Contributed equally
Triple-negative breast cancer (TNBC) is a particularly aggressive subtype of breast cancer with limited options for clinical intervention. As with many solid tumors, TNBC is known to promote invasiveness and metastasis by secreting extracellular vesicles (EVs) capable of modulating the behaviour of recipient cells. Recent investigations have demonstrated that high expression levels of glucocorticoid receptor (GR) in TNBC are linked to therapy resistance, higher recurrence rates and increased mortality. In addition to activating protein-coding genes, GR is also involved in the expression of short non-coding RNAs including microRNAs (miRNAs or miRs). The molecular mechanisms responsible for the oncogenic effects of GR on TNBC have yet to be fully elucidated; however, emerging evidence suggests that miRNAs may play a pivotal role in tumorigenesis and metastasis. Thus, the aim of this study was to identify GR-regulated cellular and vesicular miRNAs that might contribute to the particularly oncogenic phenotype of TNBC with a high GR expression. We analyzed miRNA profiles of three TNBC cell lines using an
Breast cancer (BC) is the most prevalent type of cancer affecting women, and the second most common type of cancer as a whole. Globally, the incidence of BC is one in nine women (
One of the most aggressive variants of BC is triple-negative BC (TNBC). This subgroup of BC cells does not express the receptors for estrogen (ER), progesterone receptor (PR) and human epidermal growth factor 2 (HER2). The absence of these proteins renders commonly used clinical interventions, such as inhibiting aromatase and blocking hormone receptors ineffectual for TNBC therapy (
Synthetic glucocorticoids, such as dexamethasone are commonly used in tumor therapy (
In addition to regulating protein-coding genes, GR is known to activate non-coding RNAs, including microRNAs (miRNAs or miRs) (
Recent studies have indicated that TNBC modulates distant cells by secreting signaling factors, including extracellular vesicles (EVs). EVs shed from tumor cells are enriched in specific miRNAs that might contribute to tumor progression and metastasis (
To the best of our knowledge, however, to date, there is no study available investigating the effects of GR signaling on miRNA regulation in TNBC. Thus, in this study, to address this knowledge gap, we analyzed cellular and vesicular miRNA profiles in an
The human TNBC cell lines, MDA-MB-231, MDA-MB-436 and MDA-MB-468, were purchased from the Leibnitz Institute DSMZ-German Collection of Microorganisms and Cell Culture (Braunschweig, Germany) and Cell line services (Eppelheim, Germany).
The cells were cultured in T75 flasks in a monolayer in DMEM (Sigma-Aldrich, Hamburg, Germany) containing 4.5 g/l glucose, 1% L-glutamine, 10% exosome-depleted fetal bovine serum (FBS) (BioCat GmbH, Heidelberg, Germany), 160 ng/l cortisol and 1% penicillin/streptomycin (Invitrogen, Karlsruhe, Germany). Cultures were maintained in a humidified atmosphere at 37°C and 5% CO2. For the experiments studying cellular miRNAs, the MDA-MB-231, MDA-MB-436 and MDA-MB-468 cells were seeded 4.5 h prior to transfection at a concentration of 1×105 cells per well in 24-well plates (Greiner Bio-One, Frickenhausen, Germany) using 0.5 ml culture medium.
GR overexpression was induced by transfecting the TNBC cells with nuclear receptor subfamily 3 group C member 1 (
For experiments studying EV miRNAs, the MDA-MB-231 and MDA-MB-468 cells were seeded at a concentration of 3×106 cells per well in 6-well plates (Greiner Bio-One). Both parental and transfected cells were seeded in 3 wells with 2.5 ml culturing medium each. Transfection was performed with 2.5
For all experiments, untransfected cells with endogenous GR expression were used as control samples. Three independent technical replicates per cell line were analyzed.
To evaluate the effectiveness of transfection, the
For EV isolation, 7.5 ml of cell culture supernatant were collected from the parental and transfected cells after 30 h of cultivation, and centrifuged (3,200 × g, 5 min) to remove the cellular debris. EVs were isolated from pre-cleared supernatant using the miRCURY Exosome Isolation kit - Cells, urine and CSF according to the manufacturer's instructions (Exiqon, Vedbaek, Denmark). EV pellets were resuspended in either lysis buffer for RNA extraction, or PBS for vesicle characterization.
