Non-small cell lung cancer (NSCLC) is considered to be an inflammation-associated carcinoma. Although interleukin-17 (
Lung cancer, in which non-small cell lung cancer (NSCLC) accounts for approximately 85% of cases, is the most lethal type of cancer worldwide (
Interleukin 17 (
As is known, the expression of proliferation-related genes is associated with the activation of certain molecules in diverse signaling pathways, including various transcription factors (
The present study demonstrated that the production of IL-17 and the expression levels of
Plasma samples from patients with NSCLC (n=40) and healthy volunteers (n=40) were collected from the First Affiliated Hospital of Nanjing Medical University (Nanjing, China). Patients were eligible if they were diagnosed with NSCLC by biopsy and had not been treated with chemotherapy or radiotherapy prior to sample collection. Patients were excluded if they suffered from any other disease (trauma, infections, allergies, autoimmune diseases or other inflammatory diseases and cancers). Informed consent was obtained from all patients participating in this research prior to the experiment. This study was approved by the Ethics Committee of Nanjing Medical University and conformed to the guidelines outlined by the Declaration of Helsinki. Specifically, venous blood samples were collected into K3EDTA tubes (Greiner Bio-One; Frickenhausen, Germany) and were then fractionated by centrifugation (10 min, 3,000 × g). The plasma was aliquoted and stored at −80°C prior to analysis. NSCLC tissue arrays (n=60, paired) were provided by the National Engineering Center for BioChips (Shanghai, China).
The human NSCLC cell lines, A549 (Cat. no. CCL-185), H1299 (Cat. no. CRL-5803) and H1975 (Cat. no. CRL-5908) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The human adenocarcinoma cell lines, PC9 and SPC-A1, were purchased from the European Collection of Authenticated Cell Cultures (ECACC, Cat. no. 90071810) and the Institute of Biochemistry and Cell Biology of the Chinese Academy of Science (Cat. no. TCHu53), respectively. The human bronchial epithelial cell line (16HBE) was supplied by Dr Gruenert (California Pacific Medical Center, San Francisco, CA, USA). Recombinant human
The plasma
Total RNA from the NSCLC tissues and cells was isolated using TRIzol reagent (Thermo Fisher Scientific) and the cDNA was generated using the reverse transcription reagent kit (Vazyme Biotech). The PCR assay was performed with a 50
The slides from the NSCLC tissue array were incubated with the antibodies against IL-17R (dilution 1:100), HMGA1 (dilution 1:250) and cyclin D1 (dilution 1:250), followed by incubation with secondary antibodies (dilution 1:500). The reaction was visualized with a DAB HRP substrate kit. Finally, sections were viewed under a light microscope (Eclipse 90i; Nikon, Tokyo, Japan). The tissues subjected to IHC were scored according to the staining intensity and stained area, and 5 randomly selected fields were analyzed. The scoring of the staining intensity was as follows: negative, 0; weak, 1; moderate, 2; and strong, 3. The scoring of the stained area was as follows: 0%, 0; 1–25%, 1; 26–50%, 2; 51–75%, 3; and 76–100%, 4. These scores were multiplied to produce the final score: 0–1, negative expression; 2–4, weak positive expression; and 6–12, strong positive expression (
The
The cells were maintained in DMEM with 10% FBS in an incubator containing 5% CO2 at 37°C. For
The cells were lysed using RIPA buffer (Beyotime, Beijing China) and the total protein concentration was measured by BCA assay. The protein samples were loaded (50
The
The afore-mentioned promoter reporters were transfected into the A549 cells with a pRL-SV40 vector (Promega), separately. A dual-luciferase reporter reagent was used to measure the promoter activity according to the manufacturer's instructions and as previously described (
ChIP assay was performed using ChIP-grade
Cell proliferation was measured by CCK-8 and colony formation assays. For CCK-8 assay, based on the manufacturer's instructions, the optical density (OD) values at 450 nm were documented using a microplate reader (Biotek). For colony formation assay, the cells were seeded in a 6-well plate at 500 cells/per well. Following culture for 10 days, the cells were fixed and stained with 0.1% crystal violet. Visible colonies were counted.
