisense RNA 1 (head to head) −3.06
 SULT1B1 Sulfotransferase family, cytosolic, 1B, member 1 −3.05
 CFAP58 Cilia and flagella-associated protein 58 −3.03
 TERF1 Telomeric repeat binding factor (NIMA-interacting) 1 −3.03

Functional gene annotation clustering analysis of annotation cluster one (enrichment score: 3.12) based on the Database for Annotation, Visualization and Integrated Discovery algorithma.

Category Term No. of genes P-value
UP_KEYWORDS Glycoprotein 66 8.32×10−5
UP_SEQ_FEATURE Signal peptide 51 1.21×10−4
UP_SEQ_FEATURE Glycosylation site:N-linked (GlcNAc…) 58 5.77×10−4
UP_KEYWORDS Secreted 33 1.09×10−3
UP_KEYWORDS Signal 57 1.45×10−3
UP_KEYWORDS Disulfide bond 49 1.64×10−3

Partial list of a functional annotation cluster was obtained by loading 216 genes, the expression of which included an increase or decrease of >3-fold following knockdown of leucine-rich repeat-containing 26 in HCC70 cells using a DNA microarray analysis.