For nanoparticle tracking analysis (NTA), the EVs were diluted in particle-free PBS and analyzed on a NanoSight LM10 (Malvern Instruments GmbH, Herrenberg, Germany) using a 408 nm laser and NTA 3.0 software. Four videos of 30 sec each were captured, and analyzed using default settings for blur and minimum track length, and a detection threshold of two.
Total RNA was isolated from the cells and EVs using the miRCURY RNA Isolation kit – Cell and Plant (Exiqon,) according to the manufacturer's instructoins. Cellular RNA was quantified using a nanophotometer (Implen GmbH, Munich, Germany), and RNA integrity was assessed by capillary electrophoresis on the Bioanalyzer 2100 using the RNA 6000 Nano kit (Agilent Technologies, Waldbronn, Germany). EV RNA was analyzed using the Agilent Small RNA kit (Agilent Technologies).
Sequencing libraries were constructed from 190 ng of cellular RNA, or the entire EV RNA isolated from 7.5 ml conditioned culture medium, respectively. Library preparation was performed as previously described by Spornraft
FastQC (version 0.11.5) was used to assess the sequence length distribution and quality of the NGS data, as previously described (
Based on the NGS data, differentially regulated cellular miRNAs were validated by RT-qPCR. First, 111 ng of RNA were reverse transcribed in triplicate using the miScript II RT kit (Qiagen) according to the manufacturer's instructions. A total of 1
miRWalk 2.0 was used to predict mRNAs targeted by miR-203a-3p (
The transfection of the TNBC cells with
To assess overexpression-induced changes in GR signaling, we additionally quantified the expression levels of GR target genes
EVs isolated from the conditioned media of the parental MDA-MB-231 and MDA-MB-468 cells were characterized by NTA (
Prior to sequencing, RNA extracted from EV preparations was analyzed by capillary electrophoresis. Samples from both cell lines were found to be enriched in small RNA species <150 nt without obvious differences in size profiles between the parental and transfected cells. Full electropherograms for small RNA analysis are provided in
EV RNA from the MDA-MB-231 and MDA-MB-468 cells was profiled by small RNA-Seq. The mean per-replicate library sizes are provided in
Differential expression of miRNAs was assessed in EVs from the parental and transfected MDA-MB-231 and MDA-MB-468 cells. While individual cell lines were clearly distinguished by principal component analysis (
Cellular RNA was initially analyzed by capillary electrophoresis to assess its suitability for NGS analysis. For all cell lines, samples from both parental and transfected cells featured excellent RNA integrity, as indicated by the RNA integrity number (RIN) values >9. Bioanalyzer electropherograms for cellular RNA are shown in
In the NGS data, both the mean size of sequencing libraries and the number of detected miRNAs were higher than in the EV samples (
Differential gene expression analysis revealed slight, yet statistically significant changes in specific miRNAs during GR overexpression (
We then assessed differential miRNA regulation between endogenous and induced GR expression using RT-qPCR and the Student's t-test. Of the 7 miRNAs found to be significantly regulated in the NGS data, only miR-203a-3p was validated with statistical significance. In the transfected MDA-MB-436 cells, it was upregulated with a log2 fold change of 0.63 (
To assess the potential biological functions of miR-203a-3p in the MDA-MB-436 cells, in which it was found to be significantly increased in, we quantified the mRNA levels of 4 of its predicted target genes. Using RT-qPCR, we detected a 3-fold increase in
TNBC is a particularly aggressive form of BC, leading to a poor prognosis for patients. Both the absence of hormone receptors and its molecular heterogeneity render TNBC a difficult target for therapeutic intervention. Additionally, a high GR expression was recently linked to therapy failure and worse outcomes in patients with TNBC, as well as other solid tumors. As Chen
GR biology is fascinatingly complex, involving ligand- dependent receptor activation and isoform-specific transcriptional activity (
When assessing the impact of GR overexpression on intracellular expression profiles, we detected a slight, cell line-specific modulation of 7 miRNAs. Even though the impact of GR signaling on TNBC miRNAs has not yet been elucidated, previous studies have reported GR-responsive miRNAs in primary lymphocytes, as well as in liver and spleen cells (
Of note, miR-203a-3p, upregulated by GR expression in MDA-MB-436 cells, is controversially discussed in BC literature. Several studies have reported its overexpression in BC, as well as an association with a poor prognosis (
The myosin light chain kinase (
Taken together, our data suggest that
In conclusion, we did not observe any prominent alterations in cellular or vesicular miRNA profiles upon overexpression of GR. The patterns of miRNA expression seem to be influenced by GR to only a small degree, and other mechanisms may therefore be the primary driver for the higher mortality rates of patients suffering from TNBC with GR overexpression.