All data are presented as the means ± SE. Data analysis was carried out using GraphPad Prism 6.01 (GraphPad Software, San Diego, CA, USA). The significant difference between 2 groups was determined by a Student's t-test. Multi-group comparisons were carried out by one-way ANOVA with Dunnett's post hoc test. Using a Chi-square test, the association of the clinical parameters of the patients with NSCLC with the expression of proteins was analyzed. The correlation between the IHC scores was determined by computing Pearson's correlation coefficient. A P-value <0.05 was considered to indicate a statistically significant difference.
At the beginning of the present study, we examined the concentration of
Given that
To further confirm that
It has been reported that
As mentioned earlier,
NSCLC is one of the most common types of malignancy worldwide (
It has been well documented that cell proliferation is associated with extracellular stimuli and proliferative molecule expression (
As is known,
Reportedly,
In conclusion, the present study verified that the expression level of
The authors would like to thank Miss Samjhana Pandey for modifying the language.
This study was supported by grants from the National Natural Science Foundations of China (nos. 81272532, 81472626 and 81672896).
The analyzed datasets generated during the study are available from the corresponding author on reasonable request.
YS and WQ designed the study and CZ wrote the manuscript. CZ and YL carried out experiments. WZ collected and provided the samples of NSCLC patients. DZ, PM, LM and FY participated in the experiments and analyzed the data. YS and YW supervised the study. All authors have read and approved the final manuscript.
This study was approved by the Ethics Committee of Nanjing Medical University and conformed to the guidelines outlined by the Declaration of Helsinki. Informed consent was obtained from all patients participating in this research prior to the experiment.
Not applicable.
The authors declare that they have no competing interests.
Plasma IL-17 concentration and tissue IL-17R, HMGA1 and cyclin D1 expression levels in patients with non-small cell lung cancer (NSCLC). (A) Quantification of IL-17 in plasma samples from patients with NSCLC and healthy donors. Data are presented as the means ± SE. (B) Representative images of IL-17R, HMGA1 and cyclin D1 expression in NSCLC tissues and corresponding adjacent normal tissues by IHC staining (n=60). (C) Statistical analysis of IHC staining intensity and the staining area of the above-mentioned proteins. The percentages of negative, week or strong expression of IL-17R, HMGA1 and cyclin D1 in NSCLC tissues are shown. (D) Correlations of IHC staining scores between IL-17R, HMGA1 and cyclin D1. Pearson's correlation coefficient was computed. HMGA1, high-mobility group A1.
Cell proliferation, and mRNA and protein levels of HMGA1 and cyclin D1 in A549 cells upon IL-17 stimulatoin. (A) The IL-17R protein expression in various NSCLC cell lines examined by western blot analysis. (B) A549 cells were stimulated with various concentrations of recombinant IL-17 (IL-17A) for 72 h following serum starvation. CCK-8 assay was performed to detect cell viability (OD value). (C and D) Colony formation of the A549 cells under IL-17 stimulation at various concentrations. (C) A representative image and (D) quantification of the colonies are shown. (E–G) A549 cells were exposed to 50 ng/ml IL-17 for different periods of time, and the (E) mRNA or (F and G) protein levels of HMGA1 and cyclin D1 were examined by RT-qPCR and western blot analysis, respectively. All data are presented as the means ± SE from 3 independent experiments, *P<0.05 and **P<0.01 vs. 0 ng/ml IL-17 or 50 ng/ml IL-17 at 0 h. HMGA1, high-mobility group A1.
Alterations in cell proliferation and the expression of HMGA1 or cyclin D1 in IL-17-stimulated A549 cells following the silencing of IL-17R or the neutralization of IL-17. The A549 cells were transfected with siIL-17R (scrambled siCTR as a control) for 24 h or pre-treated with a neutralizing antibody against IL-17 (IgG from same species as a control) for 30 min, followed by IL-17 stimulation at 50 ng/ml. (A) Following 72 h of stimulation, CCK-8 assay were performed to detect cell viability (OD value). (B and C) Cells were seeded and allowed to form colonies for another 10 days. (B) Representative images of colony formation and (C) the numbers of visible colonies are shown. (D–F) Following exposure to IL-17 for 6 h, the (D) mRNA or (E and F) protein levels of HMGA1 and cyclin D1 in the A549 cells were measured by RT-qPCR or western blot analysis. Data are expressed as the means ± SE from 3 independent experiments, **P<0.01 vs. DMEM group, ΔΔP<0.01 vs. siCTR + IL-17 group, and ##P<0.01 vs. IgG + IL-17 group. HMGA1, high-mobility group A1.
Role of HMGA1 in IL-17-induced cell proliferation and the expression of cyclin D1 in A549 cells. A549 cells were transfected with an HMGA1 overexpression vector (pIRES2-HMGA1, pIRES2-EGFP as control) or shRNA expression plasmid (shHMGA1, scrambled shCTR as control) for 48 h. In addition, cells transfected wiht shRNA vectors were treated with 50 ng/ml IL-17 for 6 h. (A) The transfection efficiency was determined by GFP expression at 24 h in A549 cells (×200 magnification). (B) The resutls of western blot analysis revealed that pIRES2-HMGA1 successfully enhanced HMGA1 expression in the A549 cells. (C) Western blot analysis was used to identify the optimal shRNA for HMGA1 silencing, and it was found that shHMGA1-1 markedly downregulated HMGA1 expression in the A549 cells upon IL-17 stimulation. (D) Cells were seeded in a 96-well plate and CCK-8 assay were used to monitor cell proliferation at the indicated time-points. (E and F) Colony formation assay was performed by culturing the cells for a further 10 days, and (E) a representative image or (F) the number of colonies are shown. (G–I) Cyclin D1 (G) mRNA or (H and I) protein expression in the A549 cells transfected with the afore-mentioned plasmids was assessed by RT-qPCR or western blot analysis. Data are presented as the means ± SE from at least 3 independent repeated experiments. **P<0.01 vs. pIRES2-EGFP, ΔΔP<0.01 vs. shCTR + IL-17 group. HMGA1, high-mobility group A1.
Identification of cyclin D1 promoter activity in A549 cells upon IL-17 stimulation and the HMGA1 binding element on the cyclin D1 promoter. (A) A549 cells were transfected with the full-length promoter of cyclin D1 (cyclin D1-FL, −2,099 to +86 nt), followed by stimulation with IL-17 at 50 ng/ml for 3 or 6 h. Luciferase reporter assay was performed to examine the activity of the cyclin D1 promoter in A549 cells at different time-points. *P<0.05 and **P<0.01 vs. 0 h. (B) Cyclin D1-FL was co-transfected with pIRES2-HMGA1 or with shHMGA1 into A549 cells, followed by IL-17 stimulation. The activity of the cyclin D1-FL promoter was assessed by reporter assay. **P<0.01 vs. DMEM, ΔΔP<0.01 vs. pIRES2-EGFP, ##P<0.01 vs. shCTR + IL-17 group. (C) Schematic representation of the cyclin D1 promoter and the predicted HMGA1 response elements on it. The reporter plasmids carrying truncated promoter regions were constructed as indicated. (D and E) Using luciferase assay, the activity of cyclin D1-FL and three truncated promoters (cyclin D1-T1, cyclin D1-T2 and cyclin D1-T3) was measured either in the presence of (D) IL-17 stimulation or (E) HMGA1 overexpression. **P<0.01 vs. pGL3-cyclin D1-FL. (F and G) A549 cells were transfected with pIRES2-HMGA1 or with shHMGA1 followed by exposure to IL-17. Anti-HMGA1 was used to perform ChIP assay. (F) PCR and (G) RT-qPCR were then applied to quantify the binding of HMGA1 to the indicated region of the cyclin D1 promoter. **P<0.01 vs. DMEM, ΔΔP<0.01 vs. pIRES2-EGFP, ##P<0.01 vs. shCTR + IL-17 group. All data are shown as the means ± SE from 3 independent experiments. HMGA1, high-mobility group A1.