The authors wish to thank Franz Jansen for excellent technical assistance. We are grateful to Renate Scheler and Dr Ricarda Schumann from the University Eye Hospital LMU Munich for excellent assistance with TEM. We also wish to thank Professor Jörg Kleiber for kindly providing access to the NanoSight LM10.
This study was supported by the K.L. Weigand'sche Stiftung, Curt-Bohnewands-Fonds, Georg and Traud Gravenhorst Stiftung, as well as by the Friedrich-Baur-Stiftung. The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
The analyzed datasets generated during the study are available from the corresponding author on reasonable request.
MR, GS and OS conceived and designed the experiments; DB, RG, CM and MR performed the experiments; DB, RG, BK and MR and performed the validation and formal analysis; DB, BK, MWP and MR curated and analyzed the data; DB, BK and MR wrote the manuscript; MWP, GS and OS reviewed and revised the manuscript; MR, OS and GS acquired funding. All authors have read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Validation of
Particle size distribution in extracellular vesicle (EV) preparations from MDA-MB-231 and MDA-MB-468 cells. The area under the curve represents the absolute number of particles isolated from 7.5 ml conditioned media.
Bioanalyzer electropherograms for small RNA analysis in extracellular vesicles (EVs) from parental (left panels) and transfected (right panels) of MDA-MB-231 and MDA-MB-468 cells. FU, fluorescence unit; nt, nucleotide.
Principal component analysis of miRNA expression in MDA-MB-231 and MDA-MB-468 extracellular vesicles (EVs). Even though the cell lines were clearly separated, expression patterns in EVs from parental and transfected cells overlapped.
Bioanalyzer electropherograms for total RNA analysis in parental (left panels) and transfected (right panels) MDA-MB-231, MDA-MB-436 and MDA-MB-468 cells. RIN, RNA integrity number; FU, fluorescence unit; nt, nucleotide.
Principal component analysis of intracellular miRNA expression. (A) Based on all miRNAs, individual cell lines were clearly separated on principal components 1 and 2 with subtle differences between parental and transfected cells. (B) Analysis of the top 500 highest variance miRNAs reduced the separation of groups.
Principal component analysis of intracellular miRNA expression. (A) Analysis of all miRNAs in the dataset separated cell lines (PC1) and treatment groups (PC3). (B) Distances between parental and transfected cells were reduced when limiting the analysis to the top 500 highest variance miRNAs.
Results from RT-qPCR validation of miR-203a-3p. In transfected MDA-MB-436 cells, miR-203a-3p was upregulated with a log2 fold change of 0.63.
Primer pairs used for validation of
Name | Forward primer (5′-3′) | Reverse primer (5′-3′) |
---|---|---|
GCCATTGACTTCATAGACTCCATC | ATGATGCTTCGCCTCTGCTT | |
GACGGTGAAAACTGAGGCTG | AGAAGGACTTGGTGGAGGAGA | |
TCTTCTTCCACAGTGCCTCC | TCTTCAGGGCTCAGACAGGA |
Library sizes and number of detected miRNA species in MDA-MB-231 and MDA-MB-468 EVs.
MDA-MB-231 cells
| ||
---|---|---|
Parental | Transfected | |
Library size ± SD | 1.11E7±1.66E6 | 1.27E7±1.64E6 |
Distinct miRNAs | 796 | 788 |
| ||
MDA-MB-468 cells
| ||
Parental | Transfected | |
| ||
Library size ± SD | 1.09E7±1.25E6 | 1.25E7±1.50E6 |
Distinct miRNAs | 762 | 736 |
EV, extracellular vesicle; SD, standard deviation.
Top 10 most highly expressed miRNAs in EVs from parental and transfected MDA-MB-231 and MDA-MB-468 EVs.