Putative schematic diagram of the molecular mechanisms underlying non-small cell lung cancer (NSCLC) proliferation induced by IL-17 through HMGA1 and cyclin D1. HMGA1, high-mobility group A1.
Specific primers for qPCR and plasmids construction.
Name | Primers (5′→3′) | |
---|---|---|
Forward | GCTGGTAGGGAGTCAGAAGG | |
Reverse | TTGGTTTCCTTCCTGGAGTT | |
Forward | GCCACTTGCATGTTCG | |
Reverse | GGGCTCCTCAGGTTCA | |
β-actin | Forward | CAGCCATGTACGTTGCTATCCAGG |
Reverse | AGGTCCAGACGCAGGATGGCATG | |
pIRES2- |
Forward | CCG |
Reverse | CCG | |
Forward | CGG | |
Reverse | CTA | |
Truncate 1 | Forward | CGG |
Reverse | CTA | |
Truncate 2 | Forward | CGG |
Reverse | CTA | |
Truncate 3 | Forward | CGG |
Reverse | CTA |
Underlined letters indicate the following restriction sites:
The characteristics of the patients with non-small cell lung cancer (NSCLC) detected by ELISA.
Characteristics | No. (%) |
---|---|
Total | 40 |
Sex | |
Male | 25 (62.5) |
Female | 15 (37.5) |
Age | |
<60 | 7 (17.5) |
≥60 | 33 (82.5) |
Tumor size | |
<5 cm | 16 (40) |
≥5 cm | 24 (60) |
Lymph node metastasis | |
Negative | 11 (27.5) |
Positive | 29 (72.5) |
TNM stage | |
I | 3 (7.5) |
II | 11 (27.5) |
III | 16 (40) |
IV | 10 (25) |
Pathological type | |
Squamous carcinoma | 15 (37.5) |
Adenocarcinoma | 17 (42.5) |
Large cell carcinoma | 2 (5) |
Bronchioloalveolar carcinoma | 6 (15) |
Association between
Characteristic | Total | P-value |
P-value |
P-value | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Weak and negative | Strong | Weak and negative | Strong | Weak and negative | Strong | |||||
60 | 24 | 36 | 21 | 39 | 25 | 35 | ||||
Sex | ||||||||||
Male | 45 | 15 | 30 | 0.0679 | 17 | 28 | 0.4346 | 17 | 28 | 0.2899 |
Female | 15 | 9 | 6 | 4 | 11 | 8 | 7 | |||
Age (years) | ||||||||||
<60 | 26 | 11 | 15 | 0.7497 | 10 | 16 | 0.623 | 11 | 15 | 0.9298 |
≥60 | 34 | 13 | 21 | 11 | 23 | 14 | 20 | |||
Tumor size | ||||||||||
<5 cm | 35 | 22 | 13 | <0.0001 |
19 | 16 | 0.0002 |
4 | 31 | <0.0001 |
≥5 cm | 25 | 2 | 23 | 2 | 23 | 21 | 4 | |||
Lymph node metastasis | ||||||||||
Negative | 30 | 18 | 12 | 0.0016 |
16 | 14 | 0.0029 |
19 | 11 | 0.0007 |
Positive | 30 | 6 | 24 | 5 | 25 | 6 | 24 | |||
TNM stage | ||||||||||
I | 19 | 16 | 3 | <0.0001 |
11 | 8 | 0.0374 |
3 | 16 | 0.0002 |
II | 27 | 7 | 20 | 6 | 21 | 10 | 17 | |||
III | 14 | 1 | 13 | 4 | 10 | 12 | 2 | |||
Pathological type | ||||||||||
Squamous carcinoma | 20 | 6 | 14 | 0.3728 | 6 | 14 | 0.0861 | 7 | 13 | 0.2566 |
Adenocarcinoma | 20 | 9 | 11 | 5 | 15 | 11 | 9 | |||
Large cell carcinoma | 10 | 3 | 7 | 7 | 3 | 5 | 5 | |||
Bronchioloalveolar carcinoma | 10 | 6 | 4 | 3 | 7 | 2 | 8 |
Chi-square test;
P<0.05;