MDA-MB-231 parental
|
MDA-MB-231 transfected
| ||
---|---|---|---|
miRNA | Count ± SD | miRNA | Count ± SD |
miR-100-5p | 32,896.06±15,567.28 | miR-100-5p | 28,093.64±1,746.75 |
miR-21-5p | 20,517.88±6,132.81 | miR-21-5p | 20,563.67±13,352.19 |
let-7f-5p | 14,534.16±7,389.27 | let-7i-5p | 16,700.98±7,018.44 |
let-7i-5p | 13,851.26±3,041.99 | let-7f-5p | 13,224.79±6,215.57 |
miR-486-5p | 12,773.16±9,474.51 | let-7a-5p | 13,170.83±7,480.14 |
let-7a-5p | 12,044.75±4,144.34 | miR-486-5p | 12,251.12±9,557.67 |
miR-92a-3p | 9,763.94±5,940.53 | miR-451a | 11,594.65±13,346.77 |
let-7g-5p | 9,167.48±3,312.17 | let-7g-5p | 9,583.62±3,853.93 |
miR-451a | 8,899.87±5,035.93 | miR-92a-3p | 8,909.74±4,096.12 |
miR-27b-3p | 7,298.91±2,952.47 | miR-27b-3p | 7,004.21±4,888.94 |
| |||
MDA-MB-468 parental
|
MDA-MB-468 transfected
| ||
miRNA | Count ± SD | miRNA | Count ± SD |
| |||
let-7f-2-3p | 20,174.15±3,134.83 | miR-505-3p | 17,483.16±12,287.71 |
miR-103b | 14,956.91±4,896.68 | miR-4742-3p | 15,703.77±5,227.01 |
miR-4742-3p | 14,411.10±5,455.42 | miR-103b | 14,095.48±11,598.41 |
let-7a-3p | 13,768.25±2,884.00 | let-7f-2-3p | 13,819.32±4,499.01 |
miR-505-3p | 10,494.01±2,170.28 | let-7a-3p | 9,814.04±2,947.26 |
let-7f-5p | 10,065.30±2,199.66 | let-7i-3p | 8,987.19±3,015.38 |
let-7i-3p | 9,369.82±1,379.22 | let-7f-5p | 8,452.97±2,966.55 |
miR-22-5p | 7,455.85±526.85 | miR-22-5p | 7,692.73±2,962.41 |
let-7b-3p | 5,176.99±1,522.35 | miR-196b-5p | 4,445.60±5,386.47 |
miR-196b-5p | 3,375.73±1,780.00 | miR-27b-3p | 3,582.84±1,131.12 |
Data are mean normalized readcounts for 3 replicates each. EV, extracellular vesicle; SD, standard deviation.
Library sizes and number of detected miRNA species in MDA-MB-231, MDA-MB-436 and MDA-MB-468 cells.
MDA-MB-231 cells
| ||
---|---|---|
Parental | Transfected | |
Library size ± SD | 9.42E6 1.56E6 | 7.98E6±8.10E5 |
Distinct miRNAs | 1,025 | 949 |
| ||
MDA-MB-436 cells
| ||
Parental | Transfected | |
| ||
Library size ± SD | 9.25E6±8.75E5 | 8.28E6±5.92E5 |
Distinct miRNAs | 1,187 | 1,216 |
| ||
MDA-MB-468 cells
| ||
Parental | Transfected | |
| ||
Library size ± SD | 8.32E6±1.23E6 | 7.27E6±9.70E5 |
Distinct miRNAs | 1,096 | 1,016 |
SD, standard deviation.
Top 10 most highly expressed miRNAs in parental and transfected MDA-MB-231, MDA-MB-436 and MDA-MB-468 cells.
MDA-MB-231 parental
|
MDA-MB-231 transfected
| ||
---|---|---|---|
miRNA | Count ± SD | miRNA | Count ± SD |
miR-100-5p | 963,722.05±111,405.87 | miR-100-5p | 1,348,718.94±345,916.54 |
let-7i-5p | 663,458.05±68,993.69 | let-7i-5p | 774,622.60±97,337.13 |
let-7f-5p | 267,434.97±31,684.39 | let-7f-5p | 324,183.97±17,197.04 |
let-7a-5p | 195,527.39±12,006.56 | let-7a-5p | 204,938.44±20,414.46 |
miR-151a-3p | 106,021.75±1å1,082.05 | miR-151a-3p | 163,277.67±56,462.79 |
let-7g-5p | 90,178.84±13,127.37 | miR-21-5p | 80,090.23±21,445.21 |
miR-21-5p | 67,628.11±16,283.91 | let-7g-5p | 78,292.35±25,760.59 |
miR-92a-3p | 57,221.86±7,227.13 | miR-92a-3p | 61,589.95±11,515.77 |
miR-99b-5p | 51,137.53±9,440.27 | miR-10a-5p | 60,968.56±16,758.93 |
miR-26a-5p | 46,946.37±4,194.59 | miR-99b-5p | 57,331.95±10,509.88 |
| |||
MDA-MB-436 parental
|
MDA-MB-436 transfected
| ||
miRNA | Count ± SD | miRNA | Count ± SD |
| |||
let-7f-5p | 374,536.91±26,561.27 | let-7f-5p | 340,698.27±40,869.66 |
miR-148a-3p | 184,192.97±10,352.18 | miR-148a-3p | 226,502.28±169,068.63 |
let-7a-5p | 153,782.25±10,424.01 | let-7a-5p | 163,998.51±24,567.84 |
let-7i-5p | 146,573.76±5,731.89 | let-7i-5p | 157,923.40±59,299.50 |
miR-92a-3p | 138,702.18±11,122.50 | miR-151a-3p | 148,161.03±108,764.69 |
miR-151a-3p | 123,436.41±9,688.08 | miR-92a-3p | 116,819.87±14,412.48 |
miR-100-5p | 71,942.27±10,410.65 | miR-100-5p | 74,514.77±19,201.37 |
let-7g-5p | 71,876.07±1,749.76 | miR-21-5p | 66,313.38±31,125.38 |
miR-21-5p | 55,083.27±6,735.91 | let-7g-5p | 62,873.25± 0,847.78 |
miR-99b-5p | 38,293.24±5,041.04 | miR-27a-3p | 46,550.47±14,720.23 |
| |||
MDA-MB-468 parental
|
MDA-MB-468 transfected
| ||
miRNA | Count ± SD | miRNA | Count ± SD |
| |||
let-7f-5p | 265,322.95±28,671.87 | let-7f-5p | 284,627.19±31,730.98 |
let-7i-5p | 235,059.66±20,017.95 | let-7i-5p | 187,056.07±30,924.33 |
let-7a-5p | 92,998.25±9,551.52 | let-7a-5p | 92,984.74±14,147.88 |
miR-99b-5p | 78,640.71±22,892.91 | miR-92a-3p | 85,018.48±14,067.98 |
miR-92a-3p | 75,727.64±7,097.75 | miR-99b-5p | 64,627.71±7,761.79 |
miR-151a-3p | 73,088.61±32,556.30 | let-7g-5p | 62,517.17±6,768.50 |
let-7g-5p | 50,292.17±10,045.56 | miR-21-5p | 49,269.32±7,542.30 |
miR-21-5p | 43,287.45±14,869.30 | miR-151a-3p | 43,104.23±13,278.15 |
miR-25-3p | 38,646.33±3,045.93 | miR-25-3p | 40,277.41±1,076.45 |
miR-30a-3p | 35,921.06±9,828.02 | miR-26a-5p | 33,429.91±3,036.12 |
Data are mean normalized readcounts for three replicates each. SD, standard deviation.
Cellular miRNAs significantly regulated by GR.
miRNA | log2FC | baseMean | P-adj | |
---|---|---|---|---|
MDA-MB-231 | miR-221-5p | 1.13 | 223.75 | 0.0010 |
miR-576-3p | 1.11 | 53.47 | 0.0071 | |
let-7b-3p | −1.10 | 88.78 | 0.0118 | |
MDA-MB-436 | miR-203a-3p | 1.35 | 134.76 | 0.0301 |
miR-4746-5p | −1.07 | 74.25 | 0.0444 | |
MDA-MB-468 | miR-1260a | −1.54 | 291.24 | 0.0003 |
miR-1260b | −1.54 | 335.12 | 0.0001 |
Positive fold changes indicate upregulation during GR overexpression. GR, glucocorticoid receptor; log2FC, log2 fold change; P-adj, DESeq2-adjusted P-value.